ID: 1129841064

View in Genome Browser
Species Human (GRCh38)
Location 15:78743767-78743789
Sequence CCTCACAGGCAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129841064_1129841079 13 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841079 15:78743803-78743825 AAAGAGGGGCATTCACCTGTGGG No data
1129841064_1129841076 -2 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841076 15:78743788-78743810 GGTGGGTGGGGCTGGAAAGAGGG No data
1129841064_1129841078 12 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841078 15:78743802-78743824 GAAAGAGGGGCATTCACCTGTGG No data
1129841064_1129841075 -3 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841075 15:78743787-78743809 AGGTGGGTGGGGCTGGAAAGAGG No data
1129841064_1129841077 -1 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841077 15:78743789-78743811 GTGGGTGGGGCTGGAAAGAGGGG No data
1129841064_1129841073 -10 Left 1129841064 15:78743767-78743789 CCTCCCTCTTTCTGCCTGTGAGG No data
Right 1129841073 15:78743780-78743802 GCCTGTGAGGTGGGTGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129841064 Original CRISPR CCTCACAGGCAGAAAGAGGG AGG (reversed) Intergenic
No off target data available for this crispr