ID: 1129834588

View in Genome Browser
Species Human (GRCh38)
Location 15:78694085-78694107
Sequence GCAGAATATTCAGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 838
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 776}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129834588_1129834591 12 Left 1129834588 15:78694085-78694107 CCACACCTGGCTGAATATTCTGC 0: 1
1: 0
2: 4
3: 57
4: 776
Right 1129834591 15:78694120-78694142 TTTTTGTATGCCTGAGACTTTGG 0: 1
1: 4
2: 12
3: 37
4: 329
1129834588_1129834593 19 Left 1129834588 15:78694085-78694107 CCACACCTGGCTGAATATTCTGC 0: 1
1: 0
2: 4
3: 57
4: 776
Right 1129834593 15:78694127-78694149 ATGCCTGAGACTTTGGGCCTTGG 0: 1
1: 0
2: 0
3: 9
4: 219
1129834588_1129834592 13 Left 1129834588 15:78694085-78694107 CCACACCTGGCTGAATATTCTGC 0: 1
1: 0
2: 4
3: 57
4: 776
Right 1129834592 15:78694121-78694143 TTTTGTATGCCTGAGACTTTGGG 0: 1
1: 3
2: 14
3: 36
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129834588 Original CRISPR GCAGAATATTCAGCCAGGTG TGG (reversed) Intronic
900295779 1:1948742-1948764 GAAGAAAATTTAGCCAGGCGTGG - Intronic
900565204 1:3328772-3328794 GCAGAATCTGCAGCCAGGTGGGG + Intronic
900983400 1:6059344-6059366 GCACAAAAATTAGCCAGGTGTGG - Intronic
901432698 1:9227020-9227042 ATAGAAAAATCAGCCAGGTGTGG + Intergenic
901683402 1:10929465-10929487 GCACAAAAATCAGCCAGGCGTGG + Intergenic
901780843 1:11593549-11593571 GCAGGGTGGTCAGCCAGGTGAGG + Intergenic
902166349 1:14574948-14574970 GAGGAAGATACAGCCAGGTGAGG + Intergenic
902414201 1:16229535-16229557 GCAGAGCATTAAACCAGGTGTGG + Intergenic
902819271 1:18933601-18933623 ACAAAAAATTTAGCCAGGTGTGG + Intronic
902898981 1:19500805-19500827 GCAGGATTTCCAGCCAGGTGCGG + Intergenic
903213367 1:21830532-21830554 GCAAAAAATTTAGCCAGGGGTGG + Intronic
903636004 1:24816536-24816558 TAAGAACATTCAGCCAGGTCTGG - Intronic
903729799 1:25484076-25484098 GCAGCATTTTCATCTAGGTGAGG - Intronic
904106620 1:28089961-28089983 CCAGAAAAATTAGCCAGGTGTGG + Intergenic
904549848 1:31306821-31306843 GAAAAAAAATCAGCCAGGTGTGG - Intronic
905128494 1:35733434-35733456 TAAGAAAATTCAGCCAGGTCCGG - Intronic
905578191 1:39062863-39062885 AAAAAAAATTCAGCCAGGTGTGG - Intergenic
905597296 1:39218934-39218956 GTACAAAAATCAGCCAGGTGTGG - Intronic
905988480 1:42310601-42310623 ACAAAATAATTAGCCAGGTGTGG - Intronic
906693777 1:47810677-47810699 TCAGAATATTCACGAAGGTGTGG + Intronic
907070459 1:51530013-51530035 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
907362664 1:53932193-53932215 ACACAAAAATCAGCCAGGTGTGG + Intronic
907699185 1:56766590-56766612 ACAAAAAATTTAGCCAGGTGTGG - Intronic
907764222 1:57392662-57392684 GCACTAAATTCATCCAGGTGAGG + Intronic
908292941 1:62686932-62686954 GCAAAAAAATTAGCCAGGTGTGG - Intronic
908504839 1:64786635-64786657 GCAAAAAACTTAGCCAGGTGCGG + Intronic
908631536 1:66114789-66114811 GTACAAAAATCAGCCAGGTGTGG - Intronic
909029724 1:70524989-70525011 ACACAAAAATCAGCCAGGTGTGG - Intergenic
909643788 1:77894594-77894616 ACAGAAAAATTAGCCAGGTGTGG - Intronic
909670432 1:78182413-78182435 GCAGAGCATTAAACCAGGTGTGG + Intergenic
909690797 1:78405829-78405851 ACAAACTATACAGCCAGGTGCGG + Intronic
910994166 1:93086348-93086370 ACAAAAAATTTAGCCAGGTGTGG + Intronic
911080417 1:93923678-93923700 GCAGAAAAAATAGCCAGGTGTGG + Intergenic
911573475 1:99546016-99546038 TAAGAATAATCAGCCAGGTGCGG + Intergenic
911643718 1:100316338-100316360 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
912350079 1:109004107-109004129 ACAAAAAAATCAGCCAGGTGTGG + Intronic
912579630 1:110708464-110708486 GCACAAAAATTAGCCAGGTGTGG - Intergenic
912601952 1:110945050-110945072 GCCAAAAATTTAGCCAGGTGTGG - Intergenic
912922976 1:113887051-113887073 GTAGAAAAATTAGCCAGGTGTGG - Intronic
912982801 1:114392258-114392280 GAAGAATTTTAAGCAAGGTGGGG - Intergenic
913275481 1:117133837-117133859 ACACAAAAATCAGCCAGGTGTGG + Intergenic
913971077 1:143418506-143418528 GCACAAAAATTAGCCAGGTGTGG + Intergenic
914065455 1:144244118-144244140 GCACAAAAATTAGCCAGGTGTGG + Intergenic
914113696 1:144722236-144722258 GCACAAAAATTAGCCAGGTGTGG - Intergenic
914243106 1:145865774-145865796 ACAGAAAAATCAGCCAGTTGTGG + Intergenic
914822112 1:151112629-151112651 CCAGCATAGTCGGCCAGGTGCGG - Intronic
915104376 1:153523844-153523866 GTGGAAAAATCAGCCAGGTGAGG + Intergenic
915134870 1:153723943-153723965 ATAGAAAAATCAGCCAGGTGTGG + Intergenic
915295173 1:154915762-154915784 TAACAATATTGAGCCAGGTGCGG + Intergenic
916158726 1:161887225-161887247 GCACAAAAATTAGCCAGGTGTGG - Intronic
916246351 1:162692070-162692092 GGAGAATGTTCAGCCAGGTAAGG - Intronic
916382954 1:164233503-164233525 GCAAAATGTTAAGCCTGGTGGGG - Intergenic
916716642 1:167452067-167452089 ACAGAAAAATTAGCCAGGTGTGG + Intronic
917304376 1:173612086-173612108 GTAGAAAAATTAGCCAGGTGTGG + Intronic
917376358 1:174351955-174351977 GCAAAAAAATTAGCCAGGTGTGG - Intronic
917422519 1:174879799-174879821 GTAATATACTCAGCCAGGTGTGG + Intronic
917441856 1:175075450-175075472 GCACAAAAATTAGCCAGGTGTGG - Intronic
917528741 1:175813813-175813835 AGAGAATGTTAAGCCAGGTGCGG + Intergenic
917770707 1:178274741-178274763 GTACAAAAATCAGCCAGGTGTGG - Intronic
918063946 1:181086957-181086979 ACAAAATAATCAGCCGGGTGTGG - Intergenic
918917114 1:190656858-190656880 GCAAAACAATTAGCCAGGTGTGG - Intergenic
919648813 1:200124774-200124796 ACAAAATAATTAGCCAGGTGTGG + Intronic
919696216 1:200578799-200578821 ACAAAAAATTCAGCCAGGCGTGG + Intronic
919702574 1:200646176-200646198 ACAGAAAAATTAGCCAGGTGTGG + Intronic
919757159 1:201073425-201073447 GGAGAGTTATCAGCCAGGTGAGG - Intronic
920214558 1:204352827-204352849 ATAAAATAATCAGCCAGGTGTGG + Intronic
920296975 1:204964046-204964068 GCTTAGGATTCAGCCAGGTGAGG + Intronic
920510282 1:206546260-206546282 ACAAAAAAGTCAGCCAGGTGTGG - Intronic
920794710 1:209127974-209127996 GTATAATAATTAGCCAGGTGTGG + Intergenic
920899865 1:210098017-210098039 TCAAAAAATTTAGCCAGGTGTGG + Intronic
921450144 1:215296091-215296113 GCAAAAAAATCAGCCGGGTGTGG - Intergenic
922383944 1:225061772-225061794 ATAGAATATACAGCCAGGTGTGG - Intronic
922977073 1:229794035-229794057 GTATAAAAGTCAGCCAGGTGTGG + Intergenic
923567368 1:235086258-235086280 GCAAAATGTTCAGTCAGGCGTGG + Intergenic
923582133 1:235227986-235228008 ACAAAATAATTAGCCAGGTGTGG - Intronic
923868908 1:237969841-237969863 GGAGAATATAAGGCCAGGTGTGG + Intergenic
924077229 1:240352818-240352840 GCAGAATTTCCAGCCACGTGAGG + Intronic
924752610 1:246909119-246909141 ATATAAAATTCAGCCAGGTGAGG + Intronic
924754070 1:246925907-246925929 GAAAAATAATTAGCCAGGTGTGG + Intronic
1063683545 10:8213546-8213568 TAAAAATAATCAGCCAGGTGTGG - Intergenic
1063842050 10:10083164-10083186 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1064213534 10:13380953-13380975 ACAGAATTTTTGGCCAGGTGTGG + Intergenic
1064543049 10:16424553-16424575 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1064595078 10:16935722-16935744 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1064735733 10:18379975-18379997 GTAGAATAGTGGGCCAGGTGTGG - Intronic
1064765924 10:18671325-18671347 ACACAAAAATCAGCCAGGTGTGG - Intronic
1064875454 10:19988949-19988971 GTACAAAATTTAGCCAGGTGTGG - Intronic
1064974256 10:21097160-21097182 GCTCAATATCCGGCCAGGTGCGG + Intronic
1065732578 10:28722717-28722739 GCAGAAGACTCAGCCACGTGAGG + Intergenic
1065922095 10:30401901-30401923 GCAGAATATTCGGCCGGGTGCGG + Intergenic
1066106014 10:32157640-32157662 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1066319327 10:34285419-34285441 CCAAAACAATCAGCCAGGTGTGG + Intronic
1066546776 10:36508745-36508767 TTAGTATATTCAGCCGGGTGCGG + Intergenic
1067402280 10:45987915-45987937 TAAAAATATCCAGCCAGGTGTGG - Intronic
1067428331 10:46225882-46225904 GCAGAATCTGCAACCAGGAGTGG - Intergenic
1067870633 10:49957549-49957571 TAAAAATATCCAGCCAGGTGTGG - Intronic
1068525090 10:58119441-58119463 GCATAATATTCAGACTGCTGAGG + Intergenic
1068723123 10:60269486-60269508 GCACAAAATTTAGCCATGTGTGG + Intronic
1069522392 10:69133975-69133997 TAAGAATAATCAGTCAGGTGTGG - Intronic
1070240070 10:74671351-74671373 GTACAAAAATCAGCCAGGTGTGG - Intronic
1070315631 10:75308995-75309017 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
1070560186 10:77560504-77560526 AGAGAATGTGCAGCCAGGTGAGG + Intronic
1070801952 10:79249026-79249048 GCAGAAGATTTAGCAAGGTCTGG + Intronic
1071027899 10:81137764-81137786 GAAGAAGATTCAGCCAGGTGCGG - Intergenic
1071484115 10:86086539-86086561 GCAGAACCCTCAGACAGGTGTGG - Intronic
1072366938 10:94721166-94721188 ACAAAATAATTAGCCAGGTGTGG - Intronic
1072583635 10:96762227-96762249 GCACAAAAATTAGCCAGGTGTGG + Intergenic
1072778359 10:98223979-98224001 GCAGAATAATTACGCAGGTGGGG + Intronic
1073120011 10:101115993-101116015 ACACAATAATTAGCCAGGTGTGG - Intronic
1073358327 10:102875184-102875206 ATGAAATATTCAGCCAGGTGCGG + Intronic
1073601491 10:104850290-104850312 TCAAAAGCTTCAGCCAGGTGCGG + Intronic
1074460025 10:113628341-113628363 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1074576438 10:114674132-114674154 ACACAAAAATCAGCCAGGTGTGG + Intronic
1076046591 10:127299252-127299274 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1078127894 11:8586059-8586081 ACAAAAAATTTAGCCAGGTGTGG + Intronic
1078827137 11:14940133-14940155 ACAGAAAATTGGGCCAGGTGTGG - Intronic
1079190595 11:18273840-18273862 GCAGAACATTAAACCAAGTGGGG + Intergenic
1079582827 11:22087547-22087569 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1080525028 11:33107159-33107181 GAAAAAAAATCAGCCAGGTGTGG + Intronic
1080754819 11:35186980-35187002 ATAGAATATTAGGCCAGGTGTGG + Intronic
1080922515 11:36723166-36723188 GCAGAAACTGGAGCCAGGTGGGG + Intergenic
1081386842 11:42481893-42481915 ACAAAAAAATCAGCCAGGTGTGG - Intergenic
1081629156 11:44676467-44676489 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1081799737 11:45849774-45849796 ACAAAATAATTAGCCAGGTGTGG - Intronic
1082176560 11:49066851-49066873 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1082846792 11:57732808-57732830 GCTGAACTTTCAGCCTGGTGGGG + Intronic
1082890162 11:58130664-58130686 GAAGAAAAATTAGCCAGGTGTGG + Intronic
1082937313 11:58668411-58668433 GAATAATATTGGGCCAGGTGCGG + Intronic
1083342973 11:61970823-61970845 ACACAAAAATCAGCCAGGTGTGG - Intergenic
1083678141 11:64339246-64339268 GCAAAATAATTAGCCAGGTGTGG + Intergenic
1083943037 11:65908256-65908278 GCATAAGAGTCAGCCAGGTGAGG - Intergenic
1084023695 11:66434386-66434408 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1084308123 11:68299736-68299758 GTACAAAAATCAGCCAGGTGTGG - Intergenic
1084777825 11:71388949-71388971 GAAGAACATTCAGCCATGGGGGG - Intergenic
1084997471 11:72995546-72995568 GTACAAAAATCAGCCAGGTGTGG + Intronic
1085004115 11:73068857-73068879 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1085170730 11:74447580-74447602 GCAGAGTATTAAACCAAGTGTGG - Intergenic
1085589715 11:77748378-77748400 GTACAAAAATCAGCCAGGTGTGG - Intronic
1086689153 11:89769024-89769046 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1086987909 11:93270124-93270146 GCAGAAAATTTAGACAGGTAGGG + Intergenic
1087480011 11:98687483-98687505 TGAGAATCTTCAGCCAGGGGTGG - Intergenic
1088048274 11:105479890-105479912 TAAGAAAATTTAGCCAGGTGCGG + Intergenic
1088509390 11:110559138-110559160 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1089547765 11:119242985-119243007 TTAGAATTTTCAGCCAGGGGTGG + Intronic
1090010758 11:123043912-123043934 AAAAAAAATTCAGCCAGGTGTGG + Intergenic
1090033662 11:123229489-123229511 GCACAAAAATTAGCCAGGTGTGG + Intergenic
1090281658 11:125461449-125461471 GCAGAAAAATTAGCCAGTTGTGG + Intronic
1090384157 11:126346932-126346954 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1090692919 11:129203598-129203620 ACATAATGTTGAGCCAGGTGTGG + Intronic
1090705521 11:129332946-129332968 TCTGAATATTTAGCTAGGTGTGG + Intergenic
1090843717 11:130514085-130514107 GCAAAATATTGGGCCATGTGCGG - Intergenic
1091153267 11:133349194-133349216 GTAAAATATTTAGCCAAGTGTGG - Intronic
1091265909 11:134270837-134270859 TCAGGATCTTCATCCAGGTGGGG - Intergenic
1091774682 12:3176774-3176796 GCACGATTCTCAGCCAGGTGTGG - Intronic
1093656624 12:21702059-21702081 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1093863029 12:24191093-24191115 GGAGAATTTAAAGCCAGGTGCGG - Intergenic
1094211482 12:27897707-27897729 ACAAAATAATTAGCCAGGTGTGG + Intergenic
1094821431 12:34229045-34229067 ACAAAATAATCAGCCTGGTGTGG + Intergenic
1095093550 12:38130260-38130282 ACAAAATAATCAGCCGGGTGTGG - Intergenic
1095281824 12:40360851-40360873 GCATAATAGTCATCCAGGTAAGG - Intronic
1095970090 12:47895818-47895840 GCAGGAGCTTCAGCCTGGTGTGG - Intronic
1096108920 12:49017500-49017522 AAAGAAAACTCAGCCAGGTGTGG - Intronic
1096296485 12:50388461-50388483 ATACAAAATTCAGCCAGGTGTGG + Intronic
1096414163 12:51399037-51399059 ACAGAAACTTCAGCCAGGTGTGG - Intronic
1096742629 12:53705130-53705152 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1097064242 12:56309113-56309135 TAAGAATTTTCTGCCAGGTGCGG + Intronic
1097259474 12:57708470-57708492 AAAAAATATTTAGCCAGGTGTGG + Intronic
1097395954 12:59074992-59075014 GCAGTATGTTCTGTCAGGTGAGG + Intergenic
1097790847 12:63813960-63813982 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1098133330 12:67374436-67374458 GTACAAAAATCAGCCAGGTGTGG + Intergenic
1098447401 12:70580527-70580549 TTAAAATATTCAGCCAGGAGTGG + Intronic
1098525996 12:71487690-71487712 TTAGAAAATTCAGCCAGGTGTGG - Intronic
1098542210 12:71669663-71669685 GAAAATTATTCAGCCAGCTGCGG + Intronic
1099457774 12:82885047-82885069 GTACAAAAATCAGCCAGGTGTGG - Intronic
1099543169 12:83940993-83941015 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1100486237 12:95030161-95030183 GCAAACATTTCAGCCAGGTGGGG - Intronic
1100510955 12:95272901-95272923 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1100630850 12:96387977-96387999 GAAAAACAATCAGCCAGGTGTGG + Intronic
1100846618 12:98665183-98665205 TTAGAAAAATCAGCCAGGTGTGG - Intronic
1101184874 12:102265318-102265340 GAAGAGTATTCACCCAGATGTGG + Intergenic
1101667708 12:106834826-106834848 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1101952260 12:109186219-109186241 CCAGTAAATCCAGCCAGGTGTGG - Intronic
1102188696 12:110969521-110969543 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
1102296723 12:111742863-111742885 GTACAAAATTTAGCCAGGTGTGG - Intronic
1102372244 12:112391804-112391826 TCAAAATATTTAGCCAGGCGTGG - Intergenic
1102823930 12:115930897-115930919 TAAAAATATTCAGCCAGGTGTGG + Intergenic
1103754138 12:123189778-123189800 CCAAAAAAATCAGCCAGGTGTGG + Intronic
1103756694 12:123213147-123213169 ACAGAATGGTCAGCCAGGCGCGG - Intronic
1104067227 12:125315982-125316004 CCAGAAAAGCCAGCCAGGTGAGG - Intronic
1104230313 12:126878090-126878112 GCAGAATAATCAGGCGGGTGAGG + Intergenic
1105045415 12:132999408-132999430 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1105402317 13:20106272-20106294 ATAGAAAAATCAGCCAGGTGTGG + Intergenic
1105718433 13:23090605-23090627 GTAAAATATTCGGCCAGGTGGGG - Intergenic
1106052032 13:26200365-26200387 GCAGAATATTAAACCAAGTGTGG - Intronic
1106166293 13:27249560-27249582 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1106275187 13:28197856-28197878 GTAAAATATTCGGCCAGGAGAGG - Intronic
1106320441 13:28632649-28632671 GCAGAAAATTTAGCCAGGCATGG - Intergenic
1106438236 13:29742561-29742583 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1106456336 13:29930560-29930582 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
1106710247 13:32323306-32323328 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1106729492 13:32524916-32524938 GTAGAAAAATTAGCCAGGTGTGG - Intronic
1107082129 13:36386279-36386301 ACAGAAAACTTAGCCAGGTGTGG + Intergenic
1107203849 13:37756686-37756708 CCAAAAAATTAAGCCAGGTGTGG - Intronic
1107511301 13:41088132-41088154 GAAGAAGAACCAGCCAGGTGTGG - Intergenic
1108197097 13:48005973-48005995 GGTAAAAATTCAGCCAGGTGTGG + Intergenic
1108867887 13:54943104-54943126 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1109204084 13:59462383-59462405 ACAAAAAATTCCGCCAGGTGTGG - Intergenic
1109305681 13:60638217-60638239 GTAGAGTTTTCGGCCAGGTGCGG + Intergenic
1110547267 13:76769387-76769409 ACAGAATAAACAGCCAGTTGTGG + Intergenic
1111858902 13:93676259-93676281 ACACAAAAGTCAGCCAGGTGTGG + Intronic
1112902216 13:104371092-104371114 GAAGAATATTTACTCAGGTGTGG + Intergenic
1113245399 13:108389466-108389488 GAAAAATATTTAACCAGGTGTGG + Intergenic
1113285704 13:108845997-108846019 TAAGAATATTTTGCCAGGTGTGG - Intronic
1113770134 13:112902949-112902971 GCAGAACATTCAGACAGGCAGGG - Intronic
1113859119 13:113469681-113469703 ACAAAATGTTAAGCCAGGTGTGG + Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114188736 14:20424562-20424584 GGAAAATTTTTAGCCAGGTGTGG - Intergenic
1114223869 14:20721306-20721328 GTACAACATTGAGCCAGGTGCGG - Intergenic
1114298787 14:21355202-21355224 GGACAATTTTCAGCCGGGTGCGG + Intronic
1114681777 14:24490969-24490991 GCAGCATCTTCAACCAGTTGGGG + Intergenic
1115193901 14:30775902-30775924 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1115853783 14:37608463-37608485 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1116381979 14:44280773-44280795 TAAGAATTTTAAGCCAGGTGTGG - Intergenic
1116810836 14:49538571-49538593 GCAGAATGCTGGGCCAGGTGTGG + Intergenic
1117490022 14:56237366-56237388 ACTGAATATTAAGCAAGGTGTGG - Intronic
1117537081 14:56712706-56712728 CCAGAAGATTCAGAGAGGTGGGG + Intronic
1117668424 14:58080944-58080966 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1118024687 14:61756840-61756862 GCAGGAGAGTCAGCCAGGCGTGG + Intergenic
1118272966 14:64360639-64360661 GAAGACCCTTCAGCCAGGTGCGG + Intergenic
1118648530 14:67865390-67865412 ATAGAATAATTAGCCAGGTGTGG - Intronic
1118868512 14:69722190-69722212 ATAGTATTTTCAGCCAGGTGCGG + Intergenic
1118948197 14:70408515-70408537 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1119009005 14:70964220-70964242 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1119332571 14:73805933-73805955 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1119365660 14:74089521-74089543 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1119461155 14:74805173-74805195 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1119540919 14:75437855-75437877 GCAGGACAGTCAGCCAGGTTGGG - Intronic
1120235300 14:81883467-81883489 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1120751355 14:88201502-88201524 ACACAAAAATCAGCCAGGTGTGG + Intronic
1121343653 14:93119537-93119559 GTTGAAAATACAGCCAGGTGGGG + Intergenic
1121457778 14:94049737-94049759 AAAAAAAATTCAGCCAGGTGTGG + Exonic
1121634394 14:95443800-95443822 GCAAAAAATTTAGCCAGGCGTGG - Intronic
1121780614 14:96619540-96619562 ACAAGAAATTCAGCCAGGTGTGG + Intergenic
1122487672 14:102092222-102092244 ACAAAAAAGTCAGCCAGGTGTGG - Intronic
1122621779 14:103062296-103062318 GGACAGTAATCAGCCAGGTGTGG + Intergenic
1122734528 14:103829764-103829786 GTAAAATATTTAGCCAGGTGTGG - Intronic
1122998451 14:105278286-105278308 CTAAAATAATCAGCCAGGTGTGG + Intronic
1124138477 15:27056193-27056215 GCAAAATAATGAGCCAGGTGTGG + Intronic
1124878040 15:33614276-33614298 GCAGAAACTGCAGCCAGGTGAGG - Intronic
1124944391 15:34250058-34250080 GCACAAAAATTAGCCAGGTGTGG - Intronic
1125964057 15:43858534-43858556 ACAGAACTCTCAGCCAGGTGCGG - Intronic
1125970471 15:43907236-43907258 GTACAATATTCAGCCATGGGAGG - Intronic
1126039824 15:44579000-44579022 ACAAAATAATTAGCCAGGTGTGG + Intronic
1126336709 15:47593247-47593269 ACAGAAAAATCAGCCAGCTGTGG + Intronic
1126630373 15:50728796-50728818 ATACAATAATCAGCCAGGTGTGG - Intronic
1127352549 15:58167876-58167898 ACAAAATAATTAGCCAGGTGTGG - Intronic
1127627139 15:60790697-60790719 GCAGAATACTCAGCCAGCATTGG - Intronic
1128043939 15:64600478-64600500 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1128179538 15:65589446-65589468 GATAAATATTCAGCCAGGTGTGG - Intronic
1129009667 15:72404121-72404143 TCAGAAGAATCTGCCAGGTGTGG + Intronic
1129614661 15:77088916-77088938 GCAGAATATTGAGACAGGAGTGG - Intergenic
1129834588 15:78694085-78694107 GCAGAATATTCAGCCAGGTGTGG - Intronic
1129870955 15:78941035-78941057 GGATAAAATTCTGCCAGGTGGGG - Intronic
1129900459 15:79144240-79144262 GCAGAATTTTGATCCAGGGGTGG - Intergenic
1130545037 15:84850537-84850559 ACAAAATATTTAGCCAGGTGTGG - Intronic
1130796057 15:87210676-87210698 GCAGAATTTTCTTCCAGCTGAGG + Intergenic
1131120110 15:89816955-89816977 ACACAAAAATCAGCCAGGTGTGG + Intergenic
1132755770 16:1484417-1484439 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1133762899 16:8814020-8814042 ACACAAAAATCAGCCAGGTGTGG - Intronic
1133797651 16:9059231-9059253 GAAAAAAATCCAGCCAGGTGCGG - Intergenic
1133963570 16:10515506-10515528 AGAAAATCTTCAGCCAGGTGTGG + Intergenic
1134006729 16:10822915-10822937 GGAGAACATTCGGCCAGGGGAGG + Intergenic
1134148506 16:11787144-11787166 ACAAAAAATTAAGCCAGGTGTGG + Intronic
1134356867 16:13490407-13490429 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1134532138 16:14991454-14991476 GTACAAAAATCAGCCAGGTGTGG - Intronic
1134538921 16:15048777-15048799 GTATAAAACTCAGCCAGGTGTGG - Intronic
1134538949 16:15048912-15048934 GTATAAAAATCAGCCAGGTGTGG - Intronic
1134538976 16:15049047-15049069 GTATAAAACTCAGCCAGGTGTGG - Intronic
1134539005 16:15049182-15049204 GTATAAAAATCAGCCAGGTGTGG - Intronic
1134622522 16:15700250-15700272 ACAAAAAATTCAGCCAGGTGTGG - Intronic
1134675787 16:16089719-16089741 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1135428622 16:22362189-22362211 GTATAAAATTCAGCCGGGTGCGG - Intronic
1135468680 16:22709778-22709800 GAAAAAAAATCAGCCAGGTGTGG - Intergenic
1135512638 16:23100480-23100502 GCAGAATAGTGGGCCGGGTGTGG + Intronic
1135580649 16:23623356-23623378 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1135666706 16:24341785-24341807 CAAGAATATAGAGCCAGGTGGGG + Intronic
1136383789 16:29910511-29910533 TCAAAAAATTTAGCCAGGTGTGG - Intronic
1136488295 16:30587245-30587267 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1136850881 16:33611351-33611373 ATACAATAATCAGCCAGGTGTGG - Intergenic
1137276817 16:46940164-46940186 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1138624689 16:58241174-58241196 ACACAAAATTTAGCCAGGTGTGG - Intronic
1138690313 16:58761492-58761514 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1138761158 16:59546227-59546249 GTACAATAATTAGCCAGGTGTGG + Intergenic
1139010301 16:62623487-62623509 GCAAAAAACTTAGCCAGGTGTGG + Intergenic
1139055793 16:63181692-63181714 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1139704422 16:68731202-68731224 ATAGAATAATTAGCCAGGTGTGG + Intergenic
1139738782 16:69016813-69016835 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1139779785 16:69340862-69340884 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1140107814 16:71976896-71976918 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1140490049 16:75327877-75327899 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1140642616 16:76994166-76994188 ACAAAATAGTTAGCCAGGTGTGG - Intergenic
1140726867 16:77821444-77821466 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1140797427 16:78452629-78452651 ACATAATAATTAGCCAGGTGTGG - Intronic
1141454375 16:84129993-84130015 GCAGAAAATGCAGCCAGCTGAGG + Exonic
1141953501 16:87354317-87354339 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1142135699 16:88451102-88451124 GCAGGATGTTGAGCCCGGTGTGG - Intergenic
1203112485 16_KI270728v1_random:1459808-1459830 ATACAATAATCAGCCAGGTGTGG - Intergenic
1203138467 16_KI270728v1_random:1745365-1745387 GTACAAAAATCAGCCAGGTGAGG + Intergenic
1142771179 17:2098142-2098164 ACAGAACACACAGCCAGGTGTGG - Intronic
1142776140 17:2140514-2140536 GCAAAAAAATCAGCCGGGTGTGG + Intronic
1142797302 17:2318438-2318460 GAAACATGTTCAGCCAGGTGTGG - Intronic
1142886511 17:2915851-2915873 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1142905466 17:3038382-3038404 ACACAAAATTTAGCCAGGTGTGG + Intergenic
1143063750 17:4225914-4225936 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1143072122 17:4305106-4305128 ACAAAAAATTTAGCCAGGTGAGG - Intronic
1143454365 17:7056644-7056666 ACAGAAATTTGAGCCAGGTGTGG - Intergenic
1143531468 17:7507174-7507196 ACAAAAAATTTAGCCAGGTGTGG + Intronic
1143878935 17:10014862-10014884 GCAGATTAGCCAGCCAGGTGCGG + Intronic
1144076030 17:11719959-11719981 GCAGAATATTCTGCAAGGGCAGG + Intronic
1144289820 17:13815651-13815673 GCAAAAAAATCAGCCGGGTGTGG - Intergenic
1144604310 17:16651272-16651294 ACAAAATGATCAGCCAGGTGTGG + Intronic
1145949305 17:28803687-28803709 GAAGACATTTCAGCCAGGTGCGG + Intronic
1146070672 17:29678247-29678269 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1146189736 17:30754197-30754219 GCAAAAAATTAGGCCAGGTGCGG + Intergenic
1146223079 17:31043089-31043111 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1146341918 17:32026898-32026920 ACTGAATATTTGGCCAGGTGAGG + Intronic
1146350891 17:32092741-32092763 ACTGAATATTTGGCCAGGTGAGG - Intergenic
1146973547 17:37092122-37092144 ACAAAAAAATCAGCCAGGTGGGG + Intronic
1147222732 17:38948366-38948388 ACAAAATAATCAGCCAGGCGTGG - Intronic
1147272048 17:39280077-39280099 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1148362519 17:47024064-47024086 ACTGAATATTTGGCCAGGTGAGG + Intronic
1148504248 17:48114819-48114841 ACAAAATAGTCAGCCAGGCGTGG - Intronic
1149061602 17:52429077-52429099 AATAAATATTCAGCCAGGTGTGG + Intergenic
1149349263 17:55770873-55770895 GCAAAAAAATCAGCCAGGTATGG - Intronic
1149501658 17:57157300-57157322 ATACAATACTCAGCCAGGTGTGG + Intergenic
1149908568 17:60549654-60549676 CCAAAAAATTTAGCCAGGTGTGG + Intergenic
1149946993 17:60939275-60939297 ACAAAAAATTTAGCCAGGTGTGG + Intronic
1151115835 17:71733880-71733902 GTAGAAGATGCAGCCAGGTGTGG - Intergenic
1152002051 17:77652966-77652988 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1152071468 17:78135896-78135918 ACACAAAAATCAGCCAGGTGTGG + Intronic
1152110336 17:78354178-78354200 GTACAAAATTTAGCCAGGTGTGG + Intergenic
1152484728 17:80583069-80583091 TGAGAATATTTAGCCAGGCGTGG - Intronic
1152577725 17:81150193-81150215 GTAGAACATTCACCAAGGTGTGG - Intronic
1152882486 17:82826929-82826951 TAAAAATAGTCAGCCAGGTGTGG - Intronic
1153200844 18:2646206-2646228 CCAGCACATTTAGCCAGGTGTGG + Intergenic
1153423571 18:4937157-4937179 ACAAAAAAATCAGCCAGGTGAGG + Intergenic
1153446721 18:5180995-5181017 AAAGAAAATACAGCCAGGTGTGG + Intronic
1153915509 18:9741218-9741240 GCACAAAAATTAGCCAGGTGTGG + Intronic
1155123743 18:22849644-22849666 GCAAAAAAATCAGCCGGGTGTGG - Intronic
1155143893 18:23067929-23067951 GAAAAATTTTTAGCCAGGTGTGG - Intergenic
1155189236 18:23414515-23414537 GTAGAAAAATAAGCCAGGTGTGG + Intronic
1156318193 18:35991341-35991363 GAAAAAGATTCAGCCAAGTGGGG - Exonic
1156925363 18:42571153-42571175 GTACAAAAATCAGCCAGGTGTGG - Intergenic
1158242394 18:55391640-55391662 GAAGAACATTCTGCCAGGCGCGG + Intronic
1158274717 18:55754907-55754929 GTACAAAAATCAGCCAGGTGTGG - Intergenic
1158414301 18:57235867-57235889 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1158449983 18:57555631-57555653 GAAGAAAATAAAGCCAGGTGAGG - Intronic
1158456382 18:57611916-57611938 ACAAAATAATTAGCCAGGTGTGG - Intronic
1158516424 18:58134289-58134311 TAAGAATATTAGGCCAGGTGCGG - Intronic
1158899043 18:61944816-61944838 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1158965992 18:62622692-62622714 ACACAAAAATCAGCCAGGTGTGG + Intergenic
1159267547 18:66102286-66102308 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1159392266 18:67808099-67808121 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1159589572 18:70318778-70318800 ATAGAATAATTAGCCAGGTGTGG + Intronic
1159778168 18:72628149-72628171 GCAGAACATTAAACCAAGTGTGG - Intronic
1161003620 19:1923772-1923794 ACAAAATAATTAGCCAGGTGCGG - Intronic
1161116502 19:2499901-2499923 GAAGAATTCTCAGCCAGGCGCGG - Intergenic
1161833257 19:6625673-6625695 TAAAACTATTCAGCCAGGTGCGG - Intergenic
1161956360 19:7497858-7497880 GCAGCAAACTCAGCCAGGCGCGG + Intronic
1162260315 19:9528139-9528161 ACAAAAAATTTAGCCAGGTGTGG - Exonic
1162458667 19:10801461-10801483 AAAGAAAAATCAGCCAGGTGTGG + Intronic
1162465868 19:10839878-10839900 GAAAAATAATTAGCCAGGTGTGG - Intronic
1162715261 19:12627023-12627045 ACAGAAAATTCAGTCAGTTGTGG + Intronic
1163131801 19:15278378-15278400 ACAGAAAAATCAGCCAGGTATGG + Intronic
1164269454 19:23658203-23658225 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1164313504 19:24066742-24066764 CCACAAAAATCAGCCAGGTGTGG + Intronic
1164313862 19:24069625-24069647 AAAGAATATTCTGCCAGGTGTGG + Intronic
1165131135 19:33632922-33632944 GCACAAAAATTAGCCAGGTGTGG - Intronic
1165150485 19:33757232-33757254 ACACAAAATTTAGCCAGGTGTGG + Intronic
1165277120 19:34763924-34763946 ACAAAAAATTCAGCCAGGTGTGG + Intronic
1165726549 19:38116896-38116918 CCAGAATATTCACCCAGGGCAGG - Intronic
1165953272 19:39486579-39486601 GCAGAACCATAAGCCAGGTGAGG - Intronic
1166203603 19:41254237-41254259 GTACAAAATTCAGCCTGGTGCGG + Intronic
1166545621 19:43633227-43633249 GCACAAAAATTAGCCAGGTGTGG - Intronic
1166708777 19:44924095-44924117 CCAGAGTATCCAGCCAGGAGGGG + Intergenic
1166710748 19:44935703-44935725 CCAGAGTATCCAGCCAGGAGGGG + Intergenic
1166717188 19:44976143-44976165 TCAGAAAGTCCAGCCAGGTGGGG - Intronic
1167021299 19:46878174-46878196 ACAAAACATTTAGCCAGGTGTGG - Intergenic
1167097891 19:47384850-47384872 ACACAAAATTTAGCCAGGTGTGG - Intergenic
1167106618 19:47433795-47433817 ACAAAAAAATCAGCCAGGTGGGG - Intronic
1167212898 19:48144655-48144677 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1167360626 19:49028592-49028614 GAAGGTTATACAGCCAGGTGGGG + Intronic
1167361806 19:49034065-49034087 GAAGGTTATACAGCCAGGTGGGG - Intronic
1167364271 19:49046787-49046809 GAAGGTTATACAGCCAGGTGGGG + Intergenic
1167520079 19:49949549-49949571 GTATAATCTTCAGCCAGCTGTGG + Exonic
1167565876 19:50256525-50256547 ACAAAAAATTAAGCCAGGTGTGG - Intronic
1167656801 19:50770205-50770227 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1167733908 19:51279552-51279574 GTAGAAAAATTAGCCAGGTGTGG + Intergenic
1168499552 19:56881911-56881933 AAATAATAGTCAGCCAGGTGTGG + Intergenic
1168653943 19:58113158-58113180 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1168723176 19:58565983-58566005 ACAAAATATTTAGCCAGGCGTGG + Intronic
925182030 2:1823600-1823622 GCTGAACATGCAGCCAGCTGAGG - Intronic
925193478 2:1904522-1904544 GCAAAAAAATTAGCCAGGTGTGG - Intronic
926126334 2:10274404-10274426 ACAGAAAAATTAGCCAGGTGCGG - Intergenic
926193661 2:10746976-10746998 AAAGAATTCTCAGCCAGGTGCGG + Intronic
926228572 2:10985762-10985784 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
926988111 2:18646193-18646215 ACAAAATAATTAGCCAGGTGTGG + Intergenic
927601564 2:24446812-24446834 ACAAAATAATTAGCCAGGTGTGG - Intergenic
927788027 2:25987533-25987555 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
927830308 2:26344675-26344697 GCAAAAAATTTAGCCGGGTGTGG + Intronic
927986776 2:27416944-27416966 ACAGAAAAATAAGCCAGGTGTGG + Intergenic
927994816 2:27477113-27477135 CCAAAAGCTTCAGCCAGGTGTGG - Intronic
928142660 2:28744121-28744143 GAAGAAGATCAAGCCAGGTGTGG + Intergenic
928265332 2:29806583-29806605 GTAGAAAATCCTGCCAGGTGAGG - Intronic
928962143 2:36938268-36938290 GCACAAAAATTAGCCAGGTGTGG + Intronic
929127525 2:38535260-38535282 GCAGAATGTTCAGACAGGTCTGG + Intergenic
929132973 2:38596412-38596434 CCACAAAAATCAGCCAGGTGTGG - Intronic
929327708 2:40637278-40637300 GCAGAAAACAGAGCCAGGTGGGG - Intergenic
929491330 2:42399210-42399232 GCACAAAAATTAGCCAGGTGTGG - Intronic
929741174 2:44602159-44602181 ACACAAAAATCAGCCAGGTGTGG - Intronic
930327848 2:49942763-49942785 ATAGAAAAATCAGCCAGGTGTGG - Intronic
930538982 2:52680836-52680858 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
930784052 2:55253386-55253408 ACACAATTTTCAGCCAGGCGCGG + Intronic
930827800 2:55711869-55711891 GCAAAAAATTTAGCCAGGTGTGG - Intergenic
931266971 2:60669248-60669270 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
931391843 2:61851200-61851222 ACAGAATTTTCAGTCTGGTGAGG - Intronic
931399171 2:61914844-61914866 GCACAAAATTTAGCCAGGCGTGG - Intronic
931707303 2:64957854-64957876 GAAGAAGATTCAGGGAGGTGGGG + Intergenic
931740905 2:65243121-65243143 ATAGAAAAATCAGCCAGGTGTGG + Intronic
931754429 2:65359772-65359794 GCAAAAAATTGGGCCAGGTGCGG + Intronic
931830354 2:66044565-66044587 GAAAAAAAATCAGCCAGGTGTGG + Intergenic
932614759 2:73224939-73224961 GGAGGATATTAAGCCAGGAGAGG + Exonic
932671112 2:73738580-73738602 GAAGAACATTCGGCCAGGTGCGG + Intergenic
933108920 2:78372730-78372752 GCAAAAGCTTCGGCCAGGTGCGG + Intergenic
933900807 2:86848870-86848892 ACACAAAAATCAGCCAGGTGTGG - Intronic
934175774 2:89579437-89579459 GCACAAAAATTAGCCAGGTGTGG + Intergenic
934286088 2:91653801-91653823 GCACAAAAATTAGCCAGGTGTGG + Intergenic
934945686 2:98539659-98539681 GAGGAAGATGCAGCCAGGTGAGG + Exonic
935051238 2:99526755-99526777 ACACAAAAATCAGCCAGGTGTGG - Intergenic
935883404 2:107590054-107590076 GCAAAATTTTCAGCCGGGCGCGG + Intergenic
935942936 2:108260305-108260327 GCAGAAGATTCAGCACAGTGGGG + Intronic
936363820 2:111832772-111832794 ACAGAAAAATTAGCCAGGTGTGG + Intronic
936391625 2:112080083-112080105 ACAGAAAAATTAGCCAGGTGGGG - Intronic
936577112 2:113666387-113666409 ACAGAAAAATTAGCCAGGTGAGG - Intergenic
937208254 2:120250862-120250884 GCAGTATATTCAGAGAGGAGTGG - Intronic
938082540 2:128377860-128377882 GCAGGCTCTTCAGTCAGGTGGGG + Intergenic
939438111 2:142204868-142204890 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
940013629 2:149080684-149080706 GTACAAAAATCAGCCAGGTGTGG + Intronic
940199367 2:151133102-151133124 AGAAAATATTCAGCCAGGCGCGG + Intergenic
941627254 2:167843795-167843817 GCAGAATGATGAGCCAGGTTGGG + Intergenic
941852073 2:170194347-170194369 TAAAAATATTTAGCCAGGTGTGG + Intronic
942809202 2:179976862-179976884 ACAGAATTACCAGCCAGGTGCGG + Intronic
943410951 2:187547147-187547169 GCAAAATGTTCACCCAGGTATGG + Intronic
943767025 2:191674162-191674184 TAAAAATAATCAGCCAGGTGTGG + Intergenic
944356985 2:198801805-198801827 ACAGAAAAATCAGCCGGGTGTGG + Intergenic
944912378 2:204323182-204323204 AAAGAAAAATCAGCCAGGTGTGG - Intergenic
945005176 2:205397744-205397766 GCAAAATATTCAACACGGTGGGG - Intronic
947413190 2:229865015-229865037 GCACAATATTGGGCCAGGTGTGG + Intronic
947652804 2:231801603-231801625 GAAAAAAAATCAGCCAGGTGTGG - Intronic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
948999665 2:241605871-241605893 GAAAAGTATTTAGCCAGGTGTGG - Intronic
1168848905 20:963248-963270 GCAGACTTTTCAGCTACGTGAGG - Intronic
1169078907 20:2782546-2782568 ACACAAAAATCAGCCAGGTGTGG + Intergenic
1169546485 20:6656125-6656147 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1170717918 20:18847964-18847986 GCAGACTATTAAGCCAAGTGTGG + Intergenic
1170976781 20:21172447-21172469 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1171225769 20:23440910-23440932 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1171982154 20:31635767-31635789 ACAGAAGAGACAGCCAGGTGCGG - Intergenic
1172251838 20:33485121-33485143 TAAGAATATTAGGCCAGGTGCGG - Intergenic
1172421298 20:34820613-34820635 ACACAAAAATCAGCCAGGTGTGG + Exonic
1172439008 20:34952328-34952350 CCAGAATGTTCAGCCAGGTTTGG - Intronic
1172656011 20:36538921-36538943 GTAGAAAACTTAGCCAGGTGTGG + Intergenic
1172915153 20:38438039-38438061 CCAGAAGATTCAGCCTGGTGAGG - Intergenic
1173007003 20:39147641-39147663 AAAAAATAATCAGCCAGGTGTGG + Intergenic
1173194373 20:40902108-40902130 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1173280120 20:41619518-41619540 ACAGAGTATTCAGCCAGGCAGGG - Intergenic
1173738333 20:45377645-45377667 CCAGAGGAATCAGCCAGGTGTGG + Intronic
1173977370 20:47197102-47197124 ACAAAAAATTCAGCCAGGTGTGG - Intergenic
1174244819 20:49170504-49170526 ACAAAATAATTAGCCAGGTGTGG - Intronic
1174307372 20:49623287-49623309 GTACAAAAATCAGCCAGGTGTGG + Intergenic
1174384179 20:50176933-50176955 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1174987959 20:55476518-55476540 AAAAAATAATCAGCCAGGTGTGG - Intergenic
1175434533 20:58934164-58934186 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1175607374 20:60322098-60322120 GTACAAAATTTAGCCAGGTGTGG + Intergenic
1176308876 21:5139250-5139272 GTAGAAAAATTAGCCAGGTGTGG - Intronic
1176512028 21:7755937-7755959 TCAGGGGATTCAGCCAGGTGTGG + Intronic
1176788495 21:13289492-13289514 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1176872372 21:14093895-14093917 ACAAAATAATCAGCCAAGTGTGG + Intergenic
1177987645 21:27997694-27997716 GCTAAATATTTGGCCAGGTGTGG - Intergenic
1178611797 21:34089181-34089203 ACACAAAAATCAGCCAGGTGTGG - Intronic
1178646141 21:34386463-34386485 TCAGGGGATTCAGCCAGGTGTGG + Intronic
1179611543 21:42555139-42555161 ATACAAAATTCAGCCAGGTGTGG - Intronic
1179726616 21:43344669-43344691 GGAGAACATTCAGGCAGGTCGGG - Intergenic
1179848186 21:44122783-44122805 GTAGAAAAATTAGCCAGGTGTGG + Intronic
1180893218 22:19306812-19306834 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1181460641 22:23083935-23083957 GCTGTGTTTTCAGCCAGGTGGGG + Intronic
1181525576 22:23483621-23483643 TAAAAATAATCAGCCAGGTGTGG + Intergenic
1181581090 22:23828496-23828518 GTAGAAAAATTAGCCAGGTGTGG + Intronic
1181639163 22:24187827-24187849 GCAGAGCCTGCAGCCAGGTGAGG + Exonic
1181874653 22:25930625-25930647 ACAGAACAATTAGCCAGGTGTGG - Intronic
1182614129 22:31574901-31574923 GCAGAAAAATCAGCCAGGGGTGG + Intronic
1183150414 22:36032570-36032592 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1183848880 22:40566373-40566395 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1184121678 22:42454765-42454787 GTACAAAATTTAGCCAGGTGTGG - Intergenic
1184123451 22:42469720-42469742 GAAGAAGATTCAGCCAGGCCTGG + Intergenic
1184234201 22:43174385-43174407 GCAGGAAACTCAGCCAGGAGAGG - Exonic
1184353733 22:43964061-43964083 GCAGAAAAATTAGCCAGGTGTGG - Intronic
1184737408 22:46407474-46407496 ACAGCAAATTTAGCCAGGTGTGG + Intronic
1185423126 22:50746277-50746299 ACAGAAAAATTAGCCAGGTGAGG + Intergenic
949108137 3:224978-225000 ACAGAAAAATTAGCCAGGTGTGG + Intronic
949135724 3:562622-562644 ACAAAAAAATCAGCCAGGTGTGG - Intergenic
949439909 3:4069373-4069395 GCTGAATATTTAACCAAGTGTGG - Intronic
949865491 3:8543636-8543658 ACTGAAAAATCAGCCAGGTGTGG - Intronic
949993910 3:9601534-9601556 ATAGAAAATTTAGCCAGGTGTGG + Intergenic
950033457 3:9867139-9867161 GCAGTATCTTCAGACAGGTCGGG + Exonic
950055101 3:10017916-10017938 GCAGTATCTTCAGACAGGTCGGG + Intergenic
950066694 3:10117547-10117569 GCACAAAAATCAGCCAGGTGTGG - Intronic
950283661 3:11727940-11727962 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
950993744 3:17470764-17470786 ACAAAAAAATCAGCCAGGTGTGG + Intronic
951038846 3:17966105-17966127 CCACAAAAATCAGCCAGGTGTGG - Intronic
951339545 3:21468112-21468134 GTAGTATATGGAGCCAGGTGTGG + Intronic
951480830 3:23160478-23160500 ACACAATAATTAGCCAGGTGTGG + Intergenic
952040180 3:29251971-29251993 AAAGAATTTTCAGCCAGGTATGG - Intergenic
952272566 3:31847349-31847371 GTACAAAAATCAGCCAGGTGTGG - Intronic
952353526 3:32563445-32563467 ACAGAAAAATTAGCCAGGTGTGG - Intronic
953208016 3:40849213-40849235 AGAGGAAATTCAGCCAGGTGTGG + Intergenic
953596596 3:44320440-44320462 ACAAAAAATTTAGCCAGGTGTGG + Intronic
954022820 3:47757484-47757506 TCAGAACGCTCAGCCAGGTGTGG + Intronic
954187719 3:48931724-48931746 TCACAATTTTCAGCCGGGTGCGG + Intronic
954707025 3:52486563-52486585 ACAGAAAAATTAGCCAGGTGTGG - Intronic
954872954 3:53781461-53781483 GCAGCATGTTCATCCAGGTCAGG + Intronic
955015086 3:55062402-55062424 TGAGAAGATACAGCCAGGTGTGG - Intronic
955185837 3:56714299-56714321 TCTCAAAATTCAGCCAGGTGTGG - Intergenic
956125735 3:66009223-66009245 AAAGAATATCCGGCCAGGTGCGG + Intronic
956533901 3:70253565-70253587 ACAAAATAATTAGCCAGGTGTGG + Intergenic
957246351 3:77721674-77721696 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
957826784 3:85457255-85457277 ACATAAAATTTAGCCAGGTGTGG + Intronic
958029263 3:88087363-88087385 CCAGGATTTTCAGCCAGGTGTGG - Intronic
958598112 3:96256617-96256639 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
958856479 3:99392127-99392149 GCAGAATATCCAGACAGTTGAGG + Intergenic
959081896 3:101810973-101810995 ACAGAAAAATTAGCCAGGTGTGG - Intronic
960073737 3:113459724-113459746 ACACAAAAATCAGCCAGGTGTGG + Intronic
960863600 3:122178586-122178608 ACAAAAAAATCAGCCAGGTGTGG - Intergenic
961099876 3:124189647-124189669 ACAAAATATTAGGCCAGGTGCGG + Intronic
964110235 3:153079964-153079986 ACAAAAAAATCAGCCAGGTGTGG - Intergenic
964129800 3:153273741-153273763 GCACAAAAATTAGCCAGGTGTGG + Intergenic
964568091 3:158080550-158080572 GAAGAACATTGGGCCAGGTGTGG + Intergenic
964705351 3:159612589-159612611 GTAGAAAAATTAGCCAGGTGTGG + Intronic
966608911 3:181849069-181849091 GCTGAATATCAGGCCAGGTGTGG + Intergenic
966695242 3:182783455-182783477 ACAGAAAATTGAGTCAGGTGAGG + Intergenic
966699142 3:182825742-182825764 ACAGAAAAATTAGCCAGGTGTGG + Intronic
966864928 3:184252785-184252807 ACATAAAAATCAGCCAGGTGTGG + Intronic
967063813 3:185896203-185896225 AGAAAACATTCAGCCAGGTGTGG - Intergenic
967069896 3:185953346-185953368 GCAGAAAAATTAGCCAGGTATGG - Intergenic
967307023 3:188069278-188069300 ACAGAAATATCAGCCAGGTGTGG - Intergenic
968347847 3:198026108-198026130 TAAGAAAAATCAGCCAGGTGTGG - Intronic
968444429 4:642638-642660 GCAAAAAAGTTAGCCAGGTGTGG + Intronic
970944746 4:21677903-21677925 ACAAAATAATTAGCCAGGTGTGG - Intronic
970975570 4:22039455-22039477 AAAGAATTTTCGGCCAGGTGTGG - Intergenic
971019445 4:22518603-22518625 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
972096610 4:35354864-35354886 GCAAAAAATTTAGCCGGGTGTGG + Intergenic
972307842 4:37849561-37849583 GTACAAAAATCAGCCAGGTGTGG - Intronic
972605260 4:40607812-40607834 GGCGAATTTTCAGCCAGGCGCGG + Intronic
972675232 4:41254098-41254120 GCAGAATTCTTAGCCAGGTGTGG - Intergenic
973017111 4:45154208-45154230 GTACAAAATTTAGCCAGGTGTGG - Intergenic
973801254 4:54481182-54481204 GAAGAATATTCAGGCGGGTGTGG + Intergenic
973991971 4:56418125-56418147 AAATAATCTTCAGCCAGGTGCGG - Intronic
974339538 4:60597760-60597782 ACAGAATATTCAGGCAAGAGAGG + Intergenic
975138549 4:70897993-70898015 ACAAAAAAATCAGCCAGGTGTGG - Intergenic
975585538 4:75944617-75944639 GCAAAAAAATTAGCCAGGTGTGG - Intronic
976253436 4:83076622-83076644 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
976344057 4:83979409-83979431 GCACAAAAATTAGCCAGGTGTGG + Intergenic
976567485 4:86567508-86567530 TAAGAATTTTCAGCCAGGTGTGG - Intronic
976968088 4:91070138-91070160 ACAAAAAATTTAGCCAGGTGTGG - Intronic
978602835 4:110446753-110446775 ACTGAATAACCAGCCAGGTGTGG + Intronic
979016845 4:115445627-115445649 GCACAAAAATTAGCCAGGTGTGG - Intergenic
979235130 4:118391341-118391363 AGACAGTATTCAGCCAGGTGTGG + Intergenic
979750749 4:124275878-124275900 GCAGAATTTTCCACCAGGTATGG + Intergenic
980009061 4:127576130-127576152 AAAGAGTATTTAGCCAGGTGTGG + Intergenic
980069088 4:128223698-128223720 GCACAAAAATTAGCCAGGTGTGG - Intergenic
980639829 4:135563202-135563224 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
980830993 4:138129019-138129041 GCATAAAAATTAGCCAGGTGTGG - Intergenic
980959749 4:139463287-139463309 ACAGAAAAATTAGCCAGGTGTGG - Intronic
981425780 4:144601404-144601426 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
981751767 4:148099248-148099270 GCAGAATATTATGCCAAGAGTGG + Intronic
981993851 4:150955117-150955139 ACAGAAAAATGAGCCAGGTGTGG + Intronic
982302256 4:153891883-153891905 ACACAATAATCAGCCACGTGTGG - Intergenic
984259570 4:177428269-177428291 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
984705351 4:182843695-182843717 AAAGAAAATTCAGCCAGGTGTGG + Intergenic
984783041 4:183543279-183543301 GTAGAAAAATTAGCCAGGTGTGG + Intergenic
988488397 5:31686517-31686539 CAAAAAAATTCAGCCAGGTGTGG - Intronic
988512217 5:31874468-31874490 AGAGAAAATGCAGCCAGGTGTGG + Intronic
988519016 5:31929694-31929716 ACAGAAAAATCAGCCGGGTGTGG + Intronic
989026574 5:37075213-37075235 GTAGAATTTTCAGCTGGGTGTGG + Intergenic
989163789 5:38415516-38415538 ACAGAAAAATTAGCCAGGTGTGG + Intronic
989717474 5:44481286-44481308 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
989802673 5:45563294-45563316 ACAAAAAAATCAGCCAGGTGTGG + Intronic
990169216 5:53029114-53029136 ACACAAAAATCAGCCAGGTGTGG + Intronic
990557211 5:56949200-56949222 ACAAAAAAATCAGCCAGGTGTGG + Intronic
991323046 5:65397719-65397741 AAAGAAAAATCAGCCAGGTGTGG + Intronic
991921459 5:71661802-71661824 GCAGAATATTAGGCTGGGTGCGG - Intergenic
992013263 5:72551873-72551895 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
992309242 5:75478155-75478177 ACAGAAAAATTAGCCAGGTGTGG + Intronic
993138760 5:84003224-84003246 TCAAAATCATCAGCCAGGTGTGG - Intronic
993534308 5:89062589-89062611 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
995789418 5:115868724-115868746 GTACAAAAATCAGCCAGGTGTGG + Intronic
997126775 5:131235042-131235064 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
997310947 5:132882055-132882077 GTAGAAAAATTAGCCAGGTGTGG + Intronic
997934821 5:138101224-138101246 GAGGAAGAATCAGCCAGGTGTGG + Intergenic
998013397 5:138713329-138713351 GCCAAATATTCAGCAAGGTGTGG - Intronic
998313037 5:141154116-141154138 ATAAAATAGTCAGCCAGGTGTGG - Intergenic
999278786 5:150350700-150350722 GCAGAAGAACCAGCCAGGAGAGG - Intergenic
999344554 5:150804678-150804700 AAAGAATAATTAGCCAGGTGTGG + Intergenic
999792945 5:154959497-154959519 ACACAAAAATCAGCCAGGTGTGG - Intronic
999890889 5:155977655-155977677 CCAGAATATTCACCCAGGAGGGG + Intronic
1000278478 5:159761464-159761486 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1000342501 5:160288578-160288600 AAAGAATAACCAGCCAGGTGTGG + Intronic
1000571914 5:162925283-162925305 GAAGAAAATTGGGCCAGGTGCGG + Intergenic
1001480193 5:172083615-172083637 TAAGAATATTCAGCTGGGTGTGG + Intronic
1001980136 5:176032170-176032192 ACACAAAAATCAGCCAGGTGTGG + Intronic
1002237246 5:177811493-177811515 ACACAAAAATCAGCCAGGTGTGG - Intergenic
1002609340 5:180404167-180404189 GCAAAACATTTAGCTAGGTGTGG + Intergenic
1002622715 5:180500264-180500286 TAAGAAAAATCAGCCAGGTGTGG - Intronic
1002708989 5:181182858-181182880 GAATAAAAATCAGCCAGGTGTGG + Intergenic
1003008455 6:2403962-2403984 GCAGACTCTTCAGACAGGTTGGG - Intergenic
1003057674 6:2837432-2837454 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1003190859 6:3873188-3873210 GCAGCACATTCAGCCTGGTTGGG - Intergenic
1003211793 6:4075176-4075198 ACACAAAAATCAGCCAGGTGTGG + Intronic
1003880191 6:10473542-10473564 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1003910634 6:10740661-10740683 GCAGAATGGCCAGCCAGGCGTGG - Intergenic
1003990448 6:11481577-11481599 ACAGAACAGTTAGCCAGGTGTGG + Intergenic
1004787446 6:18984993-18985015 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1005009916 6:21325993-21326015 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1005126294 6:22450316-22450338 ACAGAAAAGTTAGCCAGGTGTGG - Intergenic
1005380994 6:25234225-25234247 TGAGAATTCTCAGCCAGGTGTGG - Intergenic
1005642756 6:27812552-27812574 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1005877464 6:30022925-30022947 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1005888125 6:30112736-30112758 GCAGAATGTCCAGGCAGATGGGG + Exonic
1005949662 6:30622405-30622427 ACAAAATAATTAGCCAGGTGTGG + Intronic
1006494054 6:34408659-34408681 ACAGAAAAATTAGCCAGGTGCGG - Intronic
1006514056 6:34536327-34536349 AGAGAATACCCAGCCAGGTGGGG + Intergenic
1006542475 6:34751706-34751728 GTAGAAAAATTAGCCAGGTGTGG - Intergenic
1006807825 6:36799928-36799950 GCTGAAGATGCAGCCAGGTGGGG - Intronic
1006924182 6:37645376-37645398 ACACAAAAATCAGCCAGGTGCGG + Intronic
1007010981 6:38417093-38417115 AAAGAATAATTAGCCAGGTGTGG - Intronic
1007144208 6:39611150-39611172 GCAAAAGAATTAGCCAGGTGTGG + Intronic
1007463750 6:42037092-42037114 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1007490915 6:42221137-42221159 GCAGAACACTCACCCAGCTGAGG - Intergenic
1007508467 6:42356728-42356750 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1007612636 6:43160406-43160428 GCAGTATTTTCGGCCAGGTGTGG - Intronic
1007810594 6:44483027-44483049 TCTGAATATGCTGCCAGGTGAGG - Intergenic
1008251942 6:49251005-49251027 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1008255620 6:49296164-49296186 GCAGAATATATAGCAATGTGTGG + Intergenic
1009205056 6:60790899-60790921 CCAAATGATTCAGCCAGGTGTGG - Intergenic
1009405349 6:63305768-63305790 AAATAATATCCAGCCAGGTGGGG + Intronic
1009939005 6:70267837-70267859 GCAGAAGATTCAGCCTGGACTGG - Intronic
1009964616 6:70565521-70565543 ATAGAAAAATCAGCCAGGTGTGG + Intergenic
1010222064 6:73456613-73456635 GCACAAAAATTAGCCAGGTGTGG + Intergenic
1010248210 6:73681891-73681913 TCGGAATTTCCAGCCAGGTGCGG - Intergenic
1010525729 6:76898193-76898215 GCATAAAATTCAGACAGGTAGGG - Intergenic
1010682411 6:78812012-78812034 GCAGAACATTAAACCAAGTGGGG - Intergenic
1010913992 6:81593197-81593219 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1011639421 6:89405196-89405218 ACAAAAAAATCAGCCAGGTGTGG + Intronic
1013062082 6:106644446-106644468 GAAAAAAATTCAGCCAGGTGAGG - Intronic
1013119935 6:107132205-107132227 ACAGGATGTTTAGCCAGGTGCGG + Intergenic
1013374413 6:109500725-109500747 GCATCACACTCAGCCAGGTGTGG + Intronic
1013484687 6:110585424-110585446 TAAGAATATTCAGCCAGGTGTGG - Intergenic
1013781906 6:113738088-113738110 GCCCAATATTTAGCCAGGGGTGG + Intergenic
1013795672 6:113885902-113885924 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
1016036917 6:139392646-139392668 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1016047215 6:139493141-139493163 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1016912911 6:149216512-149216534 GAAAAACACTCAGCCAGGTGTGG + Intergenic
1017465628 6:154691213-154691235 TCTGAATTGTCAGCCAGGTGCGG + Intergenic
1017468436 6:154716692-154716714 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1017516284 6:155158709-155158731 ACACAAAACTCAGCCAGGTGTGG - Intronic
1017663887 6:156700130-156700152 GCAGAATATTCAACCATGCTTGG - Intergenic
1017896020 6:158680594-158680616 ACACAAAAATCAGCCAGGTGTGG + Intronic
1018186275 6:161267564-161267586 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1018571856 6:165220243-165220265 GCAGCATGTTCACCCAGCTGCGG + Intergenic
1019797043 7:3057977-3057999 GCAAAAAATTTAGCCAGGCGTGG + Intergenic
1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG + Intronic
1020112723 7:5456545-5456567 GCAGCAAACTCAGCAAGGTGGGG + Intronic
1020118919 7:5491974-5491996 GCAGGAACTTCAGCCAGATGGGG + Intronic
1020662972 7:11004090-11004112 ACAGAAAAATCAGCCAGGTGTGG + Intronic
1020807166 7:12804471-12804493 GTACAAAAATCAGCCAGGTGTGG - Intergenic
1021610284 7:22451039-22451061 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1021668040 7:23006420-23006442 ACAAAATAATTAGCCAGGTGTGG - Intronic
1021692676 7:23246224-23246246 AAAGAATATTGAGCCAGGCGCGG + Intronic
1022010735 7:26306048-26306070 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1022066863 7:26867384-26867406 AAAGAATAATTAGCCAGGTGTGG + Intronic
1022167351 7:27781872-27781894 ACATAAAAATCAGCCAGGTGTGG - Intronic
1022384688 7:29890194-29890216 ACAAAATAATTAGCCAGGTGTGG + Intronic
1023366670 7:39471504-39471526 CTAGAATATTCACCAAGGTGAGG + Intronic
1024185540 7:46944835-46944857 GTCAAAGATTCAGCCAGGTGCGG - Intergenic
1024206422 7:47165823-47165845 TAAGAAAATCCAGCCAGGTGCGG + Intergenic
1024455315 7:49599370-49599392 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1024560674 7:50642182-50642204 GCAGAGCATGCAGCCAGGAGAGG + Intronic
1025155496 7:56602466-56602488 GCATGATTATCAGCCAGGTGCGG - Intergenic
1025622792 7:63189549-63189571 ACTGAATAACCAGCCAGGTGTGG + Intergenic
1026077380 7:67184861-67184883 ACAGAAAAATTAGCCAGGTGCGG - Intronic
1026836029 7:73639907-73639929 GAAAAATAATTAGCCAGGTGTGG + Intergenic
1026886436 7:73950775-73950797 GCAAAAAAATTAGCCAGGTGTGG + Intergenic
1027000348 7:74648654-74648676 GTAGCATTTGCAGCCAGGTGCGG - Intergenic
1027046683 7:74995650-74995672 ACAAAAAATTTAGCCAGGTGTGG + Intronic
1028112603 7:86960404-86960426 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1028155592 7:87425718-87425740 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1029894948 7:103973850-103973872 TAATAATACTCAGCCAGGTGTGG + Intronic
1029980898 7:104877987-104878009 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1029983975 7:104904493-104904515 ACACAAAAATCAGCCAGGTGTGG + Intronic
1030763157 7:113376478-113376500 ATAGAATATTCTGCCAGGCGCGG + Intergenic
1031006807 7:116482754-116482776 GCAGAATGTCCAGCTAGGTGAGG - Intronic
1031103604 7:117512468-117512490 GTACAAAAATCAGCCAGGTGTGG + Intronic
1031414301 7:121477487-121477509 GCAGAGTATTAAACCAAGTGTGG + Intergenic
1031529616 7:122860380-122860402 GTAAAAAATTTAGCCAGGTGTGG - Intronic
1031588324 7:123559505-123559527 ACAAAAACTTCAGCCAGGTGTGG + Intergenic
1031984731 7:128156553-128156575 TCAGGACAATCAGCCAGGTGTGG + Intergenic
1032842361 7:135724339-135724361 ACAAAAAATTCATCCAGGTGTGG + Intronic
1033189791 7:139267378-139267400 ACAGAAAAATTAGCCAGGTGTGG + Intronic
1033669749 7:143479729-143479751 TCAAAAAAATCAGCCAGGTGTGG + Intergenic
1034173577 7:149082734-149082756 GCAAAAAAATTAGCCAGGTGTGG - Intronic
1034218754 7:149428261-149428283 CCAGAAAACTCAGCGAGGTGGGG + Intergenic
1034524941 7:151652779-151652801 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1034952173 7:155306153-155306175 ACAGAAAAATTAGCCAGGTGCGG - Intronic
1035386480 7:158476158-158476180 GTACAAAAATCAGCCAGGTGTGG - Intronic
1036076281 8:5504631-5504653 AGAAACTATTCAGCCAGGTGCGG - Intergenic
1036427781 8:8662163-8662185 GCAGAAAATCAAGCCAGCTGTGG + Intergenic
1036515077 8:9436550-9436572 GCAGAATATAAAGAAAGGTGAGG + Intergenic
1037149261 8:15616285-15616307 TCAGAATATCAGGCCAGGTGTGG + Intronic
1037173358 8:15919759-15919781 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1037265768 8:17058001-17058023 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1037493847 8:19420334-19420356 GCTGAATACACAGCCAGGTATGG - Exonic
1037632344 8:20669639-20669661 GCAGAATTTACTGCCAGGAGAGG - Intergenic
1037904465 8:22707367-22707389 GCAGAACATTCAGCTAGAGGAGG + Intergenic
1039146875 8:34457082-34457104 GAAGAATATTCTGGCAGATGAGG - Intergenic
1039568352 8:38566638-38566660 GCAGAACATTAAACCAAGTGTGG + Intergenic
1040028358 8:42802404-42802426 AGAAAAAATTCAGCCAGGTGTGG + Intergenic
1040488125 8:47893988-47894010 ACAGAACATTCAGCCGGGGGTGG + Intronic
1040698523 8:50033277-50033299 GTACAAAATTTAGCCAGGTGTGG - Intronic
1041046458 8:53891463-53891485 GCAAAAAAATTAGCCAGGTGTGG + Intronic
1041325165 8:56655567-56655589 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1041551093 8:59102381-59102403 ACACAAAAATCAGCCAGGTGTGG - Intronic
1041710184 8:60887325-60887347 GGAGGATATGCAGCCAGGTGAGG + Intergenic
1041905234 8:63025575-63025597 ATACAAAATTCAGCCAGGTGTGG + Intronic
1042363018 8:67903703-67903725 GTTGAAAAGTCAGCCAGGTGCGG - Intergenic
1042727122 8:71890267-71890289 GCACAAAAATTAGCCAGGTGTGG - Intronic
1042967874 8:74375035-74375057 GAAAAATATTGGGCCAGGTGTGG + Intronic
1044323555 8:90833870-90833892 TCAGAATTCTCAGCCAGGCGTGG + Intronic
1044894609 8:96878119-96878141 ACAGAAAAATTAGCCAGGTGTGG - Intronic
1044974724 8:97652841-97652863 AGAGAATAATCAGCCAGGTGCGG + Intronic
1044990941 8:97795253-97795275 TAATAATATTTAGCCAGGTGTGG - Intronic
1045311900 8:101010262-101010284 ACAAAATAATTAGCCAGGTGTGG - Intergenic
1046088819 8:109473358-109473380 CCAGAAAAATTAGCCAGGTGTGG + Intronic
1046531485 8:115451709-115451731 GCAGAAAAATCAGCCTGGTGGGG + Intronic
1046633906 8:116650800-116650822 ACAAAAAATCCAGCCAGGTGTGG - Intronic
1046946786 8:119981499-119981521 TCAAAATAATTAGCCAGGTGTGG + Intronic
1047515973 8:125555091-125555113 GCAGAACATTAAACCAAGTGTGG + Intergenic
1049082491 8:140454346-140454368 GCAGCATAATCAGCCGGGTGTGG + Intronic
1049105963 8:140613042-140613064 ACAAAATAATTAGCCAGGTGTGG + Intronic
1049437198 8:142592209-142592231 CCAGAGAATCCAGCCAGGTGTGG + Intergenic
1049837744 8:144749327-144749349 ACACAAAAATCAGCCAGGTGTGG + Intronic
1050304468 9:4294216-4294238 ACAGAATAATGGGCCAGGTGCGG + Intronic
1050353183 9:4759749-4759771 ACACAATAATTAGCCAGGTGTGG - Intergenic
1050525455 9:6542593-6542615 GCAGAAAATTCAGCCGGGCATGG + Intronic
1051477281 9:17522057-17522079 GCAGAAAATGCATACAGGTGGGG - Intergenic
1051485958 9:17608301-17608323 GTACAAAATTTAGCCAGGTGTGG - Intronic
1051770773 9:20576848-20576870 ACACAATATCCAGCCAGATGTGG + Intronic
1052679498 9:31671089-31671111 TCAGAATATTTAGTCTGGTGTGG - Intergenic
1054579909 9:66901652-66901674 TCAGAATTTTTGGCCAGGTGCGG + Intronic
1055097550 9:72429046-72429068 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1055379751 9:75693327-75693349 GCAGTATTCTAAGCCAGGTGCGG + Intergenic
1056368803 9:85933782-85933804 AGAAAATAATCAGCCAGGTGTGG + Intergenic
1056698461 9:88880554-88880576 GCAGCCTCTTCATCCAGGTGTGG + Intergenic
1056919904 9:90778196-90778218 TCAGGATTTTCAGCCGGGTGCGG + Intergenic
1057188647 9:93073400-93073422 GAAAAATAATTAGCCAGGTGTGG - Intronic
1057610569 9:96539477-96539499 TCTGAATTTTCAGCCAGGGGTGG - Intronic
1057750058 9:97785342-97785364 ATAGAAAAATCAGCCAGGTGTGG + Intergenic
1058023961 9:100119711-100119733 ACAAAAAAATCAGCCAGGTGTGG - Intronic
1058036926 9:100262900-100262922 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1058372234 9:104283143-104283165 GCACAAAAATTAGCCAGGTGTGG - Intergenic
1058683170 9:107457588-107457610 ACAAAAAATTTAGCCAGGTGTGG + Intergenic
1059072805 9:111156859-111156881 ACAGAAAAATTAGCCAGGTGTGG - Intergenic
1059251108 9:112889044-112889066 GCATAAAAATTAGCCAGGTGTGG - Intronic
1059291213 9:113225857-113225879 GCAAAGTGTTCGGCCAGGTGTGG + Intronic
1059781591 9:117534229-117534251 GAAGAATATTGAGTCAGGTCTGG - Intergenic
1059914555 9:119084711-119084733 ACACAAAAATCAGCCAGGTGTGG - Intergenic
1060613542 9:124990331-124990353 ACACAAAAATCAGCCAGGTGTGG + Intronic
1060621346 9:125069776-125069798 GTACAAAAATCAGCCAGGTGTGG - Intronic
1062153853 9:135035122-135035144 GCAGGATTGCCAGCCAGGTGCGG + Intergenic
1062663433 9:137652879-137652901 ACAGAAAAGTTAGCCAGGTGTGG - Intronic
1185565115 X:1089079-1089101 ACAAAAAAATCAGCCAGGTGTGG + Intergenic
1185666404 X:1768703-1768725 ATAGAAAATTTAGCCAGGTGTGG - Intergenic
1186897507 X:14018906-14018928 AAAGTATATCCAGCCAGGTGTGG - Intronic
1187367319 X:18675747-18675769 GCAGAGTATTCAACCTGGTGCGG + Intergenic
1187900470 X:24023150-24023172 GCAGATTATTAAACCAAGTGTGG + Intronic
1188928136 X:36070780-36070802 GCTGATTTTGCAGCCAGGTGAGG - Intronic
1189775120 X:44463770-44463792 ATACAATATTTAGCCAGGTGTGG + Intergenic
1189778219 X:44488991-44489013 GCAGGATATAGGGCCAGGTGCGG + Intergenic
1189822321 X:44881976-44881998 GCAAAATACTCAGCCAGGCATGG - Intronic
1190028091 X:46944997-46945019 AAAAAAAATTCAGCCAGGTGTGG - Intronic
1190497106 X:51037389-51037411 GTACAAAAATCAGCCAGGTGTGG - Intergenic
1190757069 X:53410435-53410457 ACAAAAAATTTAGCCAGGTGTGG + Intronic
1190805079 X:53827371-53827393 GAAGAATGATTAGCCAGGTGCGG - Intergenic
1190821560 X:53978099-53978121 ACAAAAAATTTAGCCAGGTGTGG - Intronic
1191857648 X:65640184-65640206 GCAGCAGATTCAGGGAGGTGGGG - Intronic
1192128412 X:68524457-68524479 TGAAAATAATCAGCCAGGTGCGG - Intronic
1192859609 X:75052621-75052643 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1193041669 X:77010346-77010368 AAAGAACATTTAGCCAGGTGTGG + Intergenic
1193354014 X:80495822-80495844 GAAAAATATCCAGCCAGGCGCGG + Intergenic
1193513389 X:82433336-82433358 TGAGAATATTCAGCAAGGAGTGG - Intergenic
1193549895 X:82879080-82879102 GAAGAATAATCAGCCAGGGTTGG - Intergenic
1193889790 X:87031151-87031173 ACAGAATTTCCAGCCAGGTGCGG - Intergenic
1194683458 X:96882801-96882823 ACAAAAAAGTCAGCCAGGTGTGG + Intronic
1194949016 X:100102696-100102718 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1195035414 X:100967443-100967465 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1195896020 X:109747071-109747093 GAAGAAACTTCGGCCAGGTGCGG + Intergenic
1196311659 X:114174865-114174887 GCACAAAAATTAGCCAGGTGTGG - Intergenic
1196321480 X:114345465-114345487 TCAGAATAGTCTCCCAGGTGTGG - Intergenic
1196782447 X:119395665-119395687 GCAAAAAAATTAGCCAGGTGCGG + Intergenic
1196835460 X:119809564-119809586 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1196837370 X:119825866-119825888 ACTGAAGAGTCAGCCAGGTGTGG + Intergenic
1196888328 X:120268257-120268279 GCAGAATATGGTGGCAGGTGAGG + Exonic
1196917457 X:120552301-120552323 ATACAAAATTCAGCCAGGTGTGG - Intronic
1197104682 X:122700234-122700256 TCAGAATATTAAGCCATTTGTGG - Intergenic
1197485764 X:127049456-127049478 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1197973829 X:132143846-132143868 GTAGAATTGTCAGCCAGATGTGG - Intergenic
1198114800 X:133534811-133534833 ACAAAAAATTTAGCCAGGTGTGG - Intergenic
1198317437 X:135483215-135483237 GCAGAATAATTGACCAGGTGCGG + Intergenic
1198733575 X:139761126-139761148 ACACAAAAATCAGCCAGGTGTGG + Intronic
1198736410 X:139790231-139790253 ACAGAATAATTAGCCTGGTGTGG - Intronic
1199808227 X:151323440-151323462 GCAGGATGTGCAGCCAGGTATGG - Intergenic
1199823937 X:151478797-151478819 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1200087717 X:153617195-153617217 CAAGAAAATTTAGCCAGGTGTGG - Intergenic
1200754342 Y:6976222-6976244 GAAGGATATTCAGCTGGGTGTGG - Intronic
1200848911 Y:7862240-7862262 AAAGAAGAGTCAGCCAGGTGTGG + Intergenic
1201395756 Y:13546000-13546022 ACAGAAAAATTAGCCAGGTGTGG + Intergenic
1202193938 Y:22276204-22276226 GCTGAATATTCAGCCGGGCGTGG + Intergenic
1202340114 Y:23855388-23855410 GCAAAAAAATTAGCCAGGTGTGG - Intergenic
1202530652 Y:25814694-25814716 GCAAAAAAATTAGCCAGGTGTGG + Intergenic