ID: 1129833475

View in Genome Browser
Species Human (GRCh38)
Location 15:78685881-78685903
Sequence GGTGCAGATGACTCCACCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 70}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129833475 Original CRISPR GGTGCAGATGACTCCACCGA CGG (reversed) Intronic
901941947 1:12668967-12668989 GGTGCAAATTACTCCACCCAGGG - Intergenic
903648115 1:24906819-24906841 GGGGCGGATGCCTCCACCCAGGG - Intronic
910210274 1:84785205-84785227 GGTGCGTATGACTCCTCCAAAGG + Intergenic
919912141 1:202118132-202118154 GTTGCAGATGAGGCAACCGAGGG + Intergenic
921804760 1:219441692-219441714 AGAGCAGATGACTCCAATGATGG - Intergenic
923745204 1:236693624-236693646 GGTCCAGAGGACTCCACGGGAGG - Intronic
924595361 1:245440510-245440532 GGTCCAGATTAATCCACAGATGG + Intronic
1064614572 10:17139462-17139484 GGTGAGGATGTCACCACCGATGG + Intergenic
1071298969 10:84242389-84242411 GGTGGAGATGTCTCCACATAAGG + Intergenic
1075920773 10:126210990-126211012 GGTGGAGTTGACTCCACCAAGGG + Intronic
1081013447 11:37845245-37845267 GGTGGAGATAACTCCTCCAAAGG - Intergenic
1081434482 11:43011901-43011923 GATGCAGAGGACTCCAAGGATGG - Intergenic
1083414974 11:62519676-62519698 GGAGCAGATATCTCCAGCGATGG + Exonic
1085735502 11:79035368-79035390 GGTGCAAATGGCTTCACTGATGG - Intronic
1092530749 12:9342748-9342770 GGAGAAGATGACTCCACACATGG - Intergenic
1102003991 12:109577223-109577245 GGTACAGGGGACTCCACTGATGG - Intronic
1102188344 12:110966842-110966864 TGTGCAGATGGCTCCAGTGAGGG - Intergenic
1108223205 13:48259662-48259684 GTTTCAGATGACTCAACCGCCGG - Intronic
1110862640 13:80359763-80359785 GGTGTAGATGTCTCCACGGCTGG - Intergenic
1113515859 13:110897669-110897691 GGTGCAGATGTCTCCATATATGG + Intronic
1118443382 14:65831338-65831360 GCTGCAGAAGGCTCCACCAAGGG - Intergenic
1120516742 14:85480021-85480043 GGTGCAAATGACTCAACAAAGGG - Intergenic
1124358480 15:29016750-29016772 GGTGCAGGTGTCTCCTCTGATGG + Intronic
1127277951 15:57463909-57463931 GGTGCAACTAACTCCACCAAAGG - Intronic
1127364117 15:58271364-58271386 TCTGAAAATGACTCCACCGATGG + Intronic
1127648328 15:60980486-60980508 GGACCAGATGACTCCATCAATGG - Intronic
1129833475 15:78685881-78685903 GGTGCAGATGACTCCACCGACGG - Intronic
1131389087 15:92032687-92032709 GGTGCAGAGGCCCCCATCGAAGG + Intronic
1139202529 16:64992983-64993005 GATGCAGATGACCCCACTTATGG - Exonic
1139518273 16:67464686-67464708 GTTTCAGATGACTCCTCAGAGGG + Intronic
1140193072 16:72834580-72834602 GGAGCAGATTTCACCACCGATGG - Intronic
1140215157 16:73001132-73001154 GGTGCAGATGACTAAAATGACGG - Intronic
1144915744 17:18722443-18722465 GGTACAGTTGACTACACCGTGGG + Intronic
1153010393 18:533473-533495 GGTGCATAGGATTCCACCGTAGG + Intergenic
1158851602 18:61500412-61500434 GATGCAGATGACCCGACCTACGG + Exonic
1160568271 18:79799883-79799905 GGTGCAGGTGCCTCCACTCATGG + Intergenic
1161553042 19:4924757-4924779 GATGAAGATGACTCCACAGAGGG - Intronic
1164778574 19:30873748-30873770 GGTGCAGCTGACTCCATCAGTGG + Intergenic
927923666 2:26993715-26993737 GGGGCAGATGACTCCTCAGCTGG - Intronic
928911954 2:36430677-36430699 GGTGGAGATGCCTTCACAGAAGG + Intronic
934501963 2:94869189-94869211 GGGGCAGATGAGGCCACCAAAGG - Intergenic
938064525 2:128273836-128273858 GGTGCAGAGGACTCCCCAAATGG + Intronic
939641215 2:144642240-144642262 GTTCCAAATGACTCCACCGTGGG + Intergenic
942389231 2:175475166-175475188 GGTGCAGATGGTTCCAGGGAAGG + Intergenic
945301920 2:208222467-208222489 GGTGGAAATGCCTCCACTGAAGG - Intergenic
947741832 2:232488170-232488192 GGAGCCGAGGACTCCTCCGAAGG + Intergenic
1169811039 20:9609548-9609570 GGAGCAAATGAGTCCACCAAAGG + Intronic
1178331072 21:31691915-31691937 GGAGCAGATGATTCCTCCCAGGG - Exonic
1183427071 22:37745927-37745949 GGTGCAGGTGACTCCGGCAATGG - Intronic
1183477128 22:38041961-38041983 GGTGGAGATTACTCCACCTCAGG + Intergenic
958869321 3:99538517-99538539 GGTGCACAGGACTCCACAAAAGG + Intergenic
967111361 3:186296996-186297018 GGTGCAGATGACTCTACCAGTGG - Intronic
968446507 4:654979-655001 GGTGCTGCTGACTGCACCGTGGG - Intronic
969980840 4:11152449-11152471 GGTGCAAATGACACCACATATGG + Intergenic
976270448 4:83225143-83225165 GGGGCAGATGACCCCAACGATGG + Intergenic
981792297 4:148552149-148552171 GCTGCAGATGACTGCACCCAGGG + Intergenic
987575361 5:19721415-19721437 GATGCAGATGACCCTACCTATGG - Exonic
987736705 5:21854739-21854761 GATGCAGATGACCCGACCTATGG - Exonic
988116966 5:26906787-26906809 GATGCAGATGACGCCAACTATGG - Exonic
988857039 5:35237571-35237593 GGTGAAGATGAGTCCAGCCAGGG - Intergenic
994874802 5:105405654-105405676 GATGAAGATGACAACACCGAAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1007412654 6:41673905-41673927 GGGGCAGATGGCTCCATGGAAGG - Intergenic
1007530429 6:42536972-42536994 GGAGCAGGTGAGTCCCCCGAGGG + Intergenic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1032314944 7:130829043-130829065 GGGGCACATGACACCACCAAAGG - Intergenic
1040360773 8:46662167-46662189 GGTGTTGATGACTCCAGCCAGGG + Intergenic
1045586906 8:103548045-103548067 GGAGCAGATGAATCCACAGTTGG + Intronic
1046780969 8:118214438-118214460 GGTGTAGATGACACTACCAAGGG - Intronic
1049100532 8:140575503-140575525 GGTGCAGATGGCTCCATTGGAGG + Intronic
1060248851 9:121969472-121969494 GGTGCAGAGGAGTCCTCAGAAGG - Intronic
1186559096 X:10591559-10591581 GATGCTGGTGACTTCACCGAAGG + Intronic
1187358534 X:18602046-18602068 GGTGCAGATGCCTGCAGGGAAGG + Intronic
1189101679 X:38197036-38197058 GCTGCAGATGAATCCAGAGATGG + Intronic
1192242980 X:69349471-69349493 GGTGCAGATGACCTCACTGGTGG - Intergenic
1199826839 X:151508826-151508848 GGTGCATATGTCTTCACCTATGG - Intergenic
1201160552 Y:11161416-11161438 GGGGCAGATGAGGCCACCAAAGG + Intergenic