ID: 1129831767

View in Genome Browser
Species Human (GRCh38)
Location 15:78675471-78675493
Sequence CCTGAAGTCCTGGGCAGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129831767_1129831776 7 Left 1129831767 15:78675471-78675493 CCTGCGCTGCCCAGGACTTCAGG 0: 1
1: 0
2: 2
3: 22
4: 236
Right 1129831776 15:78675501-78675523 CCTCCCAAGCTAATGGCTAATGG 0: 1
1: 0
2: 0
3: 5
4: 79
1129831767_1129831772 0 Left 1129831767 15:78675471-78675493 CCTGCGCTGCCCAGGACTTCAGG 0: 1
1: 0
2: 2
3: 22
4: 236
Right 1129831772 15:78675494-78675516 GCCCAGACCTCCCAAGCTAATGG 0: 1
1: 0
2: 2
3: 23
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129831767 Original CRISPR CCTGAAGTCCTGGGCAGCGC AGG (reversed) Intronic
900717894 1:4156888-4156910 CCTGGAGGCCTGGGCAGCACAGG - Intergenic
900960424 1:5915595-5915617 CCTGCAGTCCTGGGCTGCCTGGG - Intronic
901012944 1:6211325-6211347 CCTGAAGTCCATGGCAGACCGGG + Intronic
901400752 1:9013814-9013836 CCTGGATTCCAGGGCAGCGCCGG - Intronic
901464788 1:9414036-9414058 CCTGCAGCTCTGGGAAGCGCTGG - Intergenic
903244449 1:22005568-22005590 CCTGTGGCCCTGGGCAGCGGGGG + Intronic
903573251 1:24321878-24321900 CCCGCAGCCCTGGGCAGCCCCGG + Intronic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
904333799 1:29784361-29784383 CCTGGAGGCCTGGGCCGTGCAGG - Intergenic
904459357 1:30666456-30666478 TCTGAAGTTCTGGGCAGTTCAGG - Intergenic
904623121 1:31787455-31787477 CCCGAAGACCAGGGCAGAGCAGG - Intergenic
905250235 1:36643661-36643683 CCTGACGACCAGGGCAGCACTGG + Intergenic
905303946 1:37004893-37004915 CCTGCAGTGCTGGGCCGGGCTGG - Intronic
905420626 1:37841152-37841174 CCTGGTGTGCTGGCCAGCGCGGG - Intronic
906202085 1:43966825-43966847 TCTGAAGTCCTGGGCAGGGGAGG - Intronic
906480786 1:46197846-46197868 CCTGAAGTCATGGGCTGGCCAGG - Exonic
907413713 1:54299859-54299881 CCTGAAGGCCTCGGCTGAGCTGG - Intronic
910667374 1:89739751-89739773 CCTGACAGCCTGGGCAGCCCAGG + Intronic
913222160 1:116667912-116667934 CCGGAGGACCTGGGCAGGGCTGG + Intergenic
913345962 1:117811411-117811433 CCTGAAGTCTTGGGCACCATAGG + Intergenic
914666524 1:149837415-149837437 ACTGAAGTCCTCGCCAGCTCTGG - Intergenic
914669243 1:149856383-149856405 ACTGAAGTCCTCGCCAGCTCTGG + Intronic
915153734 1:153857184-153857206 CCTAAAGTGCTGGGCATTGCTGG - Intronic
915270639 1:154750909-154750931 GCTGAAGGCCTGGGCAGCAGGGG + Intronic
916171088 1:162002239-162002261 ACTGGAGTCCTGGGGAGAGCAGG - Intronic
917695674 1:177520766-177520788 CCTCAAGTCCTGATCAGAGCAGG - Intergenic
919097968 1:193059713-193059735 GGAGAAGTCCTGCGCAGCGCTGG - Intronic
921692273 1:218164943-218164965 CCTCCAGTCCCGGGCGGCGCCGG + Intergenic
922169524 1:223143137-223143159 CCCTAAGTCGTAGGCAGCGCGGG - Intronic
924626842 1:245702633-245702655 TCTGAAGTCCTGGGGAGCGGGGG - Exonic
1063704686 10:8419482-8419504 CCTGCAGTGCTGGTCAGGGCAGG + Intergenic
1066000571 10:31101219-31101241 CTTGAAGTGCTGGGAAGCCCAGG - Intergenic
1066045869 10:31595224-31595246 CCTGTAGTCCTGGGAAGCTGAGG + Intergenic
1067075253 10:43175541-43175563 CCTGAATTCATGGGCTGCCCAGG + Intronic
1067091970 10:43271714-43271736 GCTGAAATCCTGGGAAGAGCTGG - Intergenic
1069851510 10:71408496-71408518 CCTGAAGTGCTGGTGACCGCTGG + Intronic
1070130977 10:73655355-73655377 ACTGAAGGCATGGGCAGGGCAGG + Intronic
1073647917 10:105325370-105325392 CTTGAAGGCCTGGGGAGGGCAGG + Intergenic
1073959742 10:108912410-108912432 CCTCAAGTCCTGTGCTGCCCAGG - Intergenic
1075689269 10:124384802-124384824 ACTGAGGTGCTGGGCAGTGCTGG - Intergenic
1075703470 10:124484184-124484206 GCAGAAGTCCCGGGCAGAGCTGG + Exonic
1076515898 10:131044260-131044282 CCTTCACTCCTGGGGAGCGCTGG + Intergenic
1076515934 10:131044411-131044433 CCCTCAGTCCTGGGGAGCGCTGG + Intergenic
1076515941 10:131044437-131044459 CCCTCAGTCCTGGGGAGCGCTGG + Intergenic
1076769352 10:132654542-132654564 CCCGGGGTCCTGGGCAGAGCTGG + Intronic
1076823474 10:132954432-132954454 CCTGATTTTCTGGGCAGGGCTGG - Intergenic
1076847438 10:133076207-133076229 CCTGACGTCCTGGGCAGCCTTGG + Intronic
1077053767 11:580031-580053 CCTGAACTCGAGGGCAGCTCTGG + Intronic
1077501320 11:2910961-2910983 CATGAAGTGCTGGGGGGCGCAGG - Intronic
1079130784 11:17745722-17745744 CCTCAAGACCTGCGCTGCGCTGG + Intronic
1081569122 11:44278698-44278720 TCTGAAGTCCTGAGAAGAGCGGG - Intronic
1083301068 11:61739841-61739863 CCTGGAGTCCTGCTCAGGGCTGG - Intronic
1083348709 11:62012256-62012278 CCTGGTGTACTGGCCAGCGCAGG + Intergenic
1085279177 11:75319237-75319259 CCTCAAGCCCTGGGGAGCCCTGG + Intronic
1085408345 11:76277293-76277315 CCTGAAGACCTGGGGTGCACGGG - Intergenic
1088751391 11:112844910-112844932 TGTGAAGTCCTGGGCAGCAGGGG - Intergenic
1089296458 11:117471829-117471851 CCTGAGGCCATGGGCAGGGCAGG + Intronic
1091666289 12:2420714-2420736 CCTGGGGTGCTGGGCAGAGCCGG + Intronic
1091685175 12:2556352-2556374 CCTGAAGACCTGGGGACCTCTGG - Intronic
1092172832 12:6384280-6384302 CCCGACGTCCTGGGCAGCGGTGG - Exonic
1096547205 12:52348264-52348286 GCTGAGGTCCTGGGTAGAGCAGG + Intergenic
1102471931 12:113164117-113164139 CCTGCAGTGCTGGGCGGCTCGGG + Exonic
1102683521 12:114706353-114706375 GGTGAAGTTCTGGGCAGCTCTGG + Intergenic
1103764165 12:123269985-123270007 CCTGAAGTCCTGTTCTGGGCTGG - Intronic
1103841883 12:123871792-123871814 CCTGGAGGCCTGGGTAGAGCTGG + Intronic
1104895776 12:132162992-132163014 ACCGAAGTCATGGGCAGGGCGGG + Intergenic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1108978007 13:56473807-56473829 CTAGAAGTCCTGGCCAGAGCAGG - Intergenic
1113608340 13:111626174-111626196 CCTGAACTTCTGTGCAGTGCTGG + Intronic
1115755916 14:36525630-36525652 CCCCAAGTCCTAGGCAGCGAGGG - Intergenic
1120988640 14:90355578-90355600 CCTGAAGTCATGGGTACCCCAGG - Intergenic
1121001080 14:90452523-90452545 CCCGAAGGCCTGGGCAGGGGAGG + Intergenic
1121011387 14:90522217-90522239 CCTGAAGGCCTGGGCCGGGAGGG + Intergenic
1122159608 14:99773767-99773789 TCTGAGGACCTGGGCAGGGCCGG - Intronic
1122724292 14:103740160-103740182 CATGAAGTCCTGGGAGGGGCTGG + Exonic
1122922028 14:104884269-104884291 CATGAAGTCCTGGGCCAGGCGGG - Exonic
1123154174 14:106208573-106208595 CCAGAAGTCCTGGGCACCAACGG - Intergenic
1124575716 15:30906459-30906481 CCTGAAGTCCTTGGCAGCCAGGG + Intronic
1124745766 15:32341671-32341693 CCCGAAGTGCTGGGAAGTGCTGG - Intergenic
1127207154 15:56733196-56733218 GCTGCAGGCCTGGGCCGCGCAGG - Intronic
1127287091 15:57541723-57541745 CATGAAGTAATGGGCAGTGCAGG + Intronic
1129030332 15:72612833-72612855 CTTGAAGACCTGGCCAGAGCTGG + Intergenic
1129209909 15:74062457-74062479 CTTGAAGACCTGGCCAGAGCTGG - Intergenic
1129220329 15:74128555-74128577 CCTGCAGTCCAGGGAAGCTCTGG + Exonic
1129278133 15:74461077-74461099 GCTGGGGCCCTGGGCAGCGCGGG - Exonic
1129831767 15:78675471-78675493 CCTGAAGTCCTGGGCAGCGCAGG - Intronic
1130510884 15:84588188-84588210 CCTGGAGACCCGGGCAGGGCGGG + Intergenic
1131284223 15:91044007-91044029 CGGGAAGTCCTGGGCAGCGCAGG + Intergenic
1132261084 15:100425376-100425398 CCTAAGGCCCTGGGCAGCTCTGG - Intronic
1132520231 16:383890-383912 CCTGAAGGCCAGAGCAGCGGAGG + Intronic
1132618904 16:855231-855253 CCTGAAGCCCTGGGAAGCAGAGG - Intronic
1132774633 16:1586200-1586222 CCAGACTTCCTGGGCAGCCCCGG - Exonic
1132930001 16:2454232-2454254 CCTCAACTCCTGGGGAGCCCTGG + Intronic
1133054605 16:3139288-3139310 ACTGCAGGGCTGGGCAGCGCCGG - Intronic
1136242458 16:28952418-28952440 TCTGTAGTCCTGGGCGGGGCAGG + Intronic
1138772827 16:59686083-59686105 CCTAAGGTCTTGGGCAGCTCTGG + Intergenic
1139350095 16:66329511-66329533 CCCGAGGTCCTGGGCATGGCTGG - Intergenic
1141095210 16:81158347-81158369 CCTTCAGTCCTGGGCAACCCGGG + Intergenic
1143450888 17:7036168-7036190 ACTGAAGACCTGGCCCGCGCTGG - Exonic
1144640127 17:16932334-16932356 CCTGTGGTCCTGGGGAGCCCAGG + Intronic
1145285377 17:21502080-21502102 GCTGACGTCCTGTGCAGTGCTGG + Intergenic
1145799525 17:27673964-27673986 CCTTAAGTCCAGTGCAGCACAGG + Intergenic
1146054850 17:29575898-29575920 TCTGAAACCCAGGGCAGCGCTGG + Exonic
1146472417 17:33135188-33135210 CCTGAGGTCCTGGGCAGCTGGGG - Intronic
1147265557 17:39232262-39232284 CCTGAACCCCTGGGCTGCCCCGG - Intergenic
1147419099 17:40313227-40313249 CCACAGGTCCTGGGCAGGGCAGG - Intronic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1148392840 17:47285489-47285511 CCTGTAGTCCTGGGGACTGCAGG - Intronic
1148756655 17:49976608-49976630 CCTGAGCTCCTGGGCAGTGATGG + Intergenic
1151481207 17:74370960-74370982 TCTGAAGGCATGGGCAGCACGGG - Intronic
1151551431 17:74824650-74824672 CCTGCGGTCCTCGGCAGCCCAGG - Intronic
1151942590 17:77301925-77301947 TCTGAACCCCTGGGCAGAGCAGG - Intronic
1152000868 17:77644635-77644657 CCTGGGATCCTGGGCAGGGCAGG + Intergenic
1152611183 17:81315649-81315671 CGAGAAGACCTGGGCAGCTCTGG - Intronic
1152779271 17:82219211-82219233 CCTGGAGGCCGGGGCAGCGATGG + Intergenic
1155331949 18:24727759-24727781 CCTGAAGTCCTTGCCACCGAGGG + Intergenic
1157057373 18:44246760-44246782 CCTGGAATCCTGGGCTGAGCTGG - Intergenic
1158064257 18:53386663-53386685 CCTGAGGCCCTGGGCACTGCTGG - Intronic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160926133 19:1546873-1546895 CCTGAATTACTGGGCGGCGGTGG - Intergenic
1161490699 19:4559650-4559672 CCAGAAGGCCAGGGCAGGGCTGG - Exonic
1161810119 19:6466695-6466717 CCCGCAGTCCTGGGCAGTGTTGG - Intronic
1162904133 19:13813402-13813424 CCTGCAGTCCTGGGCTGGTCTGG + Intronic
1164884051 19:31761738-31761760 CCTGCAGTCCTGGGCTTGGCAGG + Intergenic
1165039369 19:33058232-33058254 CCTGGAGTGCTGAGCAGTGCTGG - Intronic
1165070399 19:33252005-33252027 CCTGCCCTCCTGGGCAGAGCAGG + Intergenic
1165342727 19:35224390-35224412 CCTGAAGGCCTGGGCACAGTGGG + Intergenic
1165487674 19:36105223-36105245 CCTGAACTTCTTGGGAGCGCTGG - Intergenic
1165794422 19:38510723-38510745 GCTAAAGTGCTGGGCAGCGGTGG + Exonic
1166000581 19:39875323-39875345 CCTACAGTCCTGGGAAGGGCAGG + Intronic
1166003379 19:39891578-39891600 CCTACAGTCCTGGGAAGGGCAGG + Intronic
1167070952 19:47221723-47221745 CCTGACACCCTGGCCAGCGCGGG - Exonic
1167463166 19:49636911-49636933 TCTGCAGTCCTGGACACCGCGGG - Exonic
1167476849 19:49706258-49706280 CCTGAAGACCCAGGCAGCGGAGG + Exonic
1168714717 19:58520009-58520031 CCTGATCTCCTGGGCGACGCCGG - Exonic
926043644 2:9693922-9693944 CTCGAAGACTTGGGCAGCGCTGG - Intergenic
926758296 2:16253349-16253371 CCTGAAGACCAGAGCAGCGTGGG - Intergenic
927898522 2:26801915-26801937 CCTGAAATCCTCGGCTGGGCTGG + Intergenic
927900999 2:26818369-26818391 CCTGAAAGCCTGGGCAGGACTGG + Intergenic
930691927 2:54373318-54373340 TGTGAAGGCCTGGGCAGCCCAGG - Intronic
932306875 2:70710187-70710209 CCTGGAGTCCTAGGGAGCACAGG - Intronic
932776192 2:74529740-74529762 CCCGAAGTCCTGAGGCGCGCCGG + Exonic
934851610 2:97705487-97705509 CCTGATGTACTGGACAGAGCTGG + Intergenic
934884017 2:98008590-98008612 CATGAACTCCTGGGAAGAGCTGG - Intergenic
937245180 2:120487961-120487983 CCTGAGGTGCCGGCCAGCGCGGG - Intergenic
937354282 2:121188186-121188208 TCTGAAGTCCTGGGCAGCCAAGG - Intergenic
938319156 2:130351522-130351544 TCTGAAGTCCTAGGCAATGCAGG - Intergenic
942061266 2:172230749-172230771 CCTGAATTCCTGGGCAGCCTCGG - Intergenic
944596275 2:201264472-201264494 CCTGAACTCCTGGGCCACGTTGG + Intronic
946015683 2:216602360-216602382 ACTGGAGTCCTGGGCAGGGTTGG - Intergenic
947746164 2:232508381-232508403 TAGGAAGTCCTGGGCAGCCCTGG - Intergenic
948466064 2:238152157-238152179 CCAGAGGCCCTGGGCAGCTCCGG + Exonic
948496413 2:238352564-238352586 CCAGGAGGCCTGGGCAGCACAGG + Intronic
948700494 2:239756711-239756733 CCTGGACTCCTGGGCATTGCTGG + Intergenic
949044580 2:241866634-241866656 CCTGCCCGCCTGGGCAGCGCTGG + Intergenic
949072227 2:242032736-242032758 CCTGAAATCGTGAGCAGAGCTGG - Intergenic
1169093088 20:2873278-2873300 CCCGAAGGACTGGGCAGCCCCGG + Intronic
1172099594 20:32477193-32477215 CCACAAGTCCAGGGGAGCGCTGG - Intronic
1172389667 20:34558533-34558555 CGTGACGTCATGGGCAGCGCGGG - Intronic
1172804067 20:37598546-37598568 CCTGAACTCCTGGGGAGGGAGGG + Intergenic
1173200456 20:40950986-40951008 CCTGAAGGCGTGGGCAGAGTTGG - Intergenic
1173310786 20:41894538-41894560 CCTGAGGTCCTGGCCAGGGTGGG + Intergenic
1173333134 20:42092228-42092250 CTTGAAGTCATGGGCATTGCTGG + Intronic
1173618483 20:44418525-44418547 CCTGGAGCCCTGGCCAGGGCAGG - Intronic
1173622741 20:44449142-44449164 CCTGGAGACCTGGGCTGCTCTGG + Intergenic
1173744512 20:45426258-45426280 CCTTGAGTCCTGGGAAGAGCTGG + Intergenic
1175026380 20:55907071-55907093 CCTTCAGTCCTGGGCAGACCAGG - Intergenic
1175683486 20:61008855-61008877 AATGAAGTCCTGGGGAGCGCTGG - Intergenic
1175746267 20:61459467-61459489 ACTGGAGTCCTGGGGGGCGCAGG - Intronic
1176670790 21:9734014-9734036 CCTGCAGTCTTGGGCAGCCAGGG + Intergenic
1179791810 21:43760069-43760091 CCTGTAGCCCTGGGCAGAGCTGG + Exonic
1180782549 22:18529185-18529207 CCTGAAGGCGTGGGCGGGGCGGG + Intronic
1181126101 22:20703214-20703236 CCTGAAGGCGTGGGCGGGGCGGG + Intergenic
1181239440 22:21468523-21468545 CCTGAAGGCGTGGGCGGGGCGGG + Intergenic
1181366661 22:22381603-22381625 ACTGAAGTCCTGGGCTGAGGTGG + Intergenic
1181373029 22:22432726-22432748 ACTGAAGTCCTGGGCTGAGGTGG + Intergenic
1181509404 22:23382335-23382357 GCTGGAGTCCTGGGCTGAGCTGG - Intergenic
1181852158 22:25757303-25757325 CTTGAAGTCCTGGTCAGGCCAGG + Intronic
1182092175 22:27603298-27603320 CCAGAAGACCTGGGCAGCGTTGG + Intergenic
1183149979 22:36029166-36029188 GCTGGAGTGCGGGGCAGCGCGGG + Intergenic
1184474310 22:44712297-44712319 GATGAAGCCCTGGGCAGAGCTGG + Intronic
1184561986 22:45268766-45268788 CCTGATGTCCCTAGCAGCGCCGG + Intergenic
1185276115 22:49950818-49950840 TCAGGAGTCCAGGGCAGCGCAGG + Intergenic
1185297107 22:50059800-50059822 TCTGCAGTCCTCGGCAGCTCCGG - Exonic
1185327411 22:50233774-50233796 CCTGGGGTCCTGGGCATGGCCGG + Intronic
949641637 3:6042111-6042133 CCTGCAGTCCTTGGCAGTGCTGG + Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950692311 3:14669642-14669664 GCTGGAGTCCTGGGCTGGGCTGG - Intronic
951466368 3:23004474-23004496 CCTGTAGTCCCTGGCAGTGCTGG + Intergenic
953409670 3:42683557-42683579 CCTGCAGTCCAGGGCTGGGCTGG + Intergenic
954387543 3:50252203-50252225 CCTGTAGTCGGGGGCAGTGCAGG - Intronic
954423361 3:50430450-50430472 CCAGAAGTGCTGGGCAGGGAGGG + Intronic
961193936 3:124985698-124985720 CCCCCACTCCTGGGCAGCGCAGG - Intronic
968609366 4:1550185-1550207 CCTGAGGGCCCGGGCAGTGCAGG - Intergenic
968642816 4:1722762-1722784 CGTGAGGACCTGGGCAGCCCTGG + Intronic
968671650 4:1855582-1855604 TCTGAAGGGCTGGGCAGCCCTGG - Intronic
971620476 4:28848938-28848960 CCTGAGGTCCTAGACAGGGCGGG + Intergenic
973634905 4:52852762-52852784 ACTGTAGTCCTGTCCAGCGCAGG - Intergenic
985403989 4:189617530-189617552 CCTGCAGTCTTGGGCAGCCAGGG - Intergenic
985508342 5:298124-298146 CCTGAAATCATGAGCAGAGCTGG - Intronic
985739701 5:1607548-1607570 CCTGAAATCATGAGCAGAGCTGG + Intergenic
985775643 5:1840444-1840466 CCTGAAGGCCTCAGCAGGGCTGG - Intergenic
986273581 5:6254383-6254405 CCTGAAGTCCAGAGCAGCTATGG - Intergenic
987070505 5:14333087-14333109 CCTGCAGTCCTCAGCAGCACTGG + Intronic
989236829 5:39157823-39157845 CCTGTAGTAGTGGGCAGAGCTGG + Intronic
990003504 5:50921640-50921662 CCTGAGGGCCCGGGCAGTGCAGG + Intergenic
998599923 5:143575078-143575100 CCTGAAGGGCTGGGAAGCGAAGG - Intergenic
998914009 5:146994687-146994709 TCTGAAGTGTTGGGCAGAGCGGG - Intronic
1001429665 5:171649230-171649252 CCTGAAGTGCTAGGCAGAGAAGG + Intergenic
1002078921 5:176726419-176726441 CCTGGTGTCCTCGGCAGTGCTGG - Intergenic
1002375882 5:178788901-178788923 CCTGGAGCCCTGGGCAGAGCCGG + Intergenic
1002494046 5:179599765-179599787 CCTGCAGCGCTCGGCAGCGCAGG - Intronic
1002792504 6:446504-446526 GCTGCAGTGCTGGGCAGCCCTGG + Intergenic
1003872083 6:10411704-10411726 ACTGGAGTCCTGGGTGGCGCGGG - Intronic
1004241365 6:13925100-13925122 CCCGCAGTCCTGGACGGCGCCGG + Intronic
1004455357 6:15786869-15786891 CCTGAAGTCCTGAGCAAAGAAGG + Intergenic
1005997380 6:30939693-30939715 CCCTAAGCCCTGGGCAGGGCTGG - Intergenic
1006388611 6:33746122-33746144 CCTGATGCCCTGGGCAGTGGTGG - Intronic
1012578705 6:100836258-100836280 CTTGAAGTCCTAGCCAGAGCAGG - Intronic
1017324775 6:153131637-153131659 GCTGCTGTCCTGGGCTGCGCGGG + Intergenic
1024333249 7:48177860-48177882 CCTGAAGGCCAGGGAAGCCCAGG - Intronic
1029111426 7:98214734-98214756 CAGGAAGCCCTGGGCTGCGCTGG - Exonic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1029145594 7:98443529-98443551 CCTGGTGTCAGGGGCAGCGCAGG + Intergenic
1029646096 7:101857003-101857025 TCTGAAGTCCTGCCCAGCTCCGG + Intronic
1031382514 7:121105046-121105068 CCTGAAGGCCAGTGCAGCGGTGG - Intronic
1032721384 7:134553176-134553198 CATGAATTCCTGGGCACCGTGGG + Intronic
1032760139 7:134932899-134932921 GCTGTAGTCCTGGGTAGCACAGG + Intronic
1033551246 7:142450291-142450313 CCCTAGGTCATGGGCAGCGCTGG + Intergenic
1033553933 7:142471710-142471732 CCTGAAGCTCTGGGCAGGACAGG + Intergenic
1033813557 7:145046120-145046142 CCTGAGCTCCAGGGCAGTGCAGG - Intergenic
1034729311 7:153370239-153370261 GCTGAAGGCCTGGGGAGTGCAGG + Intergenic
1035338277 7:158143946-158143968 GCTGCAGTCCTGGGGAGCTCCGG - Intronic
1035662625 8:1359374-1359396 TCTGAAGCCCAGGGCAGCACAGG - Intergenic
1035705231 8:1669968-1669990 CCTGCAGCCCTGGGCCTCGCTGG + Intronic
1036692279 8:10951570-10951592 CCTGAAGTCCGGGGAAGTGCAGG - Intronic
1037235360 8:16714015-16714037 GATGAAGTCCTGGACAGGGCTGG - Intergenic
1037772352 8:21809970-21809992 CCTACAGTCCTGGGCAGAACTGG + Intronic
1039455629 8:37704022-37704044 CCTGGAGTCCAGGGTAGGGCAGG + Intergenic
1040794143 8:51271261-51271283 CCACAAGTGCTGGGCAGCCCTGG - Intergenic
1044802139 8:95968252-95968274 TCAGAAGTCTTGGGCAGCACTGG - Intergenic
1047463456 8:125090908-125090930 CCTGAAATCCTGGGAAAGGCAGG + Intronic
1048572288 8:135666113-135666135 CCTGGAGTGCTGGGCAGCACAGG + Intergenic
1048759736 8:137780873-137780895 ACTGAAATCCTGGGCAGGGTGGG + Intergenic
1049017275 8:139929772-139929794 CCAGCAAGCCTGGGCAGCGCTGG + Intronic
1049205604 8:141362058-141362080 CCTGGACTGCTGGGCAGGGCTGG + Intronic
1049229737 8:141475697-141475719 CCTGCAGGGCTGGGCAGCACCGG + Intergenic
1049605522 8:143527420-143527442 GCTGAAGACCTGGGCTGCGCAGG - Intronic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049617341 8:143581382-143581404 CCTGCAGTCCTGAGCATGGCAGG - Intronic
1049749260 8:144275725-144275747 CCTGATGTTCTGGGCAGTGGTGG - Intronic
1050428764 9:5539774-5539796 CCTGAAGGCCTGGGCAGGGCAGG + Intronic
1050959705 9:11713006-11713028 CCTGAGGTCTTGGGCAGGACTGG + Intergenic
1053383158 9:37665770-37665792 CCTGAAGTCTTTGGCAACGTTGG + Intronic
1058456589 9:105143439-105143461 CCTGAAGGCCAGGGCTGCTCAGG - Intergenic
1058862826 9:109133591-109133613 TCTAAAGTCCTGGCCAGCACTGG + Exonic
1061497410 9:130982870-130982892 CGTGCCCTCCTGGGCAGCGCAGG - Intergenic
1188440334 X:30209781-30209803 CCTGAGGTCCTGAGGAGAGCCGG + Intergenic
1191183597 X:57587222-57587244 CAGGAAGTCCTGGGTAGGGCTGG + Intergenic
1196828257 X:119757941-119757963 GCTGGAATCCTGGGCAGCCCCGG + Intergenic