ID: 1129840678

View in Genome Browser
Species Human (GRCh38)
Location 15:78741635-78741657
Sequence CTTTTTAAGTACATTTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129840678_1129840685 26 Left 1129840678 15:78741635-78741657 CCTAAATAAATGTACTTAAAAAG No data
Right 1129840685 15:78741684-78741706 CAGGTGAATTGCTTGAGCCCAGG 0: 67
1: 2601
2: 44286
3: 132051
4: 258831
1129840678_1129840681 -3 Left 1129840678 15:78741635-78741657 CCTAAATAAATGTACTTAAAAAG No data
Right 1129840681 15:78741655-78741677 AAGGAAACTTTTGCTATAGGAGG No data
1129840678_1129840683 7 Left 1129840678 15:78741635-78741657 CCTAAATAAATGTACTTAAAAAG No data
Right 1129840683 15:78741665-78741687 TTGCTATAGGAGGCCAAGGCAGG No data
1129840678_1129840682 3 Left 1129840678 15:78741635-78741657 CCTAAATAAATGTACTTAAAAAG No data
Right 1129840682 15:78741661-78741683 ACTTTTGCTATAGGAGGCCAAGG No data
1129840678_1129840680 -6 Left 1129840678 15:78741635-78741657 CCTAAATAAATGTACTTAAAAAG No data
Right 1129840680 15:78741652-78741674 AAAAAGGAAACTTTTGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129840678 Original CRISPR CTTTTTAAGTACATTTATTT AGG (reversed) Intergenic
No off target data available for this crispr