ID: 1129846510

View in Genome Browser
Species Human (GRCh38)
Location 15:78770371-78770393
Sequence GTCAACAATGGGAAGACTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 3, 2: 1, 3: 20, 4: 161}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129846505_1129846510 -6 Left 1129846505 15:78770354-78770376 CCCTGAGGATACTGAGTGTCAAC 0: 3
1: 1
2: 6
3: 28
4: 166
Right 1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG 0: 1
1: 3
2: 1
3: 20
4: 161
1129846503_1129846510 7 Left 1129846503 15:78770341-78770363 CCCAATTCTGAGACCCTGAGGAT 0: 1
1: 2
2: 6
3: 19
4: 244
Right 1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG 0: 1
1: 3
2: 1
3: 20
4: 161
1129846504_1129846510 6 Left 1129846504 15:78770342-78770364 CCAATTCTGAGACCCTGAGGATA 0: 3
1: 1
2: 4
3: 17
4: 172
Right 1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG 0: 1
1: 3
2: 1
3: 20
4: 161
1129846506_1129846510 -7 Left 1129846506 15:78770355-78770377 CCTGAGGATACTGAGTGTCAACA 0: 1
1: 2
2: 4
3: 20
4: 163
Right 1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG 0: 1
1: 3
2: 1
3: 20
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129846510 Original CRISPR GTCAACAATGGGAAGACTGA GGG Intronic
901283326 1:8056835-8056857 GTGAACAATGAGAAGACACAGGG + Intergenic
901744026 1:11360780-11360802 GACAACACTGGGAAGAGAGAAGG + Intergenic
904402962 1:30268895-30268917 GTCCACAATGGAAAGAGTCAAGG + Intergenic
905928271 1:41767473-41767495 GGCAACACTGGGAAGAATGAGGG + Intronic
907623474 1:56006117-56006139 GCCAGCAATTGGAAGACTGAAGG + Intergenic
907937420 1:59055224-59055246 GTCAGCCATGTGAAGACTGGAGG + Intergenic
908194291 1:61733903-61733925 GAGAACAAGGGGAAAACTGAAGG - Intergenic
908698076 1:66867315-66867337 GTCAAAAGTTGGAAGATTGAAGG - Intronic
910064272 1:83134634-83134656 GTCCACATTGGGAAGATTCATGG + Intergenic
913135900 1:115888835-115888857 GTGTAGAATGGGAAGACTGCAGG - Intergenic
918087362 1:181257076-181257098 GCCTGAAATGGGAAGACTGAGGG + Intergenic
919427471 1:197450551-197450573 GTCTAGAAAGGGAAGACTTAAGG + Intronic
920174867 1:204094459-204094481 GTCAACAATGGGGTCACTGAAGG - Intronic
922208010 1:223465919-223465941 ATGAACAATGGCAAGGCTGATGG - Intergenic
922953522 1:229579407-229579429 GTGAACAATGAGAGGACAGAAGG - Intergenic
1064811634 10:19206527-19206549 GTGAACACAGGGAAGTCTGAGGG - Intronic
1064940756 10:20732893-20732915 GGAAACAATGAGGAGACTGAGGG - Intergenic
1066038551 10:31520711-31520733 ATCAACCAAAGGAAGACTGATGG - Exonic
1066252150 10:33644636-33644658 GTCTGCAAAGGGAAGACTGTGGG + Intergenic
1068780923 10:60918337-60918359 GTCATCAAGGCAAAGACTGAAGG - Intronic
1069364002 10:67677087-67677109 GTCAACACTGGGGAGACTGGAGG - Intronic
1070532722 10:77351221-77351243 GTCAACTCTGAGAAGACTAAAGG + Intronic
1071083308 10:81838776-81838798 TTCATCAATGGGAAAACTGAGGG - Intergenic
1072281045 10:93865737-93865759 GTCACAAATGGGAAGCCTGCAGG + Intergenic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1073744597 10:106451787-106451809 TTGTAGAATGGGAAGACTGAGGG + Intergenic
1075203845 10:120429604-120429626 GTCAACAATGTGAGCTCTGAGGG + Intergenic
1076227404 10:128790908-128790930 GTCAAGAAACGGAACACTGAAGG - Intergenic
1076238176 10:128882000-128882022 CTCGCCAATGGGAAGACGGAAGG + Intergenic
1077200607 11:1305665-1305687 ATCAACGATGTGAAGAGTGAGGG + Intronic
1084302935 11:68263070-68263092 GCCAACAGTGGGAAGAGAGATGG - Intronic
1084469049 11:69344538-69344560 GACAACCATGGGAGGACTCAGGG + Intronic
1085152852 11:74266062-74266084 GTCAGCAGTGGAAAGACTGAGGG + Intronic
1085685619 11:78619645-78619667 GACAAAAGTGGAAAGACTGATGG - Intergenic
1086396763 11:86423245-86423267 GTCATCAATGAGAAAACTCAGGG - Intergenic
1086760193 11:90620323-90620345 GTCATCATTTGGAAGAATGAAGG - Intergenic
1088047707 11:105473600-105473622 GTGACCAAGGGGAAGACTGTAGG + Intergenic
1090487225 11:127124516-127124538 GTGAAGAATGGGAAGAGAGAAGG - Intergenic
1091572934 12:1706205-1706227 CTTACCAATGAGAAGACTGAGGG - Intronic
1092169159 12:6362541-6362563 TTCACTGATGGGAAGACTGAGGG + Intronic
1092875078 12:12840818-12840840 GTCTACAGTCAGAAGACTGAAGG - Intergenic
1103879550 12:124155479-124155501 GTCAATAATGGGGAAACTGTTGG - Intronic
1105643880 13:22295691-22295713 GCCTAGAATGGGAAAACTGATGG - Intergenic
1105734386 13:23252898-23252920 GTCAAAACAGGAAAGACTGAGGG + Intronic
1106519072 13:30481324-30481346 GCCAAGAAGGGGAAGAGTGAAGG + Intronic
1106770368 13:32955607-32955629 GCCTACAATGGGAAGAATGAGGG + Intergenic
1107565042 13:41593684-41593706 TTGTACAATGTGAAGACTGAAGG - Intronic
1109592230 13:64500709-64500731 GTCAGGAGTGGAAAGACTGAAGG - Intergenic
1111691887 13:91574474-91574496 GTCAACAATAGGAACAATAAGGG + Intronic
1114617081 14:24074087-24074109 CTGAAGAATGGGAAGACTGCGGG + Exonic
1114650930 14:24284247-24284269 GGCAACAATGGCAAGACCCAAGG - Intergenic
1120496322 14:85241486-85241508 TTCAACATTGTGCAGACTGAGGG - Intergenic
1120610073 14:86628706-86628728 GTGAACAAAGCAAAGACTGAGGG - Intergenic
1120936988 14:89906749-89906771 ATTAGCAATGGGAAAACTGAGGG + Intronic
1124080732 15:26492524-26492546 GGAGACAATGGGAAGATTGATGG - Intergenic
1124712136 15:32022438-32022460 GCCAGCAATGGAAAAACTGAAGG + Intergenic
1125987007 15:44063605-44063627 GTCAACAAAGGGATCATTGATGG - Intronic
1126047917 15:44661282-44661304 AACAACACTGGCAAGACTGATGG + Intronic
1128061646 15:64739219-64739241 GTCACAAAAGGTAAGACTGAGGG + Intergenic
1129739399 15:77982716-77982738 GTCAACCATGGGAAGACTGAGGG - Intergenic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1130059294 15:80558102-80558124 GTCAGTAATGTGAAGAGTGAAGG - Intronic
1130255410 15:82323580-82323602 GTCAACGATGGGAAGACTGAGGG - Intergenic
1130599557 15:85266406-85266428 GTCAACGATGGGAAGACTGAGGG + Intergenic
1130688511 15:86059997-86060019 GTCAAAGATGAGAAGACAGAAGG + Intergenic
1135021143 16:18964145-18964167 GTCAATAATGGGGAAACTAAAGG - Intergenic
1135420987 16:22305372-22305394 TTCAAAGATGGGAAAACTGAAGG + Intronic
1136089796 16:27910619-27910641 GTCTGTGATGGGAAGACTGAGGG - Intronic
1140219592 16:73033880-73033902 GTCAACAGTGAGAAGACTCCAGG + Intronic
1140714360 16:77708529-77708551 ATCACCAGTGAGAAGACTGAGGG + Intergenic
1141494328 16:84396597-84396619 GTCACAAATGGCAAGGCTGAGGG + Intronic
1143998685 17:11032362-11032384 GAAAACGATGAGAAGACTGACGG - Intergenic
1146182578 17:30707584-30707606 ATGAAAGATGGGAAGACTGATGG - Intergenic
1147866272 17:43554707-43554729 TTCCACAAAGGGAAAACTGATGG + Intronic
1148683754 17:49489198-49489220 GTCAACAATGGGAAGATAGGAGG - Intergenic
1151354233 17:73549039-73549061 GCCAACAACGGGAAGGCTGATGG - Intronic
1151685830 17:75646160-75646182 GGCACCAATGGGAAGCCTCAGGG + Intronic
1152525969 17:80888576-80888598 GTCAACACTGGGAAGTGTGTGGG + Intronic
1154099306 18:11455098-11455120 GTCAACAGGCGGTAGACTGAAGG - Intergenic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1157198294 18:45638040-45638062 GTCAAGAATGAGAGGAATGAGGG - Intronic
1157505926 18:48226511-48226533 TTCAAAAATGAGAAAACTGAGGG + Intronic
1157984789 18:52424722-52424744 GTTCACAATGGGAGAACTGATGG + Intronic
1161933119 19:7354410-7354432 GTAAACAATTGGGAGACTGAAGG + Intronic
1162553196 19:11369852-11369874 GCCAACAATGGGAATAGTGGGGG + Intergenic
1162976244 19:14208221-14208243 ATGAAAGATGGGAAGACTGATGG + Intergenic
925460386 2:4057919-4057941 GACAAAAGTGGGAAGGCTGATGG - Intergenic
928417040 2:31103862-31103884 GTCAACAAAGTGAAGATGGAGGG - Intronic
929158586 2:38810252-38810274 GTCATCAAAGGGAAGGGTGAGGG - Intronic
934569167 2:95357744-95357766 GTCACCAAGGGGAACACTCATGG - Intronic
936765136 2:115838076-115838098 GTTAACAATGGGGAAACTGGAGG + Intronic
939249693 2:139667853-139667875 GTCACCAATGGGAAGAGGGATGG - Intergenic
940852836 2:158704541-158704563 GGCATCAACTGGAAGACTGAAGG - Intergenic
941209312 2:162616905-162616927 GGCATAAATGGGATGACTGAAGG - Intronic
941573938 2:167206646-167206668 GTCCACAATGGGAAGGGAGAAGG + Intronic
942782443 2:179661117-179661139 GTTAAAAATAGGAAAACTGAGGG + Intronic
945477683 2:210304783-210304805 CTCAACAATGGGCAGGATGATGG - Intronic
945638995 2:212398539-212398561 GTTAAGAATGGCAAGACTGCAGG + Intronic
946167775 2:217875892-217875914 GGAAACAAGGGAAAGACTGATGG + Intronic
947115241 2:226763121-226763143 GGCAAGAAAGGGAAGACTGTTGG + Intronic
948160889 2:235823278-235823300 GGCAACAATGGGAAGATGGTAGG - Intronic
948297853 2:236876144-236876166 GTCAGCCATGGGGAGAGTGATGG + Intergenic
1168831991 20:850972-850994 GTTAACTATGGGGAGACTGAGGG - Intronic
1172372745 20:34407709-34407731 GCCAGCCATGGGAAGACTGGAGG - Intronic
1172989509 20:39022789-39022811 GTGAACACTGGAAAGACGGAAGG + Intronic
1175883561 20:62274577-62274599 CTCGACAGTCGGAAGACTGAAGG - Intronic
1180186245 21:46140814-46140836 GTGAGCAATGTGAAGGCTGACGG - Intronic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
1181464608 22:23104126-23104148 GTCAACAAAGGCAGGACTGAGGG + Intronic
1182153647 22:28049033-28049055 GGCAAAGATGGGCAGACTGAAGG - Intronic
1184177310 22:42795732-42795754 GTCAAAGATGGGAGGACTGAGGG + Intergenic
949540472 3:5027920-5027942 GTCAACTATGTGAAGACTTCCGG - Intergenic
950507292 3:13403330-13403352 GACAACAGTGGGAAGACAGCAGG - Intronic
952964266 3:38611323-38611345 GGGAACAAAGTGAAGACTGATGG + Intronic
952982970 3:38753095-38753117 GTCAACAATGGAGAGACTGAAGG + Intronic
954516471 3:51182241-51182263 GTTAACGATGAGAAAACTGAGGG - Intronic
955215643 3:56983099-56983121 GTCAGAAATGGGAAGACTGCTGG + Intronic
957450361 3:80373532-80373554 GTTAACAATATGAAGAATGAAGG - Intergenic
960135565 3:114100768-114100790 GTGAATAATGGGATGAATGATGG - Intergenic
960308810 3:116095548-116095570 GACAACAATAGGAATACAGATGG - Intronic
961362510 3:126376821-126376843 CACAACACTGGGAAAACTGATGG - Intergenic
963867019 3:150372595-150372617 GTTAAAAATGGGAAGATTTAAGG - Intergenic
966201917 3:177366679-177366701 CTCACCAATGAGAATACTGAGGG + Intergenic
966990511 3:185225505-185225527 GACAAAAACAGGAAGACTGAGGG - Intronic
967101484 3:186219654-186219676 GTGAATGATGGGAAGACTGGAGG + Intronic
970131025 4:12871363-12871385 GCCCACAGTGGGAGGACTGAGGG - Intergenic
971267105 4:25105506-25105528 GTCAACCAGGGGGAGGCTGAAGG - Intergenic
972906309 4:43752248-43752270 TTCAACAATTGGAAAACTGAAGG - Intergenic
974217416 4:58868243-58868265 GCCAACAAAGTGAAGATTGAGGG - Intergenic
975734035 4:77364567-77364589 GACAAAAATGGAAAGGCTGATGG + Intronic
978252032 4:106642496-106642518 TTAATAAATGGGAAGACTGATGG - Intergenic
980700253 4:136417437-136417459 GTCATCCATGGTAAGACAGATGG - Intergenic
982279574 4:153669292-153669314 GTCATCTGTGGGAACACTGAAGG + Intergenic
983738530 4:171095316-171095338 GTCAGCATTGGGAAGATTTAAGG + Intergenic
988286779 5:29228899-29228921 GTCAACACTGGCAAGAGTGAAGG + Intergenic
988427801 5:31083905-31083927 GTCAACAATGGAAAGAAAGTAGG + Intergenic
995288070 5:110414808-110414830 GTGAACATTGGGAAGATTTAAGG - Intronic
1000970924 5:167713855-167713877 GTCAATATTGGGAATGCTGAAGG - Intronic
1002294669 5:178223763-178223785 GACAACAGAGGGAAGACTGTTGG - Intronic
1004470766 6:15927100-15927122 GTAAACAGTGGCAAGACTCAAGG + Intergenic
1005273100 6:24187195-24187217 CTCAACAATGGAAAGAGGGATGG + Intronic
1007232316 6:40356796-40356818 GTCAACCTGGGGAAGACTCATGG + Intergenic
1007483867 6:42167211-42167233 GGCCACAAGGGGAGGACTGAGGG + Intronic
1009308313 6:62119742-62119764 GTCAAAGGTGGCAAGACTGATGG - Intronic
1009498629 6:64382858-64382880 GTAAAAAATGGGAAGAGTGGTGG + Intronic
1012042128 6:94220501-94220523 CTCAAGAATGAGAAGAGTGATGG + Intergenic
1013302513 6:108817890-108817912 GTCAGCTATCAGAAGACTGAAGG + Intergenic
1013620207 6:111880389-111880411 CTCAGGAATGGGAAGATTGATGG + Intergenic
1014154776 6:118097567-118097589 GTCATGAATGGGAAATCTGAGGG + Intronic
1014416672 6:121192826-121192848 GACAAAGATGGAAAGACTGATGG - Intronic
1015705482 6:136083193-136083215 GAGAACAGTCGGAAGACTGAGGG + Intronic
1019009996 6:168837176-168837198 TCCCACAATGTGAAGACTGAAGG + Intergenic
1020971360 7:14944792-14944814 GTCAATAATGCTAAGACTGATGG + Intronic
1026868820 7:73838603-73838625 GTCACCCATGGGCAGCCTGATGG + Intronic
1027279836 7:76600108-76600130 GTCCACATTGGGAAGATTCATGG - Intergenic
1030425300 7:109369088-109369110 GTGAAAAAAGGGAAGACTCAAGG + Intergenic
1035154433 7:156900675-156900697 GGGAACAAGGGGAAGAATGATGG - Intergenic
1037612107 8:20484458-20484480 GTCAGCAGGGGGAAGGCTGAAGG - Intergenic
1038328551 8:26590319-26590341 CTCAACCATGTGGAGACTGAGGG - Intronic
1038779736 8:30559707-30559729 GTAAACCAAGAGAAGACTGATGG - Intronic
1041701540 8:60795029-60795051 GTCAACAAGGGAAAAACAGAAGG + Exonic
1041705601 8:60843462-60843484 GACAACTATGGGAAGAGGGAAGG - Intronic
1041971832 8:63752290-63752312 GACAAGAAGGGGAAGACTGGAGG + Intergenic
1042456944 8:69015980-69016002 GGCCACGATGGCAAGACTGATGG - Intergenic
1044072151 8:87775499-87775521 GGCAAAACTAGGAAGACTGAAGG - Intergenic
1044923112 8:97186479-97186501 GTCACCACTGGGAAGGCCGAGGG - Intergenic
1045765079 8:105657996-105658018 GTCAACAATGAAAAGAATAATGG - Intronic
1046627214 8:116587854-116587876 GACAACCATGTGAAGACAGAGGG - Intergenic
1047378302 8:124326904-124326926 TTAAACAATGGCTAGACTGAAGG + Intronic
1048206475 8:132419418-132419440 ATTAACAATGGTAAGACAGAGGG - Intronic
1048347649 8:133589160-133589182 GGCAACTAGGAGAAGACTGAGGG - Intergenic
1048629185 8:136222423-136222445 GTCAAGAACAGTAAGACTGAGGG - Intergenic
1050338670 9:4614240-4614262 GTGAACAATGGGAGTACTAAAGG - Intronic
1051420444 9:16883841-16883863 GTCAACAGGGGTGAGACTGATGG + Intergenic
1051737747 9:20219136-20219158 TCCACTAATGGGAAGACTGAGGG - Intergenic
1052039964 9:23727111-23727133 GTCAACACTGGGGATACTGTGGG + Intronic
1053137934 9:35663399-35663421 TTCAACAGTGGGAAGTCTGAGGG + Intronic
1055172504 9:73276173-73276195 GACAGCAATGTGAAGACTGAGGG + Intergenic
1058806188 9:108594351-108594373 TTTAACAATGAGAAAACTGAGGG - Intergenic
1059985175 9:119814217-119814239 GTCAAAAAGGGCAAGGCTGATGG + Intergenic
1061544621 9:131297300-131297322 ATCATCAATAGAAAGACTGATGG - Intronic
1186793598 X:13023148-13023170 GTCATCACTGAGGAGACTGAAGG + Intergenic
1187205426 X:17176842-17176864 GTCAATAATGGGGAGGCTGCCGG + Intergenic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1189556158 X:42147604-42147626 GTCAGGGAGGGGAAGACTGAAGG - Intergenic
1191630430 X:63315773-63315795 GACAACAGTGGAAAGGCTGATGG + Intergenic