ID: 1129834490

View in Genome Browser
Species Human (GRCh38)
Location 15:78693505-78693527
Sequence GGGGAGTGAGCTCATCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 188}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129834490_1129834498 8 Left 1129834490 15:78693505-78693527 CCTCTGGGATGAGCTCACTCCCC 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1129834498 15:78693536-78693558 CAATTACTATCTATGGCTGTGGG 0: 1
1: 1
2: 1
3: 4
4: 118
1129834490_1129834497 7 Left 1129834490 15:78693505-78693527 CCTCTGGGATGAGCTCACTCCCC 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1129834497 15:78693535-78693557 CCAATTACTATCTATGGCTGTGG 0: 1
1: 1
2: 1
3: 10
4: 100
1129834490_1129834495 1 Left 1129834490 15:78693505-78693527 CCTCTGGGATGAGCTCACTCCCC 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1129834495 15:78693529-78693551 TTGGTACCAATTACTATCTATGG 0: 2
1: 1
2: 1
3: 3
4: 92
1129834490_1129834499 20 Left 1129834490 15:78693505-78693527 CCTCTGGGATGAGCTCACTCCCC 0: 1
1: 0
2: 2
3: 21
4: 188
Right 1129834499 15:78693548-78693570 ATGGCTGTGGGTCTTGACCTTGG 0: 1
1: 1
2: 2
3: 20
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129834490 Original CRISPR GGGGAGTGAGCTCATCCCAG AGG (reversed) Intronic
900584750 1:3427448-3427470 GGGGAGTGAGCTGGGCCCTGTGG - Intronic
900783377 1:4632171-4632193 GGGGAGTGATGCCATCACAGAGG - Intergenic
900899071 1:5504564-5504586 GGGGAGTGATCTCATCCCCCTGG + Intergenic
901025280 1:6275871-6275893 CTGGAGGGAGCCCATCCCAGAGG - Intronic
901220854 1:7583078-7583100 GAGGACTGGGCACATCCCAGTGG + Intronic
902198176 1:14813958-14813980 GATGAGTAAGCTCATCCCAGCGG - Intronic
902402272 1:16164756-16164778 GGGGAGTGTGCTGCTCACAGAGG - Intergenic
904753523 1:32755294-32755316 GGGGAGTGAGGAAATCCCAGAGG + Intronic
905182902 1:36177783-36177805 GGGGAGGGGGCACCTCCCAGAGG + Intronic
906748133 1:48235762-48235784 GGTGAGTGAGCTCATGAGAGCGG - Exonic
908531846 1:65041251-65041273 GGGGGAAGGGCTCATCCCAGTGG + Intergenic
910671955 1:89782572-89782594 GGGAATTCAACTCATCCCAGGGG + Intronic
912495351 1:110088189-110088211 GGAGTATGAGCTCAGCCCAGTGG - Intergenic
915558607 1:156673976-156673998 GAGGAGGGAGCCCATCCCATGGG - Intronic
916615470 1:166434761-166434783 GGGTAGGGAGCACATCCCAGTGG - Intergenic
919331752 1:196181064-196181086 GGGGAGAGTGGTGATCCCAGTGG + Intergenic
924571601 1:245241845-245241867 GGGGACTGAGCTCATACCACAGG - Intronic
1065922180 10:30402473-30402495 AAGGAGTGAGCTCATCCCAGAGG + Intergenic
1067941101 10:50658275-50658297 GAGGAGGTAGCTGATCCCAGAGG + Intergenic
1070774237 10:79100515-79100537 GGGGCCTGATCACATCCCAGAGG + Intronic
1070862315 10:79683147-79683169 GAGGAGGTAGCTGATCCCAGAGG + Intergenic
1071521220 10:86332456-86332478 GGGGTGAGAGGCCATCCCAGGGG - Intronic
1072329665 10:94335310-94335332 GAGGAATGAGCTTATCCCAAAGG - Intronic
1072789651 10:98308956-98308978 GGGGCTTGAGCTCATTTCAGGGG + Intergenic
1073127866 10:101163133-101163155 GGGGACTGAGGCCATCCCAAAGG + Intergenic
1073469030 10:103711476-103711498 GGGGAGGGTGTTCATCTCAGTGG - Intronic
1075415357 10:122258589-122258611 GAGGAGAAAGCTCACCCCAGCGG + Intergenic
1075708371 10:124516617-124516639 GGTGAGAGAGTTTATCCCAGAGG + Intronic
1075719077 10:124574616-124574638 GGGGAGTGGTCGCATCCCACCGG + Intronic
1076271454 10:129155809-129155831 GGGGAGTGATGCCATACCAGGGG - Intergenic
1076820282 10:132935267-132935289 GGGGAGTGAGGAGATCACAGTGG - Intronic
1076820295 10:132935339-132935361 GGGGAGTGAGGAGATCACAGTGG - Intronic
1076820460 10:132936235-132936257 GGGGAGTGAGGAGATCGCAGTGG - Intronic
1076994290 11:290636-290658 AGGGAGGGAGCTCATCCCTGAGG + Intronic
1079006360 11:16794079-16794101 GGGCAGTGAGTTCAGTCCAGTGG - Intronic
1079355556 11:19727481-19727503 AGGGAGTGAGCCCCTCCCACTGG - Intronic
1081680636 11:45000002-45000024 AGGGAGTGAGCTGAGCCAAGGGG - Intergenic
1084203459 11:67577288-67577310 GGGGCCTGAGCTCAGCCCAGGGG + Intergenic
1084332088 11:68436434-68436456 GGGGAGGGAGCACAACCCACTGG - Intronic
1084438005 11:69155359-69155381 AGGGAGTGACCTCCTCCCAGCGG - Intergenic
1084438288 11:69156736-69156758 GGGGAGAGAGCACTTCTCAGGGG - Intergenic
1084674942 11:70628823-70628845 GGGGAGTGAACAGGTCCCAGAGG + Intronic
1087612097 11:100447001-100447023 GGGCAGTAATCTCATCCCGGGGG - Intergenic
1087638187 11:100726924-100726946 GGGAAGTGAGGTGATCCTAGGGG + Intronic
1088368082 11:109059896-109059918 GAGGAGTGAGGGCAACCCAGAGG + Intergenic
1089457210 11:118632598-118632620 GGGCAGTGAGCACAGCCCAAGGG + Intronic
1089732433 11:120527524-120527546 GGGGATTTATCTCCTCCCAGAGG + Intronic
1100858263 12:98777479-98777501 GGGGAGGGAGGTCTTCCGAGAGG - Intronic
1102503799 12:113371398-113371420 GGGGAAAGAGCACATCACAGAGG + Intronic
1103374592 12:120446084-120446106 GGGGAGCGAGCTCCTGCCACTGG + Intronic
1107480474 13:40781790-40781812 GGGTAGCGAGGGCATCCCAGGGG - Intergenic
1109278565 13:60329781-60329803 GGTGAGAGAGCTCCTCCCACAGG + Intergenic
1111160246 13:84384770-84384792 GCTGAGTGGGCTCATCCCTGAGG - Intergenic
1113155406 13:107314678-107314700 GGCCACTGAGCTCATCCCACAGG + Intronic
1114484853 14:23056467-23056489 GGGGAGAGAGGTCCACCCAGAGG + Intronic
1116430937 14:44844388-44844410 GAGGTGTAAGCACATCCCAGAGG - Intergenic
1117015339 14:51512108-51512130 AGTGACTGAGCTCATCACAGAGG - Intronic
1118679933 14:68230373-68230395 CTGGAGTGAACTCATTCCAGTGG - Intronic
1119924983 14:78484978-78485000 GGTGACTGAGCCCATCCCAAAGG - Intronic
1120830746 14:88995528-88995550 GGGGAGTGTGCTGACACCAGGGG - Intergenic
1122030648 14:98909028-98909050 GGGGAGTTTGCTACTCCCAGAGG - Intergenic
1123447126 15:20339462-20339484 GGGGAGTGTGCTGACCTCAGTGG + Intergenic
1128559116 15:68652983-68653005 GGGGTGTCAGCTCATCAGAGAGG - Intronic
1129749586 15:78052104-78052126 GGGGAGTGAGCTGAACCTGGGGG - Intronic
1129834490 15:78693505-78693527 GGGGAGTGAGCTCATCCCAGAGG - Intronic
1131156810 15:90080631-90080653 GCGGAGTGAGGGCATCACAGGGG + Exonic
1131437950 15:92438052-92438074 CTGGAGTGAGCTCCTCACAGCGG - Intronic
1132567664 16:630782-630804 GGAGATTGATCTCAGCCCAGGGG + Intronic
1135407325 16:22207325-22207347 GGGAAGTGAGATCTGCCCAGGGG + Intronic
1135561401 16:23479559-23479581 GGGGAGTGAGCTGGTCCCCTTGG - Intronic
1135668809 16:24357624-24357646 GGGGAGTGAGATCAGCCCACAGG + Intronic
1138231804 16:55343128-55343150 GGGGTGTGAGTACCTCCCAGGGG - Intergenic
1140682145 16:77395525-77395547 GGGGAGTGAACGCAGCCCTGAGG - Intronic
1141361959 16:83403669-83403691 GGGGAGTGAGCAGTCCCCAGTGG + Intronic
1141520275 16:84574197-84574219 GGGGACGCAGTTCATCCCAGGGG + Intronic
1143210038 17:5179238-5179260 TGGATGTGAGCGCATCCCAGGGG - Intergenic
1144739583 17:17574150-17574172 AGGGAGTGAGCTCTTCAAAGTGG - Intronic
1146024649 17:29309117-29309139 TGGGAGTGATCTGATCCCATGGG - Intergenic
1146158204 17:30542046-30542068 AGGGAGTGACCTCATCACTGTGG - Intergenic
1146295379 17:31645716-31645738 GAGGAGAGCGCCCATCCCAGTGG + Intergenic
1146457512 17:33018989-33019011 GGGGAGAAGGCTCTTCCCAGTGG + Intronic
1148444725 17:47730732-47730754 GGGAAGTGAGGGGATCCCAGGGG + Intergenic
1151372175 17:73655085-73655107 GAAGAGGGAGGTCATCCCAGAGG - Intergenic
1152060937 17:78074791-78074813 GGGGAGGGGGTGCATCCCAGGGG + Intronic
1152822052 17:82442383-82442405 GAGGGGAGAGCTCATGCCAGGGG + Exonic
1154201754 18:12305305-12305327 GAGCTGTGGGCTCATCCCAGTGG - Intergenic
1156461737 18:37325163-37325185 GGGGAGTGAGGCCATTCCTGAGG + Intronic
1156527093 18:37777789-37777811 GGAGGGTGGGCTCATCGCAGAGG - Intergenic
1159863820 18:73681566-73681588 GGGGGTTGAGCTGATCCCACAGG - Intergenic
1160778786 19:868742-868764 GTGGAGGGAGCACGTCCCAGAGG - Intronic
1161289469 19:3485236-3485258 GGGGACTGAGCTGGTCCTAGTGG + Intergenic
1161968405 19:7561619-7561641 GGGGAGTGAGCTACCCCCACGGG - Exonic
1162485237 19:10956310-10956332 GGGGAGGGGAATCATCCCAGAGG - Intergenic
1164037383 19:21466762-21466784 GGGCTGTGAGCTCATCACTGAGG + Intronic
1165128988 19:33620859-33620881 GGGGAGTGAGCTGGGCCCATGGG - Intergenic
1165421301 19:35723285-35723307 GGGGCGTGACCTCATTCCCGTGG + Intronic
1165818393 19:38658003-38658025 GGGGAGTGCCCTCATACCAGAGG + Intronic
1165900967 19:39169194-39169216 GGGAAGTGAGCTCCTGGCAGAGG + Intronic
925743849 2:7028645-7028667 GGAGAATGAGCTCTTCTCAGTGG + Intronic
932432523 2:71684508-71684530 GGGAAGTGAGCACTCCCCAGTGG - Intronic
932442036 2:71743571-71743593 TGGCTGTGAGCTCATCCCATGGG - Intergenic
932747670 2:74347617-74347639 GGACAGTGAGCACATCCCTGGGG - Intronic
934532645 2:95104611-95104633 GGGGAGTGATGGCATCACAGTGG - Intronic
935047351 2:99494054-99494076 GGGGAGAGAGCACATGCCAAGGG + Intergenic
936228566 2:110679960-110679982 TGGGACTGGGCACATCCCAGCGG + Intergenic
936460359 2:112709865-112709887 TGGGAAGGAGCTCATCCCAAGGG + Intergenic
937012701 2:118576068-118576090 GGGCAGAGACCTCATCCCGGAGG + Intergenic
939991006 2:148876424-148876446 TGGGAGGGAGGTCATCCCAGAGG - Intronic
940337315 2:152543083-152543105 GGGCAGTGAGTGCATTCCAGAGG + Intronic
940789555 2:158017704-158017726 TGGGAATGAACTCATCCCACAGG - Intronic
946371059 2:219281664-219281686 GGGAGGGGAGCCCATCCCAGAGG + Intronic
947970556 2:234319576-234319598 GGAGATTGAGCTCAGCCCAGAGG + Intergenic
1169103961 20:2978293-2978315 GGTGATTGGGCTCAACCCAGTGG + Intronic
1172878438 20:38180857-38180879 GTGGGGTGAGCTGTTCCCAGTGG + Intergenic
1173434827 20:43023208-43023230 GGGGAGTGGGCTCACTTCAGAGG - Intronic
1173836715 20:46130641-46130663 GTGGAGAGGGCTTATCCCAGTGG + Intergenic
1174488214 20:50874429-50874451 GGGGCCTCAGCTCATCCTAGAGG - Intronic
1174508176 20:51030559-51030581 GGGGAATGAGCTCATCCTGGGGG - Intergenic
1175479703 20:59302230-59302252 AGGAAGGGAGCCCATCCCAGGGG - Intronic
1176097255 20:63349844-63349866 GGGGTGGGAGCTCAGCCGAGTGG + Exonic
1176428270 21:6561771-6561793 GGGCAGTGACCTCATTCCACAGG + Intergenic
1178603215 21:34012928-34012950 GTGGAGTGAGCTGATGCCTGGGG + Intergenic
1179070425 21:38065897-38065919 GGGGAATGACCTCAACCAAGTGG - Intronic
1179465079 21:41566632-41566654 GGGATGTGAGCTCATCAGAGAGG - Intergenic
1179599629 21:42467645-42467667 GGGGGAAGAGCTCAGCCCAGTGG - Intergenic
1179703760 21:43170087-43170109 GGGCAGTGACCTCATTCCACAGG + Intronic
1180848397 22:18997248-18997270 GGGGAAGGAGCTCATCCAGGAGG + Intergenic
1183865489 22:40701009-40701031 GGGGAGTGTACCCCTCCCAGAGG - Intergenic
1183977959 22:41524022-41524044 GGGGACTGGGGTCATCCAAGTGG + Intronic
1184273601 22:43398339-43398361 GGGGAAGCAGCTCATCCAAGGGG - Intergenic
953774051 3:45800632-45800654 GGGGAGTGAGTTCAGCTCAGTGG + Intergenic
953902018 3:46848891-46848913 GGGGAGTGAGGGCATCCCCAGGG + Intergenic
957232328 3:77536304-77536326 TGGGAGAGTGCTCCTCCCAGAGG - Intronic
960841313 3:121962490-121962512 GTGGAGTGAGTTCAACCCAAGGG - Intergenic
961514661 3:127425125-127425147 GAGGAGTGAGGTCAGACCAGAGG + Intergenic
962976735 3:140452352-140452374 GGGGAGAGAGACCATCCTAGTGG - Intronic
966912624 3:184568079-184568101 GGGGAGTGAGCCCAGCCCCCAGG + Intronic
968516888 4:1019219-1019241 GGGGAGGGAGCCCACCTCAGAGG - Intronic
968684031 4:1944205-1944227 CAGGAGTGGGCTCATCCTAGAGG + Intronic
969159046 4:5239304-5239326 TGGGAGTGAGGTTATCCCAGTGG + Intronic
973566498 4:52194050-52194072 GGGGTGTAATCTGATCCCAGAGG + Intergenic
974009430 4:56593491-56593513 GTGGAGAGAGCTCATCAGAGTGG + Intronic
974249295 4:59363332-59363354 GGGAAGAGGGCTCATCCCAGGGG - Intergenic
975662060 4:76698110-76698132 GGGGACTCAGCTTTTCCCAGTGG - Intronic
981311546 4:143302708-143302730 GGGGGGTGGGCTCAACACAGCGG - Intergenic
985563392 5:603218-603240 GTGGAGTGGGGTCCTCCCAGTGG - Intergenic
986036320 5:3943756-3943778 GAGGAGTGGTCTCATCTCAGAGG + Intergenic
986261155 5:6147615-6147637 GAGGAGTGAGTTCATCCCTTTGG - Intergenic
988485701 5:31666616-31666638 GGGGACTGAGCTAACCCCATTGG + Intronic
988503438 5:31801911-31801933 GGAAAGTCATCTCATCCCAGGGG - Intronic
989162387 5:38404028-38404050 GTGGAGTGAGCTGTTCTCAGGGG - Intronic
990451255 5:55933509-55933531 GGGGAATGAGGTCAGCACAGCGG + Intergenic
996307059 5:122059463-122059485 GGAGTGACAGCTCATCCCAGGGG - Intronic
996316183 5:122163251-122163273 GGGCATTGAGCTCTGCCCAGAGG + Intronic
1001236507 5:170034359-170034381 GGGCAGTGAGCTCATGGCTGGGG - Intronic
1001997567 5:176174508-176174530 TGGGACTGGGCACATCCCAGCGG + Intergenic
1002200825 5:177527099-177527121 GGGGAGTGGAATCATCCCGGAGG + Intronic
1002517395 5:179769469-179769491 GGGAAGTGAAGTCATCCCTGAGG + Intronic
1002692756 5:181061828-181061850 GGGGCGAAAGCTCATCCCAGAGG - Intergenic
1003206635 6:4018742-4018764 GGGGAGCGCGCTCTTCCCAGCGG - Intergenic
1005098927 6:22148122-22148144 GTGGAGTCAGCTCAACCCTGGGG + Intergenic
1006108289 6:31729518-31729540 GGGGAGTGAGCGCATCCTAGTGG - Exonic
1007234930 6:40383808-40383830 GGGAGGTGAGCTCTTCCCAAGGG - Intergenic
1010676570 6:78753031-78753053 GGGGAATGTGCCCATCCCAGAGG + Intergenic
1011064084 6:83305616-83305638 GGAGAGTGAGCACATCATAGAGG + Intronic
1011681560 6:89788352-89788374 GGGCAGTGAAGTCTTCCCAGAGG + Intronic
1012128962 6:95467044-95467066 GGGGAGTGTGCAGAGCCCAGCGG + Intergenic
1013421124 6:109968017-109968039 GAGCAGTGAGCTGATCGCAGAGG - Intergenic
1014663014 6:124197383-124197405 GAGAAGTGAGCTCCTCCAAGGGG - Intronic
1017732461 6:157329691-157329713 GGGGACAAAGCTCATGCCAGGGG + Intergenic
1018312469 6:162525306-162525328 CTGGAGTGAGCTGAACCCAGGGG - Intronic
1019004435 6:168784481-168784503 GGGGACAGAGCCCATCCCAGGGG - Intergenic
1019267689 7:127569-127591 GGGCAGAGAGCTCTTCCCTGGGG + Intergenic
1019508560 7:1405573-1405595 TGAGACTCAGCTCATCCCAGGGG - Intergenic
1019600914 7:1883377-1883399 GGAAAGGGAGCTCATCCCCGGGG - Intronic
1023859978 7:44212768-44212790 TGGGAGTGAGCCCACCACAGAGG + Exonic
1024082523 7:45866631-45866653 GGGGAGTGTGCAGAACCCAGGGG + Intergenic
1026030671 7:66790498-66790520 GGGGAAAGAGCTGAGCCCAGTGG + Intronic
1028713787 7:93940857-93940879 AGGGAGAGAGGTCATCCAAGGGG - Intergenic
1028905756 7:96152340-96152362 GGGGAGAGGGCTCATCCGGGAGG + Intronic
1029514727 7:101017937-101017959 GGGGAGGGAGGGAATCCCAGGGG - Intronic
1033327601 7:140392420-140392442 GGGGAGTGAGCTTATCCATCTGG - Intronic
1033670652 7:143489357-143489379 GGTGAGTGAGTTCATCCTAATGG - Intergenic
1034256490 7:149727488-149727510 GGGGAGTGAACTCACAGCAGTGG - Intronic
1034643741 7:152625906-152625928 GGGAAGTGGGCTCATCACATGGG + Intergenic
1034936999 7:155206707-155206729 GGGAAGCCAGCTCATCACAGGGG + Intergenic
1035899977 8:3448709-3448731 CAGGAGTGAGCTCAGCCTAGAGG - Intronic
1036226883 8:6966823-6966845 AGGGAGTCAGCCCAGCCCAGCGG + Intergenic
1036683401 8:10892566-10892588 GAGGGGTGGGCTCACCCCAGGGG - Intergenic
1036688846 8:10928650-10928672 GGCAAGTGATCTCATCCCACAGG + Intronic
1041399357 8:57425686-57425708 GGGGAGTGAGTTTATTTCAGGGG - Intergenic
1042193805 8:66214545-66214567 GGGGAGTGAGCTAAGGTCAGGGG - Intergenic
1042869604 8:73386324-73386346 GGGGAGTGCTCCCTTCCCAGGGG + Intergenic
1049352126 8:142170005-142170027 GGGGAGTGAATTCACCCCGGGGG + Intergenic
1050431306 9:5564786-5564808 TGGGAATGAGCTCATGGCAGTGG - Intronic
1050532758 9:6605132-6605154 GTGGAGAGAGCTCATCAGAGTGG - Exonic
1056826064 9:89877171-89877193 GGGGACTGAGCTGATCCCCGGGG - Intergenic
1057080516 9:92171435-92171457 GAGGAGGCAGCTGATCCCAGAGG + Intergenic
1057241591 9:93416560-93416582 GGGCAGTGACCTTATGCCAGTGG + Intergenic
1059483893 9:114612399-114612421 GGGGAGTGAGCACAGCCTTGAGG - Intronic
1061468638 9:130804297-130804319 CGGCAGTGAGCTCACACCAGTGG + Intronic
1186251851 X:7676712-7676734 GGGTTGAGAGCTCCTCCCAGGGG + Intergenic
1189348839 X:40262327-40262349 GGGGAGGGGGCCCATCTCAGGGG - Intergenic
1189733865 X:44049444-44049466 GGGGAGTGTGCTCTTCCAATAGG + Intergenic
1191086093 X:56568913-56568935 AGGGAGGGAGCTAATGCCAGGGG + Intergenic
1192264599 X:69530019-69530041 GGGGAGGGGGCTCCTCCCATGGG + Exonic
1197423971 X:126272744-126272766 GGGCAGTGACCTAATGCCAGTGG + Intergenic
1199254986 X:145709459-145709481 GTGGAGTGATCTCAGCTCAGTGG + Intergenic
1200145296 X:153923270-153923292 TGGGATTGAGCTCTTCTCAGCGG - Intronic
1200164136 X:154024455-154024477 GGGGAGTCAGGCCACCCCAGTGG + Intronic
1200228903 X:154434363-154434385 GGGGAGTCAGGTCCTCCCACTGG - Exonic
1201386988 Y:13451875-13451897 GTGGAGTGAGAGCACCCCAGTGG + Intronic