ID: 1129839768

View in Genome Browser
Species Human (GRCh38)
Location 15:78736458-78736480
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 6, 1: 3, 2: 8, 3: 43, 4: 222}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129839757_1129839768 20 Left 1129839757 15:78736415-78736437 CCCTAGCTACCCTATTAATGGGC No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839760_1129839768 10 Left 1129839760 15:78736425-78736447 CCTATTAATGGGCCCAGAACCTG No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839759_1129839768 11 Left 1129839759 15:78736424-78736446 CCCTATTAATGGGCCCAGAACCT No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839753_1129839768 29 Left 1129839753 15:78736406-78736428 CCCACAGTGCCCTAGCTACCCTA No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839758_1129839768 19 Left 1129839758 15:78736416-78736438 CCTAGCTACCCTATTAATGGGCC No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839762_1129839768 -2 Left 1129839762 15:78736437-78736459 CCCAGAACCTGGAAGCCAGCCAC No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839763_1129839768 -3 Left 1129839763 15:78736438-78736460 CCAGAACCTGGAAGCCAGCCACC No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839764_1129839768 -9 Left 1129839764 15:78736444-78736466 CCTGGAAGCCAGCCACCATGTGC No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839754_1129839768 28 Left 1129839754 15:78736407-78736429 CCACAGTGCCCTAGCTACCCTAT No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222
1129839752_1129839768 30 Left 1129839752 15:78736405-78736427 CCCCACAGTGCCCTAGCTACCCT No data
Right 1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG 0: 6
1: 3
2: 8
3: 43
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129839768 Original CRISPR ACCATGTGCCCTCATGCCCA GGG Intergenic
900250291 1:1665321-1665343 GCTCTGTGGCCTCATGCCCAGGG + Exonic
900713871 1:4131795-4131817 GCCTTGTTCCCTGATGCCCAGGG + Intergenic
900779903 1:4611431-4611453 GCCATGTGCCCTCCTGTGCATGG + Intergenic
900885253 1:5410543-5410565 ACCATGTGCCCTCTTGCCTTGGG + Intergenic
904359047 1:29960520-29960542 ACCATCTGCCCACATGGCCAAGG - Intergenic
905016225 1:34780743-34780765 ACAATGTGTCCTTATCCCCAGGG + Intronic
905250430 1:36644723-36644745 ACCATGTGCCCTCAAGCCAGGGG - Intergenic
905587760 1:39134434-39134456 ACCATGTGCCTTCTTGCTCCAGG + Intronic
905666142 1:39764193-39764215 ACCCCGTGCCCTCCTTCCCAGGG - Intronic
908455093 1:64296251-64296273 CCCCTGTGCCCTCATGACCCAGG + Intergenic
911821932 1:102434636-102434658 ACCATGTGCTCTCTAGACCAAGG - Intergenic
912560787 1:110550096-110550118 ACCATGTGCTCTCTTGCCCCAGG - Intergenic
913111163 1:115658604-115658626 ACCACTTGCCGTCATTCCCAAGG - Intronic
914243156 1:145866268-145866290 GGCATGTGCCACCATGCCCAGGG - Intergenic
916991561 1:170250733-170250755 ACCAGGTCCCATCCTGCCCAAGG - Intergenic
917077644 1:171221917-171221939 ACCATGAGGCCTCAAGCCCCAGG + Intergenic
917193823 1:172445973-172445995 ACCATGTACCCTCCTGCCCATGG + Intronic
919768161 1:201140583-201140605 ACCAGGAGCTCTCCTGCCCAGGG - Intronic
920192730 1:204203777-204203799 ACAATGAGCCCCCATTCCCAAGG + Intronic
923818339 1:237405175-237405197 ACTATATGTCCTCATTCCCAAGG - Intronic
924710933 1:246529488-246529510 ACCATGTGCTCTCCAGACCAAGG - Intergenic
1063141527 10:3260223-3260245 ACCATGTCCCCTAGTGCCCTGGG - Intergenic
1064360145 10:14656979-14657001 ACATTGTGCTCACATGCCCATGG - Intronic
1065917735 10:30366747-30366769 ACCATGTGCCCTCATGCCCAGGG - Intronic
1066006150 10:31147790-31147812 ACCATGTGCCATCCTCCCCTTGG - Intergenic
1067703132 10:48588099-48588121 ATTCTGTGCCCTGATGCCCAAGG + Intronic
1069898221 10:71691998-71692020 ACAGTGAGCCCTCATTCCCAGGG + Intronic
1070585878 10:77765655-77765677 AACATGTGCCCTGATGCCAAGGG + Intergenic
1071305221 10:84293621-84293643 ATCTTGTGGCCTCTTGCCCAGGG + Intergenic
1071429996 10:85599755-85599777 ATCATTTCCCCTCATGCCAAGGG + Exonic
1072552441 10:96489078-96489100 GCCCTATGCACTCATGCCCATGG - Intronic
1073170202 10:101499892-101499914 ATCAAGTGCCCTCAAGACCAAGG - Intronic
1073179337 10:101574485-101574507 ACCCTGTGTCCTCGTGTCCATGG - Intronic
1073315705 10:102579270-102579292 ACCCTGTGCCCACATGGGCAGGG - Intronic
1077476727 11:2794011-2794033 AGGATGTGCCCTCGTGCCCTAGG - Intronic
1078107583 11:8368352-8368374 ACGATGTTGCCTCTTGCCCAAGG + Intergenic
1078443443 11:11386278-11386300 ACCATGTTCATTGATGCCCATGG + Intronic
1079004594 11:16782918-16782940 ACCATGGGCCCTCCTGCCCTGGG + Intronic
1080327452 11:31093960-31093982 ACCTGGTGCTCTCATGCACATGG - Intronic
1085304208 11:75476038-75476060 AGCATCTGCCCTGATGGCCAAGG + Intronic
1088952655 11:114586992-114587014 ACCATGTGCTCTCCAGACCAAGG - Intronic
1089497705 11:118916138-118916160 ACCCTGAGCCCTCATCCCCCAGG + Intronic
1089662492 11:119994492-119994514 ACCATGTGCCCAAGAGCCCACGG + Intergenic
1089876412 11:121726000-121726022 ACCATCTGCTCTGTTGCCCAAGG + Intergenic
1091021090 11:132100587-132100609 AGTTTGTGCCCACATGCCCAGGG - Intronic
1091128988 11:133128227-133128249 GCCCCGTCCCCTCATGCCCAAGG + Intronic
1092630331 12:10369761-10369783 ACCATGAGGCCTCAAGCCCCAGG + Intergenic
1093859102 12:24141724-24141746 TCAATGTGCCTTTATGCCCAAGG + Intergenic
1098158735 12:67626701-67626723 ACCATGTCCCCTGATTCTCAAGG + Intergenic
1100980574 12:100159215-100159237 ACCACCTGCCCTCATGCCCAGGG - Intergenic
1102777739 12:115535229-115535251 TCCATGTGTCCTCTTGCCTATGG - Intergenic
1102985660 12:117276425-117276447 GGCATGTGCCACCATGCCCAGGG + Intronic
1103300626 12:119923849-119923871 AGCAGGTGCCCACAGGCCCAGGG + Intergenic
1104704065 12:130929925-130929947 AGCATGTGCAACCATGCCCAGGG - Intergenic
1104788422 12:131466704-131466726 ACCACCTGCCCACAGGCCCACGG + Intergenic
1104874425 12:132023993-132024015 ACCATGAGCCCTGCTGCCCACGG + Intronic
1105205725 13:18221862-18221884 ACCATAAGGCATCATGCCCACGG + Intergenic
1107877843 13:44806299-44806321 GGCATGTGCCACCATGCCCAGGG + Intergenic
1108299958 13:49063694-49063716 ACCCTATGCACCCATGCCCAGGG - Intronic
1110701500 13:78554028-78554050 TCCATCTGCCCTCATGGCTATGG - Intergenic
1110980457 13:81890328-81890350 ATCATGTTTCCTCGTGCCCATGG + Intergenic
1115019089 14:28653114-28653136 ACCATGTTCCCTCTTGCCTCAGG - Intergenic
1118397469 14:65349636-65349658 TCCATCTGCACTCGTGCCCAAGG + Intergenic
1118740968 14:68738849-68738871 ACCCTGTGCCCTCTTGCCTGGGG + Intergenic
1121843020 14:97150435-97150457 ACCAGGTGACCTCATTCCCTTGG + Intergenic
1122158791 14:99768018-99768040 ACCCTGTGCCCACCAGCCCAAGG - Intronic
1122313039 14:100809315-100809337 ACTATGTGCTCTCTTGTCCAAGG - Intergenic
1122642108 14:103166002-103166024 ACCATTTGCCCTCATGTTTACGG - Intergenic
1123473315 15:20570417-20570439 ACCACGTGCCCTCACACCCAGGG + Intergenic
1123644693 15:22429936-22429958 ACCACGTGCCCTCACACCCAGGG - Intergenic
1123666010 15:22609844-22609866 ACCACGTGCCCTCACACCCAGGG - Intergenic
1123733615 15:23165428-23165450 ACCACGTGCCCTCACACCCAGGG + Intergenic
1123751743 15:23362803-23362825 ACCATGTGCCCTCACACCCAGGG + Intronic
1124284115 15:28386727-28386749 ACCACGTGCCCTCACACCCAGGG + Intronic
1124298582 15:28524887-28524909 ACCACGTGCCCTCACACCCAGGG - Intronic
1124319833 15:28704257-28704279 ACCACGTGCCCTCACACCCAGGG - Intronic
1124482678 15:30091173-30091195 ACCACGTGCCCTCACACCCAGGG + Intronic
1124489135 15:30143265-30143287 ACCACGTGCCCTCACACCCAGGG + Intronic
1124520899 15:30406045-30406067 ACCACGTGCCCTCACACCCAGGG - Intronic
1124537763 15:30560174-30560196 ACCACGTGCCCTCACACCCAGGG + Intronic
1124544218 15:30612235-30612257 ACCACATGCCCTCACACCCAGGG + Intronic
1124564181 15:30799671-30799693 ACCACATGCCCTCACACCCAGGG + Intergenic
1124754394 15:32395059-32395081 ACCACATGCCCTCACACCCAGGG - Intronic
1124760893 15:32447412-32447434 ACCACGTGCCCTCACACCCAGGG - Intronic
1124777741 15:32601651-32601673 ACCACGTGCCCTCACACCCAGGG + Intronic
1126316419 15:47374676-47374698 ACCATCTGTCCTCAGACCCAGGG + Intronic
1127772914 15:62244999-62245021 ACCACCTGCCCTCACGCCCAGGG - Intergenic
1129030039 15:72611345-72611367 ACCATGTGCCCTCACGCCCAGGG + Intergenic
1129038261 15:72664093-72664115 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129211627 15:74073138-74073160 GCCATGTGCCCTCATGCCCAGGG - Intronic
1129398776 15:75267946-75267968 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129402384 15:75292222-75292244 ACCATGTGCCCTCATGCCCAGGG + Intronic
1129475927 15:75784656-75784678 ACCACGTGCCCTCATGCCCAGGG + Intergenic
1129728750 15:77917413-77917435 ACCATGTGCCCTCATGCCCAGGG - Intergenic
1129839768 15:78736458-78736480 ACCATGTGCCCTCATGCCCAGGG + Intergenic
1129985668 15:79918262-79918284 ACCATGGGGCCTCAAGCCCCAGG - Intronic
1130259307 15:82343232-82343254 ACCACATGTCCTCATGCCCAGGG - Intronic
1130269370 15:82435933-82435955 ACCACATGTCCTCATGCCCAGGG + Intronic
1130281958 15:82525950-82525972 ACCACATGTCCTCATGCCCAGGG + Intergenic
1130473325 15:84242113-84242135 ACCACATGTCCTCATGCCCAGGG + Intronic
1130480739 15:84356177-84356199 ACCACATGTCCTCATGCCCAGGG + Intergenic
1130484935 15:84393604-84393626 ACCACATGCCCTCATGCCCAGGG + Intergenic
1130490973 15:84431582-84431604 ACCACATGTCCTCATGCCCAGGG - Intergenic
1130502557 15:84510381-84510403 ACCACATGTCCTCATGCCCAGGG - Intergenic
1131188248 15:90293467-90293489 ACCAGCTGCCCTCATGCCCAGGG + Intronic
1131282580 15:91033328-91033350 ACCAGCTGCCCTCATGCCCAGGG - Intergenic
1131896522 15:97037240-97037262 ACCATGTGCTCTCAGGCCTCTGG + Intergenic
1132474453 16:126715-126737 ACCATGGCCCCTAATACCCAGGG + Intronic
1134045985 16:11101400-11101422 ACCATGTTCCCTCCTGCCTCTGG + Intronic
1137039542 16:35597938-35597960 ACCATGAGGCCTCAAGCCCCAGG - Intergenic
1137247121 16:46714776-46714798 TCCGTGTGCCCTCATTCTCATGG - Intronic
1137454026 16:48604406-48604428 GGCATGTGCCACCATGCCCATGG - Intronic
1138098566 16:54232903-54232925 ACCAAATGCACTCATGCCCCAGG - Intergenic
1140743518 16:77962148-77962170 TCCATTTGCACTCTTGCCCAGGG - Intronic
1141118407 16:81331647-81331669 ACCCTGTCCCCTCATACACATGG + Intronic
1143090266 17:4445839-4445861 ACCACCTGCCCCCCTGCCCAGGG - Intronic
1144726300 17:17504279-17504301 ACCATGTGCCCTGGGGGCCAAGG + Intergenic
1146279832 17:31537912-31537934 CACATGTGGCCTCATGCCCAAGG + Exonic
1147353642 17:39872940-39872962 AACATGTGCCTGCATGCACATGG + Intronic
1150134823 17:62689873-62689895 CCCATGGCCCCCCATGCCCAGGG + Exonic
1151335409 17:73436737-73436759 ACCATGCGCTCTCTTTCCCATGG + Intronic
1153227208 18:2907985-2908007 CCCATGGCCCCTGATGCCCACGG + Intronic
1156405755 18:36781225-36781247 ACCATGTGACCCCAGGCCAAGGG - Intronic
1160733686 19:652330-652352 ACCCTGTGCCCCCATGCGCCAGG + Intronic
1160953103 19:1676864-1676886 CACATGTGACCCCATGCCCACGG + Intergenic
1161300014 19:3537990-3538012 ACCAGGTGCCGTCCTGCCCCAGG - Intronic
1163076349 19:14895477-14895499 AGCATGTCCCATCAAGCCCAAGG + Intergenic
1163796015 19:19338330-19338352 ACCATGTGCACGCACACCCAAGG + Intronic
1163976825 19:20860651-20860673 ACCATGGGTCCTCAAGCCCCAGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1166432846 19:42741436-42741458 TCCATGTGCCGACATACCCAGGG + Intronic
1166435951 19:42766663-42766685 TCCATGTGCCGACATACCCAGGG + Intronic
1166455701 19:42938150-42938172 TCCATGTGCCGACATACCCAGGG + Intronic
1168253347 19:55153946-55153968 ACCATCTGCCCTCAGGCCTAGGG + Intronic
1168417118 19:56176120-56176142 ACCCTGTGCCCTCCTGGCCTAGG - Intronic
925317692 2:2938357-2938379 AGCATCTGCCCTCCTGCCCCAGG + Intergenic
927037575 2:19195102-19195124 ACCATGTCCCCTTGTACCCATGG - Intergenic
931218824 2:60270803-60270825 AACAAGTGCCCCCATGCCCCAGG + Intergenic
931538165 2:63301048-63301070 ACCATGTGCTCTCTAGACCAAGG - Intronic
931814665 2:65889169-65889191 CCCTTGTGCCCTCATCCCGAGGG + Intergenic
932589390 2:73055035-73055057 ACCATCCCCCCTCATGTCCAGGG - Intronic
934616274 2:95773158-95773180 ACCAGGTGCCTTCATCCTCAGGG - Intergenic
934644621 2:96051402-96051424 ACCAGGTGCCTTCATCCTCAGGG + Intergenic
934654891 2:96112332-96112354 GCCATCTGCCCCCCTGCCCATGG + Intergenic
934838036 2:97607492-97607514 ACCAGGTGCCTTCATCCTCAGGG + Intergenic
935172074 2:100617972-100617994 TCCATGTTCTCTGATGCCCAAGG + Intergenic
936344027 2:111661615-111661637 CACATGTGCCCTCATGCCATTGG - Intergenic
940990205 2:160088572-160088594 ACCATGTGCTCTCCAGACCAAGG + Intergenic
942661755 2:178272815-178272837 ACCATTTGCACTTATGCCCATGG - Intronic
943866977 2:192937881-192937903 ACCCTGTGCCCCCATGACCCAGG - Intergenic
944034979 2:195283774-195283796 ACCATTTGCCCTTCTTCCCAGGG - Intergenic
944289918 2:197993585-197993607 TCCTTGTCCCCTCAGGCCCAGGG - Intronic
946496286 2:220199234-220199256 ACCATCTGACCTAATGACCAAGG - Intergenic
947955711 2:234189108-234189130 AGCATCTGCCCTCCTCCCCAGGG - Intergenic
948147581 2:235719666-235719688 TCCATGGGGCCCCATGCCCAAGG + Intronic
948185281 2:236016523-236016545 ACCATTTGCCCTCAAGGCTAAGG - Intronic
1169819989 20:9699863-9699885 ACCCGGTCCCCTCATGCCTATGG + Intronic
1170053967 20:12178402-12178424 ACCATGTGGCCTAATTCCCAAGG + Intergenic
1173452806 20:43180158-43180180 ACCAGGAGCACTGATGCCCAAGG - Intronic
1173918239 20:46725517-46725539 AACATGTGCCTCCATCCCCAGGG - Exonic
1175304718 20:57968034-57968056 AACATGTGCCCTCATGCTTTGGG + Intergenic
1176369041 21:6051681-6051703 TCCAGGTGCCCTCCTGCCAAGGG - Intergenic
1177464535 21:21458304-21458326 ACAATGTGCCCCCAGGCCCTGGG + Intronic
1179207889 21:39300727-39300749 ACCATTTCCCCTCTTGACCATGG - Intronic
1179754478 21:43486860-43486882 TCCAGGTGCCCTCCTGCCAAGGG + Intergenic
1180203236 21:46239928-46239950 ACCCTGGGCCTTCATCCCCATGG + Intronic
1180703198 22:17792928-17792950 ACAATGTGCCCACATGGCCGTGG + Intronic
1180760243 22:18196854-18196876 ACCATAAGGCATCATGCCCACGG - Intergenic
1180770555 22:18381152-18381174 ACCATAAGGCGTCATGCCCACGG - Intergenic
1180775425 22:18427842-18427864 ACCATAAGGCATCATGCCCACGG + Intergenic
1180808495 22:18738897-18738919 ACCATAAGGCGTCATGCCCACGG + Intergenic
1180828498 22:18884110-18884132 ACCATAAGGCGTCATGCCCACGG - Intergenic
1180913572 22:19470087-19470109 ACAATGTGGCCTCAGGCCCTTGG + Intronic
1181071424 22:20343861-20343883 ACCATAAGGCGTCATGCCCACGG + Intergenic
1181194497 22:21172811-21172833 ACCATAAGGCGTCATGCCCACGG + Intergenic
1181214945 22:21319967-21319989 ACCATAAGGCGTCATGCCCACGG - Intergenic
1181595847 22:23913926-23913948 ACCATCTGCCCGTGTGCCCAGGG - Intergenic
1182629441 22:31673664-31673686 ACCATTTATCCTCATGCTCATGG - Intergenic
1182659107 22:31912583-31912605 CCCATCTCCCCTCATCCCCATGG - Intergenic
1183920028 22:41158528-41158550 TCCATGTGTCCACATGTCCAGGG + Intronic
1203232390 22_KI270731v1_random:122324-122346 ACCATAAGGCGTCATGCCCACGG - Intergenic
1203278593 22_KI270734v1_random:110099-110121 ACCATAAGGCATCATGCCCACGG - Intergenic
949730209 3:7102487-7102509 ATGATGTGCCCTCATACCTATGG + Intronic
950681171 3:14586076-14586098 ACCAGGTGCACTCTTGCCCCAGG + Intergenic
951533294 3:23718618-23718640 GGCATGTGCCACCATGCCCATGG - Intergenic
952045437 3:29313417-29313439 ACACAGTGCCTTCATGCCCATGG - Intronic
953883759 3:46704474-46704496 ACCATGTCCCTAGATGCCCAGGG + Intronic
954464801 3:50648109-50648131 ACCCTGGGCCCTCCTGGCCAGGG - Exonic
954691139 3:52396289-52396311 ACCAGGCTCCCTCCTGCCCAGGG - Intronic
954847546 3:53572954-53572976 TCCATCTTCCCTCTTGCCCATGG + Intronic
956780223 3:72597648-72597670 ACCAAGTTCCTTCATGCCCCAGG - Intergenic
957453036 3:80403846-80403868 ACCAGGAGCCCCCATGTCCAAGG - Intergenic
958535622 3:95399143-95399165 AGCATGTGGCCTCCTGCCCTGGG + Intergenic
959999469 3:112715524-112715546 ACCAGGAGCTCTCATGCCTAAGG - Intergenic
960727363 3:120683851-120683873 ACCATGTGGACTGATGCCTACGG + Intergenic
960940475 3:122929822-122929844 GCCATGTTCTCACATGCCCATGG + Intronic
961616779 3:128188802-128188824 ACCATGCCCCCTCAGGCACAGGG - Intronic
963064077 3:141249050-141249072 AGAATGAGCCCTCCTGCCCATGG - Intronic
964732551 3:159882870-159882892 ACCAAGTGCCCTCCTGCTCCTGG + Intronic
971162756 4:24150677-24150699 TACATGTGTCCTAATGCCCACGG - Intergenic
972120420 4:35694846-35694868 ACCAAGTGCCCTGAGGCCCCAGG - Intergenic
972324182 4:37999573-37999595 ACCAGGTGCCCTCAGGACCTGGG + Intronic
973984574 4:56337857-56337879 ACCAGGAGCCCTGATGTCCAAGG + Intergenic
975831434 4:78373180-78373202 CCTATGTGCCCAAATGCCCAGGG - Intronic
975983122 4:80181640-80181662 ACCATGAGCCAACATACCCAAGG + Intergenic
977533797 4:98232488-98232510 TTCATGTGGCCACATGCCCAAGG + Intergenic
977995440 4:103494215-103494237 ATCATGTGCCCTCATCCACCTGG - Intergenic
978811030 4:112850014-112850036 ACCAGGAGCTCTGATGCCCAAGG - Intronic
980402745 4:132313802-132313824 ACCAGGAGCTCTGATGCCCAAGG + Intergenic
984399031 4:179238067-179238089 ACCAGGAGCTCTCATGTCCAAGG - Intergenic
986211279 5:5675203-5675225 ACCACTTGGTCTCATGCCCACGG - Intergenic
987265935 5:16255323-16255345 ACCATTTGTGCTCATACCCAAGG + Intergenic
989155920 5:38344731-38344753 CCCTTGTGTCCTCCTGCCCATGG + Intronic
989824890 5:45841076-45841098 ACCATGTGGACACATGCACACGG - Intergenic
990057503 5:51602233-51602255 ACCATATGCCCTCATTCACACGG + Intergenic
995581411 5:113606686-113606708 GCCATGTGCCCTCCAGCCCAAGG - Intergenic
996477433 5:123937399-123937421 ACCATGTGCTCTCCAGACCAAGG + Intergenic
996652499 5:125897192-125897214 AACATGTGCCCTGAGGCTCATGG - Intergenic
997234468 5:132264829-132264851 ACCCTGTGCTCTCACTCCCAGGG + Intronic
1000943872 5:167396641-167396663 TCCCTGTGCCCTCATGCCACTGG - Intronic
1002298062 5:178242127-178242149 ACCATCTCCCCTCCTGCACAGGG - Exonic
1003992100 6:11496436-11496458 ACAGTGTGCCCTCTTGCGCACGG + Intergenic
1005106266 6:22227570-22227592 ACCATGTTCCCTGATGTTCAGGG - Intergenic
1006443157 6:34064508-34064530 ACCATGCCCCATCATGCCCATGG - Intronic
1007727072 6:43923010-43923032 GCCATGTGCCTGCATGCACAGGG - Intergenic
1007749246 6:44062139-44062161 ATCATGTGCCCTCAGCCTCATGG + Intergenic
1007754389 6:44089502-44089524 AGCACGTGCCCTCATGGCCTCGG + Intergenic
1009541470 6:64965064-64965086 ACAATTTACCCTCATGCCCAAGG + Intronic
1011368706 6:86609292-86609314 ACCATGTTCTTTCTTGCCCAAGG + Intergenic
1014111092 6:117619131-117619153 ACCATGGGGCCTCAAGCCCCAGG + Intergenic
1014733614 6:125065545-125065567 AACAGGTGCTCTCATGCCCCAGG - Intronic
1016970776 6:149760292-149760314 ACAATGTACCCTCATGCACAAGG - Intronic
1017484137 6:154887408-154887430 ACCATGTGGCCACAGGTCCAGGG - Intronic
1017823574 6:158065443-158065465 AGAAGGTGCCCTCATCCCCAGGG - Intronic
1018955974 6:168410838-168410860 ACCAGGTCCCCTCCTGCCCACGG - Intergenic
1019152725 6:170019587-170019609 CCCCTGTGCCCCCACGCCCAGGG + Intergenic
1019444655 7:1065083-1065105 GCCATGTTTCCTCCTGCCCAGGG - Intronic
1019483457 7:1276832-1276854 ACCCTGTGCCTTCATCGCCATGG + Intergenic
1021737135 7:23650862-23650884 TCCATATTCCCTCATTCCCAGGG + Intergenic
1022735123 7:33069139-33069161 ACCATGACCCCTCAGACCCAAGG + Intergenic
1024058680 7:45682531-45682553 ACATTGTGCCCACATCCCCAGGG - Intronic
1024640840 7:51327282-51327304 ACCGTGTCCCCTGATGCCCTGGG - Intergenic
1025617124 7:63130481-63130503 ACCATGTGCCCTCAAGCCTGGGG + Intergenic
1027199509 7:76054351-76054373 CCCATCTGCCCTCTTGCACAAGG + Intronic
1028450734 7:90979478-90979500 AGCATGTCCTCTCATGCTCAAGG + Intronic
1034564728 7:151904183-151904205 GCCATGTGCACTCATAGCCAAGG + Intergenic
1035350328 7:158241011-158241033 GGCAGGTGCCCTCAGGCCCAGGG + Intronic
1036494826 8:9260742-9260764 CCCATTTGCCCTTAAGCCCAGGG - Intergenic
1038432443 8:27510991-27511013 CCCTTGTGTCCTCATGCCCTGGG - Intronic
1038548616 8:28445642-28445664 GACATGTGTCCTGATGCCCAAGG - Intronic
1038578690 8:28728147-28728169 ACCATATGCCGTCATTTCCAAGG + Intronic
1039410774 8:37353282-37353304 CCCATGTGCCCACATGCTTAGGG + Intergenic
1040388071 8:46927222-46927244 ACCAAATGCTCTCCTGCCCAGGG - Intergenic
1040526035 8:48226056-48226078 ACCATGTGCTCTCTAGACCAAGG - Intergenic
1048052155 8:130828365-130828387 GCCATGTGCCCTCCAGGCCAAGG - Intronic
1048071230 8:131023253-131023275 CCCTTCTGCCCTGATGCCCATGG + Intronic
1048942635 8:139415095-139415117 TCCCTGTCCCCTCAGGCCCAGGG - Intergenic
1049231006 8:141481605-141481627 AAGATGTCCCCTCATGCTCATGG - Intergenic
1049461407 8:142730453-142730475 ACCATGGGGCCTCAAGCCCCAGG - Intronic
1049687096 8:143943367-143943389 GGCAGGTGCCCTCATGCCCTCGG - Intronic
1051558076 9:18407322-18407344 ACCATGTTCCCTCATGCTTTTGG - Intergenic
1052223767 9:26059511-26059533 ATCATGAGCACTCAAGCCCAAGG - Intergenic
1053143643 9:35697593-35697615 CCCAAGTGCCTTCATGCCCTAGG - Exonic
1057067444 9:92068803-92068825 ACCATGAGGCTTCATGCCCTCGG + Intronic
1058083018 9:100718995-100719017 ACATGGTGTCCTCATGCCCATGG - Intergenic
1059353241 9:113680755-113680777 AACATGTTTCCTCTTGCCCAAGG + Intergenic
1060779224 9:126399446-126399468 ACCATCTGATCACATGCCCAAGG - Intronic
1061062873 9:128259403-128259425 ACCACCTGCCCTCACGCCCAGGG - Intronic
1061719309 9:132542059-132542081 ACCCTGTGAGCTCATGCCCAGGG + Intronic
1061908948 9:133712770-133712792 AACATGTGCCCCCATCTCCACGG + Intronic
1062532102 9:137006564-137006586 ACCCAGTGCCCTCAAGCCCATGG + Intergenic
1187499343 X:19826318-19826340 AGCAGATGCCCACATGCCCAAGG + Intronic
1189746934 X:44178473-44178495 AACATGTGCCCTCAGGCACACGG + Exonic
1191976761 X:66881230-66881252 AACATGTACCCTCCTGCCCCTGG + Intergenic
1192656748 X:73001796-73001818 AGCATGTGCTCTCATGACAAAGG + Intergenic
1192665372 X:73081205-73081227 AGCATGTGCTCTCATGACAAAGG - Intergenic
1198862643 X:141087609-141087631 AACATGTGCCCATGTGCCCAAGG - Intergenic
1198900051 X:141499777-141499799 AACATGTGCCCATGTGCCCAAGG + Intergenic
1201722073 Y:17110222-17110244 ACAATGTGACCACAAGCCCAGGG + Intergenic
1202018254 Y:20434851-20434873 AGCAAGTACCCTCAAGCCCATGG + Intergenic
1202367268 Y:24174004-24174026 ACCACATGCCCTCATGCCCAGGG + Intergenic
1202503513 Y:25496119-25496141 ACCACATGCCCTCATGCCCAGGG - Intergenic