ID: 1129844764

View in Genome Browser
Species Human (GRCh38)
Location 15:78763185-78763207
Sequence ACTGGCTGCTGAGTGACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 673
Summary {0: 3, 1: 0, 2: 4, 3: 60, 4: 606}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129844764_1129844768 -1 Left 1129844764 15:78763185-78763207 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1129844768 15:78763207-78763229 TCGGACAAAGACGCAAACGCTGG 0: 1
1: 0
2: 1
3: 3
4: 26
1129844764_1129844769 15 Left 1129844764 15:78763185-78763207 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1129844769 15:78763223-78763245 ACGCTGGCCCAGCTGACTCCAGG 0: 4
1: 0
2: 3
3: 16
4: 181
1129844764_1129844772 27 Left 1129844764 15:78763185-78763207 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1129844772 15:78763235-78763257 CTGACTCCAGGACCCAGCTCAGG 0: 2
1: 2
2: 4
3: 43
4: 362
1129844764_1129844773 28 Left 1129844764 15:78763185-78763207 CCCAGAGTCACTCAGCAGCCAGT 0: 3
1: 0
2: 4
3: 60
4: 606
Right 1129844773 15:78763236-78763258 TGACTCCAGGACCCAGCTCAGGG 0: 2
1: 2
2: 3
3: 37
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129844764 Original CRISPR ACTGGCTGCTGAGTGACTCT GGG (reversed) Intronic