ID: 1129834654

View in Genome Browser
Species Human (GRCh38)
Location 15:78694545-78694567
Sequence CAGCTCAGTGTTCCTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129834654_1129834660 30 Left 1129834654 15:78694545-78694567 CCAAGACCAGGAACACTGAGCTG 0: 1
1: 0
2: 0
3: 27
4: 207
Right 1129834660 15:78694598-78694620 AGATTCTGATTCAGTGCACCTGG 0: 1
1: 8
2: 30
3: 199
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129834654 Original CRISPR CAGCTCAGTGTTCCTGGTCT TGG (reversed) Intronic
900933152 1:5749073-5749095 CAGCTCCGTGTTCCTGCTGGCGG - Intergenic
901277456 1:8003341-8003363 CAGCACAGTGTACCTTGTCTTGG + Intergenic
901757526 1:11450426-11450448 CAGGTCAGTGTTCCAGGGGTGGG + Intergenic
903649486 1:24914177-24914199 CAGCTCAGTGTTCAGCCTCTTGG + Intronic
904789846 1:33011274-33011296 CAGCTATGTGTGCCTGGTCTGGG - Intronic
905217255 1:36417568-36417590 CAGCTGAGTGTTCCCTGTCACGG + Intronic
906154031 1:43603641-43603663 CAGCGCAGTGTTCATGGCCGTGG - Exonic
906295262 1:44645594-44645616 CAGCTCAGTGCTGCTGCCCTGGG + Intronic
908645224 1:66271051-66271073 CAGCTCAGTGTTGATGCTCTGGG - Intronic
909055789 1:70819374-70819396 CAGCATAGTGATCCTGGTCAGGG + Intergenic
912384168 1:109263102-109263124 CAGCTCAGTGGACCTGAGCTGGG - Intronic
914914109 1:151807696-151807718 CCGCTCATTCTTCCTGGGCTAGG + Intronic
915168008 1:153959282-153959304 CAGCTCAGTGTTTATCATCTGGG + Exonic
917271085 1:173275250-173275272 AAGCTCAGGGTTCCTCATCTGGG - Intergenic
917451686 1:175152464-175152486 CAGCCCAGTGCGCCGGGTCTGGG - Intergenic
917872122 1:179251230-179251252 CAGGACAGTATTCCTGTTCTTGG - Intergenic
918155900 1:181846338-181846360 CAGCTAAGTGTTCCAGGATTAGG - Intergenic
918893282 1:190304680-190304702 AAGCTCCATGTTACTGGTCTAGG + Intronic
919245713 1:194980854-194980876 AATCTGAGTGTTCCTGATCTGGG + Intergenic
920921669 1:210302628-210302650 CAGCTCAGTTTCCCAGGACTTGG + Intergenic
922097287 1:222453284-222453306 CAGCTCAGAGATCCTGTTCCAGG + Intergenic
923959694 1:239064101-239064123 CAGCTAAGTCCTTCTGGTCTAGG + Intergenic
1062933756 10:1369785-1369807 AAGCTCAGTGTGCCTGCTCTAGG - Intronic
1066269814 10:33811171-33811193 CAGCTCAGTGCCCCTGACCTTGG + Intergenic
1066349494 10:34624473-34624495 CGGCTCACTGTTTCTGCTCTGGG - Intronic
1067044070 10:42974730-42974752 CAGCTCAGGGGTCCAGGCCTGGG - Intergenic
1067510979 10:46894968-46894990 CAACTCTGGGTTCCTGGTATGGG - Intergenic
1067651272 10:48156894-48156916 CAACTCTGGGTTCCTGGTATGGG + Exonic
1068034498 10:51742850-51742872 CAGCCAACTTTTCCTGGTCTAGG - Intronic
1069587455 10:69617833-69617855 CAGCCCACAGTTCCAGGTCTTGG - Intergenic
1070466648 10:76730842-76730864 GATCTCAATGTTGCTGGTCTGGG - Intergenic
1071109259 10:82136070-82136092 CAAGTCAGTGTTACTGGGCTTGG - Intronic
1071772488 10:88744501-88744523 CAGCTCAGCACTCCTGGGCTGGG - Intronic
1074104457 10:110377876-110377898 CAGCACTGGGTTTCTGGTCTTGG + Intergenic
1074117130 10:110464677-110464699 CAGTTCTGTGTCCCTGGTCCTGG - Intergenic
1074367546 10:112871388-112871410 GACATCAGTCTTCCTGGTCTGGG + Intergenic
1077047287 11:552176-552198 CAGCTCTGACTTCCTGGCCTTGG + Exonic
1077354196 11:2107441-2107463 CAGGTCAGTGTGAGTGGTCTGGG - Intergenic
1080937616 11:36880882-36880904 CAGCTCAGTGACCATGGGCTGGG - Intergenic
1081753756 11:45530350-45530372 CAGCTGAGCTGTCCTGGTCTGGG - Intergenic
1083054700 11:59808802-59808824 CAGGTCAGTGTGCCAGGTTTTGG + Intronic
1084308549 11:68302399-68302421 CTGCTCTGTGTTCCTGTCCTGGG + Intergenic
1089836714 11:121376741-121376763 CAGTTCAGTTTTCAAGGTCTAGG - Intergenic
1091913684 12:4251988-4252010 CCTCTTACTGTTCCTGGTCTGGG + Intergenic
1094188017 12:27665457-27665479 CAGCCCAATGTTCCTTCTCTAGG - Intronic
1098314474 12:69178502-69178524 CAACTCAGTGTTGCTGGGCGTGG - Intergenic
1098398114 12:70043754-70043776 CATCTCAGCATTCCCGGTCTGGG - Intergenic
1100841007 12:98611778-98611800 GACATCAGTGTTCCTGGTTTTGG + Intergenic
1100909049 12:99337725-99337747 AGTCTCAGTGTTCCTGGGCTTGG - Intronic
1103111912 12:118287626-118287648 AGCCTCAGTTTTCCTGGTCTTGG + Intronic
1103611112 12:122124548-122124570 CAGGTCTCTGTTCCTGGTGTTGG + Intronic
1103910942 12:124351886-124351908 GAGCTCACTGGTCCAGGTCTTGG - Intronic
1104628079 12:130376181-130376203 CTGCTCAGACTTCTTGGTCTCGG + Intergenic
1104755598 12:131267321-131267343 CAGCTCACACTTCCAGGTCTGGG + Intergenic
1105242392 13:18620031-18620053 CACCTCAGAGTCCTTGGTCTAGG - Intergenic
1105706067 13:22968025-22968047 CAGGTCATTCTTCCTGGGCTGGG - Intergenic
1106545546 13:30727829-30727851 CAGCTCAGTCTTGCGGGTTTTGG + Intronic
1106572859 13:30943923-30943945 CAGACCAGTATTCCTGGTTTTGG + Intronic
1111788531 13:92822538-92822560 AAGCTCCCTGTTCCTTGTCTTGG - Intronic
1114749962 14:25192827-25192849 GAGCTCAGGGTTTCTGATCTTGG + Intergenic
1122834947 14:104426198-104426220 CAACTCAGTTTCCCTGGGCTGGG + Intergenic
1123798764 15:23799705-23799727 CAGCTCTGTGATATTGGTCTTGG + Intergenic
1125162951 15:36668156-36668178 GGGCTCAGTGTTCCTTGTCTTGG + Intronic
1125653904 15:41340217-41340239 CACCTCAGGGCTCCTGTTCTTGG + Intronic
1125759002 15:42084504-42084526 CAGGTCTGTGCTGCTGGTCTGGG + Intronic
1127623178 15:60753985-60754007 CGGACCAGTGTTCCGGGTCTGGG - Intronic
1128638969 15:69321827-69321849 CTGGACAGTGTTCCTGGGCTGGG + Intronic
1128780711 15:70357100-70357122 CAGCTTTGTGGTCCTGGCCTGGG + Intergenic
1129834654 15:78694545-78694567 CAGCTCAGTGTTCCTGGTCTTGG - Intronic
1130441014 15:83954690-83954712 AAGCACAGTGTTACTGGGCTTGG - Intronic
1132639980 16:973514-973536 GAGCTCTGTGGTCCAGGTCTGGG + Intronic
1132710114 16:1262732-1262754 CTGCTCAGGGGTCCTGGTCTGGG + Intergenic
1134192923 16:12136358-12136380 CAGCACAGTGATTCTGGTCTTGG + Intronic
1134402990 16:13927963-13927985 CAGCTATGTATTTCTGGTCTTGG - Intronic
1136500083 16:30665633-30665655 CAGCTCAGGGTTCGTGCTCTGGG - Exonic
1138947455 16:61869197-61869219 CACCAAACTGTTCCTGGTCTTGG + Intronic
1139657143 16:68395967-68395989 CAACTCAGTGTGCCTGGCCTGGG + Intronic
1140646989 16:77042683-77042705 GGGCTCACTGTTCCTGGTCTGGG - Intergenic
1143624819 17:8103730-8103752 CCGCCCAGTGTTCCAGGACTCGG + Intronic
1144771165 17:17760442-17760464 CAGCCCAGTGTCCCTGGCCTGGG + Intronic
1146554303 17:33810481-33810503 CAGACCAGTGTTCCTGCACTTGG - Intronic
1147562774 17:41519279-41519301 CAGCTCCGTGTTCTTAGTTTGGG + Exonic
1148852567 17:50561925-50561947 CACCTCAGTCTTCCTGGGTTGGG + Intronic
1149424811 17:56544830-56544852 CAGCTCAGGGTTGCTGATCTAGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1152239211 17:79152829-79152851 CGGCGCCGTGTTCCTGGTGTGGG - Intronic
1152795802 17:82305560-82305582 CAGCTCAGTGTCCCTCAGCTGGG - Intergenic
1154446557 18:14439847-14439869 CACCTCAGAGTCCTTGGTCTAGG + Intergenic
1156403001 18:36757766-36757788 TTGCTCAGTGATCCTGGCCTGGG - Intronic
1157737409 18:50062388-50062410 CAGACCAGTGTTCCTGTTCTTGG - Intronic
1158626170 18:59073354-59073376 CAGCTCATTCTCCCTGCTCTGGG - Intergenic
1160278562 18:77463935-77463957 GACCTCATTGTTCCTGGTGTAGG - Intergenic
1160813634 19:1025464-1025486 CAGCTCTGTCTTCCTGGGCATGG + Intergenic
1162493828 19:11011771-11011793 CAGCTCAGAAGTCCTGGGCTCGG - Intronic
1163454565 19:17399008-17399030 CTGCTGAGTGTCCCTGCTCTGGG - Intergenic
1164564471 19:29315921-29315943 CAGCCCAGTGGTCTTTGTCTCGG + Intergenic
1165073240 19:33267665-33267687 CAGCTCTGGGTTCCTGGAGTGGG - Intergenic
1165974807 19:39666275-39666297 CAGCACAGTGATCCTGGGCCCGG + Intergenic
925283061 2:2698315-2698337 GAGCTCAGGGTTCCTGGTCCGGG - Intergenic
926760554 2:16275194-16275216 CATCTCAGGGGTCCTGCTCTGGG + Intergenic
927276425 2:21266218-21266240 CAGGACACAGTTCCTGGTCTGGG - Intergenic
927302751 2:21535351-21535373 CAGCATTGTGTCCCTGGTCTAGG + Intergenic
927454969 2:23241460-23241482 CAGCACTGTGTTTCTGTTCTTGG - Intergenic
927646997 2:24884175-24884197 CAGTTCAGTGTTTCTGGGCCAGG + Intronic
929639558 2:43563718-43563740 CAACTTATTCTTCCTGGTCTAGG + Intronic
929942883 2:46348171-46348193 CAGCTCAGTGGGCCTGGGGTTGG + Intronic
930538547 2:52674819-52674841 CAACTCAGTCTTCCTATTCTAGG - Intergenic
930866408 2:56126384-56126406 CAGCTCTGCCTTTCTGGTCTCGG - Intergenic
931221414 2:60291569-60291591 AAGGCGAGTGTTCCTGGTCTTGG + Intergenic
931696314 2:64873344-64873366 CTGCTCAGACTTCTTGGTCTCGG - Intergenic
932337068 2:70937579-70937601 CAGCTCAGGGCTCCAGGCCTGGG - Intronic
932607452 2:73174916-73174938 ATGCTCAGTTTTCCTGGCCTGGG + Intergenic
932960059 2:76403119-76403141 GAGCAAAGTGTTCCTGGTCATGG - Intergenic
934156384 2:89204794-89204816 CAGGCCAGTGGTCATGGTCTTGG - Intergenic
934210934 2:89977969-89977991 CAGGCCAGTGGTCATGGTCTTGG + Intergenic
934994127 2:98941499-98941521 AAGATCAGTGTTACTGGTCTGGG - Intergenic
935233601 2:101119658-101119680 TAGAACAGTGGTCCTGGTCTTGG - Intronic
937687966 2:124719897-124719919 GGGCTCAGTGGTCCTAGTCTTGG + Intronic
937708631 2:124951325-124951347 GAGCTCAGTGTACCTGCACTAGG + Intergenic
938189535 2:129263422-129263444 CAGATGATTGTTCCTAGTCTGGG - Intergenic
940922933 2:159329916-159329938 CAGATTAGTGTTTTTGGTCTTGG - Intronic
945306623 2:208265393-208265415 CAGCCCAGTTTTCCTGGAGTTGG - Intronic
946654597 2:221932821-221932843 CAGTCCAGTGTTGCTGGTCTTGG + Intergenic
947792111 2:232874437-232874459 CAGCTCAATGTTCCTGGACGGGG - Intronic
948773766 2:240269411-240269433 CAGCTCCTTGCTCCTGGTCAGGG + Intergenic
949006276 2:241650426-241650448 CAGCTCAGTGTTTCTTGCCCCGG + Intronic
1171305867 20:24105282-24105304 CAGCGCAGGATTCCTGGTGTTGG - Intergenic
1173205715 20:40991571-40991593 CTGCTCAGTGTTCATGAGCTGGG - Intergenic
1173671636 20:44803207-44803229 CTGCTCAGTGTTAATGTTCTAGG - Intronic
1174400225 20:50271995-50272017 CACCTCTGCCTTCCTGGTCTGGG + Intergenic
1175552462 20:59826325-59826347 TCGCTGAGTGTCCCTGGTCTGGG + Intronic
1179433908 21:41346554-41346576 CTGCTCAGTGGTCGTGGTGTGGG + Intronic
1179618310 21:42595863-42595885 CTGCTCAGTGAGCCTGGTCCAGG + Intergenic
1180179442 21:46111491-46111513 CTGCTCCGTGCTCCTGCTCTGGG + Exonic
1180699349 22:17773291-17773313 CAGCTCAGGGAATCTGGTCTCGG + Intronic
1181581217 22:23829143-23829165 CAGCCCTGTGTTCCTGGCCAGGG + Intronic
1181634234 22:24167000-24167022 CAGCTCAGTGGGCCGGCTCTCGG - Exonic
1184342034 22:43891403-43891425 CAGCTCAGAATTTCTGGGCTCGG + Intronic
950221613 3:11200597-11200619 CAGCACATAGTTCCTGCTCTTGG - Intronic
950479803 3:13237260-13237282 CAGCTCAGTGACCCCGTTCTGGG - Intergenic
951908194 3:27723509-27723531 CTGCTCAGTTTTCCTGATCCCGG + Intergenic
952966372 3:38623513-38623535 AAGCACAGTGTCCCTGCTCTAGG - Intronic
954083325 3:48225039-48225061 CATCTCAGTGTTGCTGGGCTGGG + Intronic
954095944 3:48328055-48328077 AAGTTCAATGTTCCTGGACTTGG + Intronic
956691036 3:71877742-71877764 CCTCCCAGTTTTCCTGGTCTAGG - Intergenic
961431533 3:126887574-126887596 TAGCCCAGTGTCCCTGGGCTGGG + Intronic
961617042 3:128190900-128190922 CAGCTCACTGTGCCTCGCCTGGG + Intronic
961617093 3:128191426-128191448 CAGCTCACTGTGCCTGGCCTGGG + Intronic
964553413 3:157910209-157910231 GGGCTCAGTGTTCCTTCTCTAGG - Intergenic
966257786 3:177938173-177938195 CACCTCAGTGTGCCTGATCCAGG - Intergenic
966852844 3:184175216-184175238 CTGCGCAGCGTTCCTGCTCTGGG - Intronic
968683762 4:1941472-1941494 GAGCTCAGTCTCCCTGGCCTAGG + Intronic
969955295 4:10883545-10883567 CAGCACAGAGTCCCTGGACTGGG + Intergenic
970150658 4:13086364-13086386 TAGCTCATGCTTCCTGGTCTAGG + Intergenic
971131323 4:23814102-23814124 CGGCTCGGATTTCCTGGTCTTGG + Exonic
972409824 4:38782336-38782358 TAGCTCAGTGTAGGTGGTCTGGG + Intronic
975577542 4:75877531-75877553 CGGTTCACTGTTCCTGGCCTGGG + Intronic
975664366 4:76720438-76720460 CAGCTCAGTGTTTTTTGACTTGG + Intronic
977220250 4:94329734-94329756 CAGCCCAGTGTTCCAGTTGTGGG - Intronic
980481068 4:133387964-133387986 CATCTCAGAGTGCCTGCTCTGGG - Intergenic
980989192 4:139724288-139724310 CAGCTCACAGTTCATGATCTAGG + Intronic
982094954 4:151912985-151913007 GAGGTCAGTGTTTCTGGTATGGG + Intergenic
985229615 4:187800141-187800163 CAGCTCAGTCTTACTGAGCTTGG + Intergenic
986143587 5:5055064-5055086 CAGCTCGGTGTTCCTCTGCTGGG + Intergenic
986707079 5:10461179-10461201 CAGCGCAGTGTTCAAGGACTGGG - Exonic
987122014 5:14776634-14776656 CAGCACCTTCTTCCTGGTCTTGG - Intronic
988299607 5:29404854-29404876 AACCTCAGTGTTACTGGGCTTGG + Intergenic
990145433 5:52754654-52754676 CTGCTCACTCTTCCTGGTCTAGG - Intergenic
991583836 5:68182832-68182854 CAGCCCTGTGTTCCTGACCTAGG - Intergenic
992750360 5:79855730-79855752 CAGCTCTGACTTGCTGGTCTTGG + Intergenic
995927069 5:117386833-117386855 TACCTCATTGTTCCTGGTCATGG + Intergenic
997131779 5:131284439-131284461 CTGTTCAGTGTACCTGGTTTTGG + Intronic
997624523 5:135322649-135322671 CAGTTCAGTGTTGGTTGTCTGGG - Intronic
1000159733 5:158586018-158586040 AACCACAGTGTTACTGGTCTGGG - Intergenic
1001311775 5:170616309-170616331 CACCTCAGTGTGCCTGGCCCAGG - Intronic
1002439621 5:179257524-179257546 CAGCTCTGTCTGCCTGGGCTGGG + Intronic
1002442115 5:179269924-179269946 CTGCTCAGTGCTGCTGGCCTGGG - Intronic
1002824647 6:761767-761789 CTGCTCAGTGTGCCTACTCTTGG + Intergenic
1003024274 6:2539797-2539819 CAGTTCAGTGTTCTGAGTCTTGG - Intergenic
1005600567 6:27422767-27422789 CAGCTCAGTGTATCGGGTTTGGG - Intergenic
1007047846 6:38795903-38795925 CAGGGCAGTGTTCCTTGTCTTGG + Intronic
1011256123 6:85422967-85422989 CAGGTCAGTGCTGGTGGTCTTGG + Intergenic
1013615051 6:111834998-111835020 CAGTTAGGAGTTCCTGGTCTTGG + Intronic
1013723877 6:113067812-113067834 CTCATCAGTGTCCCTGGTCTAGG - Intergenic
1016695655 6:146991945-146991967 CTTCTCACTGTTGCTGGTCTTGG - Intergenic
1016934836 6:149441847-149441869 CAGGACAGTGTTCGTGGCCTTGG + Intergenic
1017379780 6:153814481-153814503 AAGCTCAGTGTTACTGGGCTTGG + Intergenic
1018048000 6:159981584-159981606 TAGCTCTGTGTTCCTGGTGGTGG + Intronic
1018204491 6:161424539-161424561 CAACTCAGTGGTCATGTTCTAGG - Intronic
1020383045 7:7566945-7566967 CAGCCCAGTGGTCCAGGTCACGG + Exonic
1022320457 7:29283311-29283333 CCGCTCAGTGCTTCTGGCCTTGG - Intronic
1022839319 7:34147914-34147936 CAGGTCAGTGTTAGTGTTCTAGG + Intronic
1023017450 7:35982275-35982297 CACCTCAGTGTCCCTGGGCCTGG + Intergenic
1024209698 7:47192701-47192723 CAGCACTGTGTACCAGGTCTGGG - Intergenic
1024326307 7:48111913-48111935 CATCTCATTGTTTCTGGTCAAGG - Intergenic
1028195376 7:87901251-87901273 CAGTTATGTGTTCCTTGTCTAGG - Intronic
1028345688 7:89779339-89779361 CAGATCAGTGGTGATGGTCTTGG - Intergenic
1030224735 7:107137560-107137582 CACCTCACTGTTCCTTTTCTAGG - Intronic
1030340487 7:108374010-108374032 CAGTTCTGTGTCTCTGGTCTGGG - Intronic
1032886226 7:136142043-136142065 CAGCTCTGTGCTCCTGGACCAGG + Intergenic
1035400478 7:158561926-158561948 CCTCTCAGTGTTCCTCTTCTTGG - Intronic
1036086572 8:5618948-5618970 CAGGTCACAGGTCCTGGTCTTGG + Intergenic
1037908728 8:22730665-22730687 CTGCTCAGGGTTGCTGGGCTAGG + Intronic
1037990993 8:23321142-23321164 CAGAGCAGTGTTCCTGCTCTAGG + Intronic
1040515409 8:48130523-48130545 CCGCGCAGTGATCCTGGTTTAGG + Intergenic
1041520710 8:58752867-58752889 CAGCACACTGTGCCTGGGCTAGG - Intergenic
1042082417 8:65070280-65070302 AACCACAGTGTTCCTGGCCTTGG - Intergenic
1043440845 8:80275981-80276003 CAGCACAGTTTTTCTGGGCTAGG - Intergenic
1046158996 8:110334373-110334395 CTGAGCAGTGTGCCTGGTCTGGG + Intergenic
1046284298 8:112074503-112074525 GAGCTCAGTGTACCTGTTCTTGG - Intergenic
1047305085 8:123646053-123646075 AAGCTCAGTGTTGCTCATCTGGG + Intronic
1047510442 8:125511706-125511728 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510447 8:125511731-125511753 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1047510452 8:125511756-125511778 CAGCCCAGTGTGCCAGCTCTTGG - Intergenic
1048581483 8:135732725-135732747 CAGCCCAGTGTCCCAGGGCTGGG + Intergenic
1048966370 8:139617900-139617922 CAGCTCTGTCTCCGTGGTCTTGG + Intronic
1049929634 9:444037-444059 CAGCACAGTGATCCCGGACTTGG - Intronic
1050888192 9:10791118-10791140 CACCTCATTCTTCCTGGACTTGG + Intergenic
1055355747 9:75435474-75435496 CAGCTCAGTGTTTCTCTTCAAGG + Intergenic
1056102406 9:83312450-83312472 ATGCTTAGTTTTCCTGGTCTAGG - Intronic
1061215361 9:129218561-129218583 CTCCTCAGTTTTCCTGGTGTGGG - Intergenic
1061375592 9:130222611-130222633 CTGCTGAGTGATCCTGGGCTGGG - Intronic
1062602502 9:137324178-137324200 CAGCTCCGTGCTCCTGGACTGGG + Intronic
1189959465 X:46310498-46310520 CACATCAGTGATCCTGGTCTTGG - Intergenic
1190948617 X:55120255-55120277 CAGCTCAGTGACTCTGGTGTGGG + Intronic
1191821582 X:65315530-65315552 CAGCTCAGCACTCCTGATCTGGG - Intergenic
1192174978 X:68879830-68879852 GAGCTGAGTGATCCTAGTCTTGG - Intergenic
1192503175 X:71666271-71666293 CACCTCAGTGTTCCTGAACCAGG - Intergenic
1192503635 X:71668296-71668318 CACCTCAGTGTTCCTGGGCCAGG + Intergenic
1193080600 X:77402681-77402703 CAAGTCAGAGGTCCTGGTCTGGG - Intergenic
1196564608 X:117189924-117189946 AACCACAGTGTTACTGGTCTTGG + Intergenic
1197034279 X:121854896-121854918 CAGCTCAGGACTCCTGGACTGGG - Intergenic
1197739146 X:129875989-129876011 CATCTCAGTGTGGCTGTTCTTGG - Intergenic
1198220109 X:134591003-134591025 CAGCTCTGTAGTGCTGGTCTTGG - Intronic
1199738537 X:150709345-150709367 ATCCTCAGTGTTCCTGGTATGGG - Intronic