ID: 1129832829

View in Genome Browser
Species Human (GRCh38)
Location 15:78681838-78681860
Sequence GGGCCTCCCTGGGTGCACCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129832823_1129832829 -6 Left 1129832823 15:78681821-78681843 CCTGGCCATATGGCTCAGGGCCT 0: 1
1: 0
2: 3
3: 15
4: 188
Right 1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG 0: 1
1: 0
2: 2
3: 19
4: 208
1129832822_1129832829 -5 Left 1129832822 15:78681820-78681842 CCCTGGCCATATGGCTCAGGGCC 0: 1
1: 0
2: 1
3: 14
4: 144
Right 1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG 0: 1
1: 0
2: 2
3: 19
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129832829 Original CRISPR GGGCCTCCCTGGGTGCACCG GGG Intronic
900505664 1:3028840-3028862 GGGCCTCCCTGGGGGTCCCCAGG + Intergenic
900610287 1:3541811-3541833 GGGGCTCCCTGGGGGCACCGTGG + Intronic
900753536 1:4416813-4416835 GAGCATCCATTGGTGCACCGAGG + Intergenic
901876265 1:12168564-12168586 GGGCCTGCCTGGGTGAACTCTGG + Intronic
901973904 1:12929576-12929598 GTGCCTCCAGGGGTGGACCGTGG - Intronic
902644397 1:17788452-17788474 GGCCCTGCCTGGCTGCTCCGAGG - Intronic
903810403 1:26032005-26032027 GAGCCTTCCTGTGTGCACCCTGG - Intronic
904583683 1:31566741-31566763 GGGCCTCCCTGGGCTCCCGGAGG - Intergenic
912568512 1:110605965-110605987 GGGCCTCCCTGGGTTGATCCAGG + Intronic
914844132 1:151271664-151271686 GGGCCTCCCTGGGAGTAAGGAGG + Intergenic
915409254 1:155688138-155688160 CCGCTTCCCTGGGTCCACCGCGG + Exonic
917389059 1:174512731-174512753 ATGCCTCACTGGGTGCACTGGGG + Intronic
919927905 1:202202002-202202024 GGTCCTCCCTGGATGCTCCCAGG - Intronic
921390384 1:214608649-214608671 GGGCCTCCTCGGGCGCACCCGGG - Intronic
1063375920 10:5554083-5554105 GGAAATCCCAGGGTGCACCGAGG - Intergenic
1064080125 10:12301719-12301741 GGGCCTCCCAGGTTCCACAGTGG + Intergenic
1065102079 10:22340958-22340980 GGGCCTCCCGGGGCGGACCCGGG - Intergenic
1067737465 10:48869288-48869310 GGGCCTCATTTGGTGCACCTGGG - Intronic
1069832683 10:71290849-71290871 GGGCCTCCCTGATTGCCCCAGGG + Intronic
1070148249 10:73789897-73789919 AGGCCTCCATGGGTTCACCTAGG + Intronic
1070793531 10:79203679-79203701 GGCCCTCCCTGGGTCCATCTTGG + Intronic
1074769597 10:116724761-116724783 TGGCCTCACTGGGTGCCCTGCGG + Intronic
1075092265 10:119450504-119450526 GGGCCTCCGTGCGTGCACCCAGG + Intronic
1075900344 10:126038044-126038066 GGGCTTCCATGGGGGCACCGTGG + Intronic
1076797884 10:132807624-132807646 TGGGCTCCATGGGTGCAGCGTGG + Intergenic
1076849208 10:133084826-133084848 GGGCCCACCTGGCTGCAGCGGGG + Intronic
1076917782 10:133433103-133433125 GCCCCGCCCTGGGTGCAGCGTGG + Intergenic
1076937776 10:133577178-133577200 GCCCCGCCCTGGGTGCAGCGTGG + Intergenic
1077051080 11:567307-567329 GGGCCACCCTCAGTGAACCGGGG - Intergenic
1077332279 11:1988923-1988945 GGGCCTCCCTGGATGGTCCTGGG + Intergenic
1077405459 11:2380557-2380579 TGGGCTCCCTGGGTGCGCGGCGG + Intronic
1078098297 11:8313637-8313659 GGTCCTCCCTGGGTGCAGTGGGG + Intergenic
1080635273 11:34118255-34118277 GGGCCTCCATGGTGGCAACGTGG - Exonic
1083307981 11:61770621-61770643 TGCCCTCCCTGGGTGCATCCCGG - Intronic
1083698099 11:64456001-64456023 GGGCCTCCCTGGGAGGGCTGTGG - Intergenic
1084208402 11:67609364-67609386 AGGCCTCCCTGGGTGGAGTGGGG + Intronic
1084496173 11:69504980-69505002 GGGCCTCCCTGGATGAAGTGGGG + Intergenic
1084939247 11:72603531-72603553 AGGCCTCCCAGGCTGCTCCGAGG + Intronic
1088500628 11:110478843-110478865 GGGACTGCCTGGAGGCACCGAGG + Intergenic
1089248092 11:117137244-117137266 GGGCCTCACTGGGTGCCCTTAGG - Intergenic
1089258621 11:117207317-117207339 GGGCCTCACTGGGTGCCCTTAGG + Intronic
1089683658 11:120133510-120133532 GGGCCTCTCTGGGTGCTAAGGGG - Intronic
1091195931 11:133730725-133730747 GGGCCTCCCTGGGTGCTTAAGGG - Intergenic
1091315398 11:134610732-134610754 GGGTCTCCCTGGCTGCCTCGAGG + Intergenic
1202815260 11_KI270721v1_random:44099-44121 GGGCCTCCCTGGATGGTCCTGGG + Intergenic
1091648295 12:2290330-2290352 GGGCCTCCCTGGGCTCAGCTGGG + Intronic
1094854988 12:34398904-34398926 GGCCCTCCGTGGGTGCAACCGGG - Intergenic
1096430370 12:51538158-51538180 GGACCTCCCTGGGTGCGCGGGGG + Intergenic
1105204256 13:18206965-18206987 GGGTGTCCCTGGGAGGACCGTGG - Intergenic
1105854393 13:24361754-24361776 TGGGCACCCTGGGTGCACCAAGG - Intergenic
1107133398 13:36919909-36919931 GAGCCTCCCAGGCTGCCCCGAGG + Intronic
1113660894 13:112105670-112105692 GGGAGGCCCTGGGTGCATCGCGG + Intergenic
1113835311 13:113325184-113325206 GGGCCACTCTGGGTGCAGCATGG - Exonic
1113911969 13:113846487-113846509 GCGCCTTCCTGGGAGCACTGTGG - Intronic
1113941717 13:114021849-114021871 GGGCGTCGCTGCGTGCACCCAGG + Intronic
1115029204 14:28774461-28774483 GGGCCGCCCTGGCTGCGCGGTGG + Intronic
1118737024 14:68708485-68708507 GGGACTCTCTGGGTGAACCTCGG + Intronic
1119228002 14:72958735-72958757 GGGGCTCCCGGGGCGCGCCGGGG + Exonic
1121930454 14:97967189-97967211 GGCCCCACCTGGGTGCACAGGGG - Intronic
1122100634 14:99406883-99406905 GGGCCTCCCTGGTGGCAGTGAGG + Intronic
1122843161 14:104476593-104476615 TGGGCACCCTGGGTGCACCAAGG - Intronic
1122872286 14:104644589-104644611 GGGCCTGCCTGGGTGCTGCTTGG - Intergenic
1123450466 15:20356705-20356727 GGGCCCCGCAGGGTGCACAGAGG + Intergenic
1124130728 15:26983319-26983341 GGGGCTCCCAGGGTGTACCAGGG - Intronic
1125731371 15:41894359-41894381 GGGCCTCTCTGTGAGCACCCAGG + Intergenic
1127790219 15:62391948-62391970 GGGCTCGCCTGGGTGCTCCGAGG + Intronic
1129832829 15:78681838-78681860 GGGCCTCCCTGGGTGCACCGGGG + Intronic
1130338062 15:82974618-82974640 GGGGCTCCCTGGGGGCACTTGGG + Intronic
1131029974 15:89178416-89178438 GGGCCTCCCCGGCTCCACCTTGG - Intronic
1131944981 15:97609596-97609618 TGGCATCCCTGGATGCACCTGGG + Intergenic
1132842799 16:1986425-1986447 GGGCATCCCTGGCTGCATAGTGG - Exonic
1132872688 16:2122805-2122827 GGGCCTGCCTGTGTTCACCGTGG - Intronic
1133513565 16:6483963-6483985 GGCTCGCCCTGGGTGCCCCGTGG + Intronic
1133966139 16:10533131-10533153 GGGCTACCCAGGGTGCACTGTGG - Intronic
1134214647 16:12307704-12307726 GGGCCTGCCTGTCTGCACAGTGG + Intronic
1134228182 16:12408329-12408351 GGACCTCTCTGGGTCCACTGTGG + Intronic
1134551780 16:15142004-15142026 GGGCCTGCCTGTGTTCACCGTGG - Intergenic
1134823658 16:17267011-17267033 GGGCCTGCCTGCGTCCAGCGTGG - Intronic
1135413346 16:22251108-22251130 GGGCCTACCTGGGTACTCTGGGG - Intronic
1136024745 16:27462266-27462288 GGGCCTTCCTGGGTTCAGCAGGG - Intronic
1136098124 16:27973652-27973674 AGGCCTGCCTGGGTGCAGCCTGG + Intronic
1136540986 16:30927627-30927649 CGGCCTTCCTGGGTGCAGCGAGG - Exonic
1139420112 16:66844715-66844737 GGGCCACCCGGGGCGCAGCGCGG - Intronic
1141657753 16:85425092-85425114 GGCCCTCCCTGGGCGCCCTGGGG + Intergenic
1141673782 16:85506895-85506917 GGGCCTCCCTGGCTCAACAGGGG - Intergenic
1141683291 16:85556377-85556399 GCGCCTCCCTGGGTCCCGCGCGG + Intergenic
1142109802 16:88325285-88325307 CGGCCCCCCGGGGTGCACCTCGG - Intergenic
1142283603 16:89161726-89161748 GGGCCAGCCTGGGAGCACCATGG - Intergenic
1142492107 17:285994-286016 GGGCATCCCGGGGTGCACAGTGG - Intronic
1142509158 17:383902-383924 TCACCTCCCTGGCTGCACCGGGG - Intronic
1142509171 17:383943-383965 TCACCTCCCTGGCTGCACCGGGG - Intronic
1145799007 17:27671665-27671687 GGTACACCCTGGGTGCACCAGGG + Intergenic
1147160791 17:38568414-38568436 GGGCCATCCTGGGTACACCATGG - Intronic
1147366598 17:39963278-39963300 GGTGCTACCTGGGTGCACCTGGG - Intronic
1148813792 17:50312421-50312443 GGGCCTGCCTGGCTCCTCCGTGG + Intergenic
1148943849 17:51241002-51241024 GGGTCTCCCAGGCTGCACCCAGG + Intronic
1151550805 17:74821521-74821543 GAGCCTCCCTGGGTGCCAGGAGG + Intronic
1152252388 17:79218811-79218833 CGGCCTCCATGTCTGCACCGAGG - Intronic
1152529271 17:80907521-80907543 CGGCCTCTCTGGGTCCAGCGTGG + Intronic
1156462019 18:37326512-37326534 GGGCCTCCATGGGGACACTGAGG - Intronic
1157285300 18:46373471-46373493 TGGCCTGCCTGGGTGCATCCTGG + Intronic
1160011291 18:75108728-75108750 GGGCCTCCCTGCCTCCACCGAGG + Intergenic
1160673102 19:375624-375646 GGGCCTGCCTGGGTGCGGTGGGG - Intronic
1160991870 19:1863408-1863430 GGGCCGCCCGCGGTGCACCACGG + Exonic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1161318757 19:3631508-3631530 GGTCCTCCCTGCGTGCTCAGAGG - Exonic
1161498590 19:4600675-4600697 GTGACTCCCTGGGTGCAGAGGGG + Intergenic
1161709208 19:5838449-5838471 GGGTCTTTCTGGATGCACCGAGG - Intronic
1162412283 19:10513847-10513869 GGGCGGCTGTGGGTGCACCGGGG + Exonic
1163575606 19:18109524-18109546 GTGCCCCACTGGGTCCACCGGGG + Intronic
1164435414 19:28224374-28224396 GGGCCTCCCAGTGTGTACCAGGG + Intergenic
1165013500 19:32864849-32864871 GGGCCGCCCTGGCCGTACCGAGG - Intronic
925291668 2:2752159-2752181 GGGCCTCCCTGGGTGAGGAGAGG - Intergenic
925345735 2:3170818-3170840 GGGTCCCCCTGTGTGCACCGTGG - Intergenic
925918216 2:8622495-8622517 GGGCCTCCCTGGGGGCTGCAAGG - Intergenic
926035161 2:9630667-9630689 CGGCCTCCCCGGGTGCCCAGCGG - Intronic
927644775 2:24870666-24870688 GGTCATCCCTGGGTGCCCCAGGG - Intronic
929594895 2:43169822-43169844 GGTCCTCCCTGGGTGCCCGCCGG - Intergenic
931228090 2:60351375-60351397 GTGCCTTCCTGGGTGCAAAGTGG - Intergenic
932098391 2:68873099-68873121 GGGCCTCTCTGGCTGCACCCCGG - Intergenic
934538943 2:95159169-95159191 GCGCCGCGCTGGGCGCACCGGGG - Intronic
934728791 2:96642926-96642948 GAGCCTCCCTGGGTCCACATGGG + Intergenic
938383783 2:130850719-130850741 GGGCCTCCCTCGGTAGACAGGGG + Intronic
938479466 2:131647277-131647299 GGGTCTCCCTGCGGGCAGCGCGG - Intergenic
940650570 2:156436394-156436416 GCGCCTCGCTGGGAGCACCCGGG + Intronic
941043600 2:160649034-160649056 GGACCTCCCTGGCTTCACGGGGG - Intergenic
947536002 2:230940782-230940804 GAGTATCCCTGGCTGCACCGGGG + Intronic
948421480 2:237863125-237863147 AGGCCTCCCTGGGTCCCCAGTGG - Intronic
948506001 2:238427225-238427247 GCGGCTCCCTGGCTGCCCCGTGG - Intronic
949028632 2:241777860-241777882 GGGCCCCCCTGGCTGCCCTGGGG + Intronic
949048260 2:241882148-241882170 GGGCCTCCCCGGGTGCAGCGTGG + Intergenic
1170799198 20:19576528-19576550 AGGCCTCTCTGGGTGCCCAGAGG + Intronic
1172214705 20:33227061-33227083 AGGCCTCCCTGGGGGCTCCAGGG - Intronic
1173420044 20:42892979-42893001 GGCCTCCCCTGGGTTCACCGTGG - Intronic
1174038515 20:47682958-47682980 GGGCCTCCCTGGGTCCCTGGGGG + Intronic
1175524243 20:59622640-59622662 CGGCCTCTCTGTGTGCAGCGAGG - Intronic
1175899501 20:62354463-62354485 GGGCCTCCATGCCTGCACCTGGG + Intronic
1179603364 21:42496089-42496111 GGGCTTCCCAGGGTGCGCAGCGG - Intronic
1179885452 21:44312381-44312403 AGGGATCCCTGGGTGCCCCGAGG + Intronic
1180143660 21:45908122-45908144 GGGCCTCACTGGCTGCCCTGGGG - Intronic
1181049815 22:20233194-20233216 GTCCCTCCCTGGGCCCACCGGGG - Intergenic
1181334494 22:22117817-22117839 GGGCCTCCTCGGGCGCACCCGGG - Intergenic
1181511718 22:23392422-23392444 TGACCTCCCTGGCTGCACCCAGG + Intergenic
1182593385 22:31399406-31399428 GGGCCTCCCCGAGCGCGCCGAGG - Intergenic
1183105942 22:35615263-35615285 TGGCCTCCCTGGGGGCAGGGTGG - Intronic
1183574941 22:38682102-38682124 GGGCCTCGCGGGGTGCAGAGCGG + Intronic
1183585108 22:38748843-38748865 GGTACTCCCTGGGTGGAACGTGG - Intronic
1184289396 22:43490339-43490361 GGGCCTCCCTGTGTGACCCTGGG + Intronic
1185314135 22:50171462-50171484 AGGCCTCTCCGGGTGCACTGGGG + Intronic
1185347044 22:50314990-50315012 GGGCCAGCCTGGGTGAACGGTGG - Intronic
952820583 3:37482593-37482615 GGGCCTCCCTGGGTTTTCCTAGG + Intronic
955346955 3:58168376-58168398 GGGCTTTCCTGGGAGCACTGAGG - Intronic
956675295 3:71726324-71726346 GGGACTTCCTGGGTGCTCAGAGG - Intronic
956775810 3:72564606-72564628 GGGCCTCCCTTACAGCACCGTGG - Intergenic
962414289 3:135168278-135168300 GGGGCTCCCCTGGGGCACCGTGG - Intronic
963745134 3:149118169-149118191 GGGCCTCCCTGGGGGTAGGGTGG - Intergenic
968132035 3:196197635-196197657 GGGCATCTCCGGGTGCACAGGGG + Exonic
968541989 4:1172506-1172528 GGCCCTCTCTGGGTGTCCCGGGG + Intronic
968662425 4:1804265-1804287 GGGCATCCATGGGAGCCCCGTGG + Intronic
968947552 4:3673398-3673420 AGGCCACTCTGGGGGCACCGTGG + Intergenic
969117172 4:4877976-4877998 GGGCCTCCCTGGGTTCCGTGGGG - Intergenic
971185115 4:24367905-24367927 GGCCCTCCCAGGGTGCAGCTAGG + Intergenic
973773336 4:54225825-54225847 CCGCCTCCCTGGGTCCAGCGAGG - Intronic
984940772 4:184930256-184930278 TGGCCTCCCTGGGTACTCCTTGG + Intergenic
985540589 5:485722-485744 GGGCCGTCCTGGGTGGGCCGAGG + Intronic
986332722 5:6729557-6729579 GGGCAGCTCTGGGTGCTCCGAGG - Intronic
993795938 5:92267987-92268009 GTGCCACCCTGGGTGCCCTGGGG + Intergenic
997883528 5:137611492-137611514 GGGCCTCCCGGAGTCCACCTGGG + Intergenic
1000337307 5:160251481-160251503 GGGCCTCCCTGGGCACACAGAGG - Intergenic
1002441634 5:179267329-179267351 GGGCCTTCCTTGGTGCAGCGAGG + Intronic
1004707726 6:18140362-18140384 GGGCCTGCCTGGGAGCATCAGGG + Intronic
1005497941 6:26405189-26405211 TGGGCTCCCTGGTTCCACCGGGG - Intronic
1006942591 6:37762874-37762896 GGGCCTCCCTGGCTGCAACCTGG + Intergenic
1009879472 6:69547589-69547611 GGGTCTCCCTGGGTGAATCCTGG + Intergenic
1013375424 6:109509826-109509848 GGAGCTCCCTGGGTGCAGCTTGG + Intronic
1015434634 6:133172197-133172219 TGCCCTCCCTGGGTGCAGCTGGG + Intergenic
1015455725 6:133424536-133424558 GGTCCTTCCTGGGGGCACCGTGG + Intronic
1019095086 6:169573096-169573118 GAGCCTCCCGGGGTGCACCTGGG + Intronic
1019266997 7:123329-123351 AGGCCTCCCTGGGTGCTGCTGGG - Intergenic
1019350205 7:551020-551042 AGGCCTACCTGGGTGCACCTGGG - Intronic
1019388874 7:774203-774225 GGGGCTCCCTGCGTGCTCGGTGG + Intronic
1019406586 7:887230-887252 GGGCGTCCCTGAGTGAGCCGTGG - Intronic
1019644831 7:2123549-2123571 GGTGCTCCCTGGGTGGACTGGGG - Intronic
1020130640 7:5556739-5556761 GGGCGTCCCTGGGTCCAGCAGGG + Intronic
1020591842 7:10148535-10148557 GGGCCTCCCTTACTGCTCCGAGG + Intergenic
1022029802 7:26481757-26481779 GGCCCTCCCTGGGTGCCTCATGG - Intergenic
1022172313 7:27841985-27842007 GGGCCTGCCTGGGTGCTTCAGGG + Intronic
1022268738 7:28785203-28785225 AGACCTCCCAGGGTTCACCGGGG + Intronic
1023271273 7:38465459-38465481 GGGCCTACCTGGGCGCTCCTTGG + Exonic
1023844504 7:44113240-44113262 CTGCTTCCCTAGGTGCACCGCGG + Exonic
1024471679 7:49773520-49773542 GGGCCTCCCCCGGGGCAGCGCGG + Intergenic
1025712851 7:63927771-63927793 GGGCATCCCAGGCTGCTCCGGGG + Intergenic
1026901391 7:74039405-74039427 GGGCCTCCCTGGGGGTGCCATGG - Intronic
1029179999 7:98693526-98693548 AGTGTTCCCTGGGTGCACCGTGG + Intergenic
1029223633 7:99009247-99009269 GCCTCTCCCTGGGTGCCCCGTGG + Intronic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1029797779 7:102913085-102913107 GGACCTCTCTGGCTGCACCCAGG - Exonic
1032074776 7:128831193-128831215 AGCACTCCCTGGGTGCCCCGGGG + Intronic
1035018531 7:155787309-155787331 GGGCCCGCCTGGCTGCCCCGAGG + Intergenic
1035450604 7:158974587-158974609 GGGCCTCCCCGGCTGCCCCAAGG - Intergenic
1035651200 8:1266657-1266679 ACGCCTCCGTGGGTGCACCCGGG + Intergenic
1037728101 8:21500759-21500781 GTGCCTCCCAGGCTGCACCAAGG - Intergenic
1040322767 8:46326932-46326954 AGTCCTCCCTGGGTGGACCCAGG + Intergenic
1043372963 8:79613404-79613426 CGGTCTCCCCGGCTGCACCGCGG - Intronic
1043993854 8:86788658-86788680 TGGCCTCCCTGGCTGCAGGGTGG + Intergenic
1045694188 8:104789232-104789254 GGGCCTCCCTGGTTGCCCTGTGG - Intronic
1048179895 8:132185057-132185079 TGACCTCCCTGGGTGCCCTGAGG + Intronic
1049108086 8:140625994-140626016 GGGCCTTGCTGGGCGCACCTTGG - Intronic
1049223043 8:141436570-141436592 GGGCCTCCCTGCTTGCAGCTTGG + Intergenic
1049582715 8:143420151-143420173 GTGCCTCTCCAGGTGCACCGGGG - Intronic
1049707007 8:144047675-144047697 GGGCCTCCCACAGTGCACTGAGG + Intergenic
1049751148 8:144284883-144284905 GGACCTGCCTGGGTGGACCCAGG - Intronic
1053288551 9:36865206-36865228 GGGCCTCCCTGGGAGAACTGAGG - Intronic
1057704896 9:97389325-97389347 GGGGCTCCCTGCCTGCACCAGGG - Intergenic
1059464398 9:114458601-114458623 GTCCCTCCCTGGGTGCCCCAGGG + Intronic
1060150110 9:121282990-121283012 GGGCCTCCCTGATTGAACCAAGG - Intronic
1060404844 9:123368127-123368149 GGAGCTCCCTGGGCTCACCGGGG - Intronic
1060894902 9:127211306-127211328 GGGCCTTCCTGGGTCCACACCGG - Intronic
1061305379 9:129729709-129729731 GGGGTTCCCTGGGTGTCCCGTGG - Intergenic
1061941742 9:133887602-133887624 GCGCCTCCCTGGGGACACCACGG + Intronic
1062032878 9:134369990-134370012 GTGCTTTCCTCGGTGCACCGAGG - Intronic
1062049483 9:134439609-134439631 GGGCCCTCCTGGGTGCCCCACGG - Intronic
1062193111 9:135257715-135257737 TGGCTTCCCTGGGTCCAGCGTGG + Intergenic
1062466400 9:136683495-136683517 GGGGCTCGCTGGGGCCACCGGGG + Intronic
1062624226 9:137435684-137435706 TGGGCTCCCTGGCTGCAGCGAGG - Intronic
1062674652 9:137733656-137733678 GGGCCTCTCTGTATGCACCTGGG - Intronic
1185478945 X:432189-432211 GGGCCACCCTGGGTGCTGCAGGG + Intergenic
1190107849 X:47572235-47572257 GGGGGTCCCTGGGGGAACCGAGG + Exonic
1200062613 X:153490266-153490288 GGGCCTGCGTGGGGGCTCCGGGG - Intronic
1201012635 Y:9563285-9563307 TGGCCTCCCAGAGTGCACCTTGG + Intergenic