ID: 1129847176

View in Genome Browser
Species Human (GRCh38)
Location 15:78773276-78773298
Sequence CAGAGTCAGGAGAAGAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 702
Summary {0: 1, 1: 2, 2: 7, 3: 59, 4: 633}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129847170_1129847176 -10 Left 1129847170 15:78773263-78773285 CCCCGGGGCCAGCCAGAGTCAGG 0: 1
1: 0
2: 6
3: 23
4: 248
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847159_1129847176 24 Left 1129847159 15:78773229-78773251 CCTGGTGCTGGCGGCCAGCCCTC 0: 4
1: 0
2: 1
3: 28
4: 287
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847167_1129847176 -4 Left 1129847167 15:78773257-78773279 CCCCAGCCCCGGGGCCAGCCAGA 0: 1
1: 0
2: 4
3: 61
4: 486
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847163_1129847176 6 Left 1129847163 15:78773247-78773269 CCCTCTGTGGCCCCAGCCCCGGG 0: 4
1: 0
2: 4
3: 60
4: 524
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847168_1129847176 -5 Left 1129847168 15:78773258-78773280 CCCAGCCCCGGGGCCAGCCAGAG 0: 1
1: 0
2: 3
3: 49
4: 387
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847169_1129847176 -6 Left 1129847169 15:78773259-78773281 CCAGCCCCGGGGCCAGCCAGAGT 0: 1
1: 0
2: 1
3: 24
4: 317
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847158_1129847176 25 Left 1129847158 15:78773228-78773250 CCCTGGTGCTGGCGGCCAGCCCT 0: 4
1: 0
2: 2
3: 19
4: 242
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847165_1129847176 5 Left 1129847165 15:78773248-78773270 CCTCTGTGGCCCCAGCCCCGGGG 0: 4
1: 0
2: 6
3: 65
4: 653
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633
1129847161_1129847176 10 Left 1129847161 15:78773243-78773265 CCAGCCCTCTGTGGCCCCAGCCC 0: 4
1: 1
2: 8
3: 104
4: 900
Right 1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG 0: 1
1: 2
2: 7
3: 59
4: 633

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129847176 Original CRISPR CAGAGTCAGGAGAAGAAAGC TGG Intronic
900319129 1:2073908-2073930 AGGAGGCAGGAGAAGAAAGCCGG + Intronic
900481064 1:2899558-2899580 CAGAGTCCTGAGAAGGGAGCGGG - Intergenic
901093347 1:6658547-6658569 AGGAGTCAGGAGTAGAAAGCGGG + Intronic
902058710 1:13623688-13623710 CAGAGTCAGGGGAAGAAAAGTGG - Intergenic
902572629 1:17356470-17356492 CACAGACAGGAGAACAAGGCAGG - Intronic
903757604 1:25673383-25673405 CAGAGCCAGGATATGAATGCAGG - Intronic
904139506 1:28341266-28341288 CACTGCAAGGAGAAGAAAGCTGG - Intergenic
904163153 1:28536064-28536086 CAGAGCCAGGACAGGAACGCAGG - Intronic
904616779 1:31754243-31754265 CAGAGCCAGGAGCAGCCAGCTGG - Intronic
904823279 1:33258430-33258452 CAGAGTCGGGGGTTGAAAGCTGG + Intronic
905599317 1:39235394-39235416 CTGAGTCAGGAGAATCAGGCAGG + Intronic
905787464 1:40769710-40769732 CAGAGCCAGGACTAGAGAGCAGG + Intronic
905855346 1:41307837-41307859 CAGAGTCAGGAGGAGGGACCAGG - Intergenic
905951047 1:41951033-41951055 CACAGTCAGGAGCAGAAACTAGG - Intronic
906642983 1:47452588-47452610 CAGAGGCGGGAGAAGAAGGGAGG + Intergenic
906788075 1:48633750-48633772 AAGAAACAGGAGAAGACAGCAGG - Intronic
907123456 1:52028275-52028297 CAGAGACATGAGAAGGAAGTAGG - Intronic
907422944 1:54359358-54359380 CAGAGGCTGCAGAAGAAACCAGG + Intronic
907467259 1:54646827-54646849 CAGAGACAGTAGATTAAAGCAGG - Intronic
907489143 1:54797938-54797960 CAGAGTCAGGCCAGGAAAGGAGG - Intronic
907896950 1:58701041-58701063 CAGAGCCAGGAGTAGAATCCAGG + Intergenic
908308129 1:62846342-62846364 AAGAGGCTGGGGAAGAAAGCAGG - Intronic
909839725 1:80304720-80304742 CTGGGTCAGGAGTAGAAATCTGG - Intergenic
910838694 1:91540902-91540924 AACAGTCAGGAGAAGGAAGGTGG + Intergenic
910874647 1:91867229-91867251 CAGTGGCAGGAAAAGAAAGGAGG + Intronic
911168519 1:94746207-94746229 CAGAGTCTAGGGAAGTAAGCAGG - Intergenic
911749767 1:101482644-101482666 CAGCTTCTGGAGCAGAAAGCAGG - Intergenic
911803337 1:102173727-102173749 CATAGGGAGGAGAAGAAAGATGG + Intergenic
912091232 1:106079293-106079315 CAGAGTCAGGATGTGAATGCGGG - Intergenic
912319850 1:108702977-108702999 CAGAGTTAGGAGATAAAAACAGG - Intergenic
912417615 1:109520805-109520827 CAGACTCAGGAGATTGAAGCGGG - Intergenic
912703376 1:111894951-111894973 TAGAGGCAGGAGAAGAAAGAGGG + Intronic
913076456 1:115344423-115344445 AGGAGCCAGGAGAAGAATGCTGG + Intergenic
913085615 1:115433885-115433907 CACAGTCTGGAGATGAAACCAGG - Intergenic
914758549 1:150580267-150580289 CAGAGATGGGAGAAGCAAGCAGG - Intergenic
914893990 1:151652090-151652112 CTGAGTCAGGAGAATCAGGCAGG + Intronic
915137590 1:153744282-153744304 CAGACTCAGGACAGGGAAGCAGG - Intronic
915489890 1:156245089-156245111 GAGGGTCAGGACAGGAAAGCAGG + Intronic
916037191 1:160932758-160932780 CTGAGGCAGGAGAAAAAGGCAGG - Intergenic
916990557 1:170239470-170239492 CAAACTCACGAGAACAAAGCAGG + Intergenic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
918119033 1:181521511-181521533 CAGAGTCAGGAGAAGACAGGAGG + Intronic
918840875 1:189537608-189537630 TTGAGACAGAAGAAGAAAGCTGG - Intergenic
919034868 1:192293499-192293521 CAGAGTAAGAAAAAAAAAGCAGG - Intergenic
919204340 1:194401676-194401698 CAGAGTGAGGAGAGGAAAGGAGG + Intergenic
919588104 1:199464283-199464305 TATAGTCAGGAAGAGAAAGCTGG + Intergenic
919798413 1:201335955-201335977 CAGAGAGAGGTGTAGAAAGCAGG - Intergenic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
921503918 1:215942827-215942849 CAGAGACAGGAAGAGAAATCAGG + Intronic
922406704 1:225321820-225321842 CAGAGTCAGGGGAGGAAGGGTGG - Intronic
922551692 1:226498778-226498800 GAGAGGCAGGAGGGGAAAGCTGG + Intergenic
923201551 1:231717471-231717493 CAGAGTCAGCAGAGGGAGGCGGG - Intronic
923280231 1:232436576-232436598 CTGGGACAGGAGAGGAAAGCAGG + Intronic
923322190 1:232845585-232845607 CAGAGTCAAGGGAAGAAAGATGG - Intergenic
923793178 1:237128273-237128295 CTGAGTCAGGAGAATCAGGCAGG + Intronic
924009098 1:239644647-239644669 GAGAGAGATGAGAAGAAAGCCGG + Intronic
924749636 1:246873994-246874016 CAGTGTCAGAAGCAGCAAGCGGG - Intronic
1063020266 10:2119898-2119920 CACAGTAAGGAGAAGACAACAGG - Intergenic
1063506296 10:6603302-6603324 CAGAGCCTTGAGAAGAATGCAGG - Intergenic
1063588410 10:7373552-7373574 CAGGGTCAGGAGTCCAAAGCTGG + Intronic
1064827467 10:19421160-19421182 CAGAGACAGGAAAAGACATCAGG - Intronic
1066017143 10:31259467-31259489 GAAAGTTAGGAGAGGAAAGCTGG + Intergenic
1066229584 10:33419402-33419424 GAGAGTTAGGAGGAGGAAGCTGG + Intergenic
1067215793 10:44301619-44301641 GAGAGAAAGGAGCAGAAAGCTGG + Intergenic
1067762521 10:49058822-49058844 CAGGGTCAGGAGAAGATGCCTGG - Intronic
1067927450 10:50524454-50524476 CACAGTCAAGAGAAGAAAGGAGG - Intronic
1068052070 10:51962620-51962642 AAGAGTCAGGAAAAAAAAGCAGG - Intronic
1068116771 10:52744677-52744699 CAGGGTGAGGAGCAGAGAGCAGG - Intergenic
1068117785 10:52752962-52752984 CAGAGTGAGGAGCAGTGAGCAGG - Intergenic
1068264591 10:54630215-54630237 CTAAGTGAAGAGAAGAAAGCTGG + Intronic
1068337703 10:55659047-55659069 GAGGGTCAGGGGAAGAAAGAAGG - Intergenic
1068339121 10:55678262-55678284 CATGGTCAGGAGGACAAAGCTGG + Intergenic
1068472280 10:57480426-57480448 CAGAGTCAGAAGTGGTAAGCTGG + Intergenic
1069239381 10:66120838-66120860 CAAAGAGAGGAAAAGAAAGCAGG + Intronic
1069914229 10:71777550-71777572 AAGGGCAAGGAGAAGAAAGCAGG - Intronic
1070268744 10:74931234-74931256 CAGGGACAGGAGAGGAAAGGAGG - Intronic
1070312865 10:75286469-75286491 CCAAGGCTGGAGAAGAAAGCAGG - Intergenic
1071136736 10:82462321-82462343 CAGAGACAGAAGAAGAAAATGGG - Intronic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071736945 10:88311574-88311596 AAGAGGCAGGTGAAGAAAGAAGG - Intronic
1072366383 10:94714619-94714641 CTGAGTCAAAAGAACAAAGCTGG - Intronic
1073131976 10:101195511-101195533 AAGAGGCAGGAGAGTAAAGCGGG - Intergenic
1073245643 10:102088250-102088272 TAGAGTCAGGAGAGGAAAATGGG - Intergenic
1073358715 10:102879046-102879068 CAAAGTCAAGAAAAGATAGCTGG - Intronic
1073366682 10:102948545-102948567 CGAAGTCAGCAGAAGCAAGCAGG + Intronic
1073368716 10:102967432-102967454 CAGAGGCTGGAGATGAAAGCAGG - Intronic
1074074958 10:110114681-110114703 CAAAGTAAGGAGAAGAGAGAAGG + Intronic
1074190014 10:111127514-111127536 CAGCCTCTGGAGAAGGAAGCAGG - Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075286419 10:121190854-121190876 ATGAGTCAGGAAAAGAAAGAGGG - Intergenic
1075397170 10:122135812-122135834 CAGAGCCACGACAAGAAGGCAGG - Intronic
1075855236 10:125624359-125624381 CAGAGACCAGAGAAGAAAGTGGG + Intronic
1076180353 10:128402257-128402279 CAGAGACAGAAGAAGAGAGCTGG + Intergenic
1076467082 10:130690350-130690372 CAGAGTGAGGAGAGCAAAGCCGG - Intergenic
1076980956 11:204484-204506 CAGAGTCAGGCAAAGCAGGCAGG - Exonic
1076986312 11:238411-238433 CAGAGCCAGGAAAAGAACTCAGG + Intronic
1077614180 11:3663275-3663297 CAGAGCCAGGACAAGAAGCCAGG + Intronic
1077799511 11:5523980-5524002 CAGAGTCAGGATTAGAACTCAGG - Intronic
1077836926 11:5934113-5934135 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1077847300 11:6039524-6039546 CAGAACCAGGAGAAGGAAGGAGG - Intergenic
1077866835 11:6229406-6229428 TAGGATCAGGAGAAGGAAGCAGG - Intronic
1078049543 11:7950423-7950445 CAGAGAGATGAGCAGAAAGCAGG + Intergenic
1078499341 11:11854321-11854343 CAGAGTCAGGACACTACAGCTGG + Intronic
1078609422 11:12807423-12807445 CAGAGCCAGGAGCAAAAAGCAGG - Intronic
1078753694 11:14188699-14188721 CAGAGTCACTACTAGAAAGCGGG - Intronic
1079228031 11:18625205-18625227 CAGAGTCAGAGAAAGAAAGTAGG + Intronic
1079379291 11:19923015-19923037 CAGAGTAAATAAAAGAAAGCAGG + Intronic
1080305241 11:30828118-30828140 GTGAGTGAGGAGAAGACAGCAGG - Intergenic
1080533283 11:33197578-33197600 CAGAGCCAGGAGATGGAATCAGG + Intergenic
1081810357 11:45910778-45910800 CACAGTCAGGAGAGGAAGTCGGG - Intronic
1082247775 11:49944482-49944504 CAAAGTTAGTAGAAGAAAACAGG + Intergenic
1082743801 11:56940502-56940524 CTGAGCCAAAAGAAGAAAGCTGG - Intergenic
1082785040 11:57312089-57312111 CAGAGCCAGGAGATGAACCCAGG + Intronic
1083114831 11:60450792-60450814 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1083118749 11:60491024-60491046 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083154446 11:60814577-60814599 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1083173975 11:60938089-60938111 CAGGGTCAGGGGCAGCAAGCAGG - Intronic
1083205172 11:61144452-61144474 CAGAAGCAGGAGGAGAACGCAGG + Intronic
1083920199 11:65778309-65778331 CAGAGGCAGGAGCAGAGGGCGGG + Exonic
1084415230 11:69028345-69028367 CTGAGTTTGGAGAGGAAAGCAGG - Intergenic
1084682180 11:70672875-70672897 CAGAGCCAGGACTAGAAAGTGGG - Intronic
1084697074 11:70762101-70762123 CAGATTGAGGAAAAGAGAGCAGG - Intronic
1084790665 11:71473539-71473561 CAGAGGCAGGTGAAGAGAACAGG - Intronic
1086668097 11:89510027-89510049 CAGATTCCAAAGAAGAAAGCAGG - Intergenic
1086807978 11:91268757-91268779 GAGAGTCAGGAGCAGGAATCGGG + Intergenic
1087546046 11:99584461-99584483 CAATGTCAAGAGAATAAAGCAGG - Intronic
1088759205 11:112913228-112913250 CAGAGGCAGGAGAAAAAGGCTGG + Intergenic
1088826208 11:113496407-113496429 AAGAGTGAGGAGCAGAAGGCAGG + Intergenic
1088958052 11:114630222-114630244 CTGAGTCAAAAGAACAAAGCTGG + Intergenic
1089318984 11:117612418-117612440 GGGAGGCAGGAGAAGGAAGCAGG - Intronic
1089340383 11:117753338-117753360 CAAAGGGAGGAGAAGAATGCGGG - Intronic
1089453930 11:118614809-118614831 CAGAGACAAGGGAAGCAAGCTGG - Intronic
1089850143 11:121488511-121488533 GAGAGCCAGGTGGAGAAAGCTGG + Intronic
1089871881 11:121682247-121682269 CAGCATCAGCAGAAGTAAGCAGG + Intergenic
1089931192 11:122314222-122314244 CAGGTTCAGGAGATGAAAACTGG + Intergenic
1090033582 11:123228922-123228944 CAGGGTCAGGATGAGAAGGCAGG - Intergenic
1090848493 11:130549919-130549941 CAAAGCCAAGAGAAGAAAGAGGG - Intergenic
1090907049 11:131085045-131085067 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1091036481 11:132238306-132238328 GGGAGGCAGGAGAAGGAAGCAGG + Intronic
1091524920 12:1290069-1290091 CAGAGCCAGAAGATGAATGCAGG - Intronic
1092006192 12:5072441-5072463 CAGAGCCACTAGAAGCAAGCTGG - Intergenic
1092053183 12:5487946-5487968 CAGAGCCAAGATCAGAAAGCAGG - Intronic
1096340337 12:50793061-50793083 CATAATCAGGAGAAGAAAGGAGG - Intronic
1096648195 12:53049390-53049412 CTGTGTCAGGAGCAGAAACCTGG + Intronic
1096825400 12:54272933-54272955 CAGAGGCAGGACAAGAACCCAGG + Intronic
1096855827 12:54481890-54481912 CTTAGTCAGGAGATGAAAGTAGG + Intergenic
1096967426 12:55639346-55639368 CAGAGCCTGGAGAAGGAAGTGGG + Intergenic
1097827386 12:64188168-64188190 CAGAGGCATGGGAAGAAAGGTGG + Intronic
1098554975 12:71808107-71808129 AAGAGAGAGGAGAAGACAGCAGG - Intergenic
1098874417 12:75852226-75852248 CCGAGTCAGAATAATAAAGCAGG + Intergenic
1099015487 12:77339039-77339061 CAGATTAAGGAGGAGAAATCTGG + Intergenic
1099027224 12:77480002-77480024 CAAAGAAAGCAGAAGAAAGCAGG - Intergenic
1099196544 12:79623179-79623201 CAGAGTCAGTGAAAGAAATCTGG + Intronic
1099269223 12:80486482-80486504 CAGAGTCAGGCCAAGAACCCAGG - Intronic
1099451172 12:82808680-82808702 CAGTGGCAGGAGAAGAATACTGG - Intronic
1101390572 12:104296089-104296111 CAGAGTCAGGACTAGAACCCAGG + Intronic
1101530155 12:105566480-105566502 TAGAGACAGGAGCAGAAAGAAGG - Intergenic
1101536351 12:105620769-105620791 CTGAGTAAAGAGAACAAAGCTGG - Intergenic
1102389684 12:112539548-112539570 CAGAGTCAGGAGCAGAACCCAGG - Intergenic
1102754427 12:115325930-115325952 CAGAGCCAGGATTATAAAGCAGG - Intergenic
1103399977 12:120637225-120637247 CAGAAACTGGAGAGGAAAGCAGG - Intergenic
1103402577 12:120653373-120653395 CACAGTATGGAGAAGGAAGCTGG + Intronic
1104283793 12:127404506-127404528 CACGGTCAGGAGAACCAAGCTGG - Intergenic
1104325708 12:127795118-127795140 AAGAGTGAAGAGAAAAAAGCAGG - Intergenic
1104438568 12:128776555-128776577 CAGAATCGGGAGACGAAAGGGGG + Intergenic
1105527235 13:21187302-21187324 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1106922421 13:34577685-34577707 CTGAGTCAGGTAAAGAAAGATGG + Intergenic
1107806875 13:44161532-44161554 CATAATCAGGAGAAGAATGCTGG - Intergenic
1108068462 13:46603289-46603311 CAGGGTCAGGAGGAGGAAACTGG - Intronic
1108758839 13:53537897-53537919 CATACTCAGAGGAAGAAAGCTGG - Intergenic
1110479660 13:75959542-75959564 CTGAGTCAGGGGAAGGAGGCTGG + Intergenic
1110610423 13:77481340-77481362 GAGAGAGAGGAGTAGAAAGCAGG + Intergenic
1111201943 13:84949703-84949725 AAGATTTGGGAGAAGAAAGCTGG - Intergenic
1111244306 13:85515349-85515371 CAGGGTCAGTGGAGGAAAGCGGG + Intergenic
1112853319 13:103733939-103733961 CAGAGTTGGGAGGAGAAAGACGG + Intergenic
1114989488 14:28269720-28269742 CTAAGTGAAGAGAAGAAAGCAGG + Intergenic
1115653033 14:35416948-35416970 CAGAGTCAGGAGTGGGAAGAAGG + Intergenic
1117160601 14:52985836-52985858 CAGAGAGGTGAGAAGAAAGCAGG + Intergenic
1117327245 14:54680895-54680917 CAGAGAGAGAAGAATAAAGCAGG + Intronic
1117558718 14:56912876-56912898 CAGAGTCAGGGGAAGGATGAGGG + Intergenic
1117765334 14:59076115-59076137 AAGAGTCAAGTGAAGAATGCTGG + Intergenic
1117817330 14:59611522-59611544 ACCAGTCAGGAGAAGAAAGGAGG - Intronic
1117881695 14:60318988-60319010 CATTGTCAGGAGAAGCAAGAGGG - Intergenic
1118725827 14:68628477-68628499 CAGAGCCGAGAGAACAAAGCAGG - Intronic
1118868986 14:69726117-69726139 CATAGCAAGGAGAAGAAAGGCGG + Intergenic
1119254744 14:73185494-73185516 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1120242140 14:81961826-81961848 CTGAGGCAGGAGAAGAAGCCAGG - Intergenic
1120547739 14:85830530-85830552 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1120718614 14:87866855-87866877 CATTGTCAGGAGGAGAAAGAAGG + Intronic
1121263411 14:92582969-92582991 CACAGGCAGGAGAAAACAGCGGG - Intronic
1121533834 14:94677562-94677584 GAGAGGCAGGAGGAGGAAGCAGG + Intergenic
1121584783 14:95055759-95055781 CAGAGCCAGGATTAGAAACCAGG - Intergenic
1121686655 14:95840403-95840425 CCGAGCCAGGAGAAGTAAGCTGG + Intergenic
1121741484 14:96255308-96255330 CAGCAACAGGAGAAGACAGCAGG + Intronic
1122047194 14:99032565-99032587 GAGAGATAGGAGAGGAAAGCTGG + Intergenic
1123480444 15:20626642-20626664 CAATGTCAGGGGATGAAAGCAGG + Intergenic
1123637564 15:22373725-22373747 CAATGTCAGGGGATGAAAGCAGG - Intergenic
1123894375 15:24813801-24813823 CAAAGACATGAGAAGAGAGCAGG + Intergenic
1124041949 15:26113563-26113585 CAGAGGCTGGAAAAGAAAACAGG - Intergenic
1125459819 15:39895119-39895141 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125795898 15:42403690-42403712 CAGTGTCACCAGAAGCAAGCAGG - Intronic
1126367599 15:47912020-47912042 CAGAGTAAATAGAATAAAGCAGG - Intergenic
1127105836 15:55614044-55614066 CCGAGTAAGCATAAGAAAGCTGG - Exonic
1127216129 15:56824627-56824649 CAGAGTCCAGGTAAGAAAGCTGG - Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127764739 15:62174014-62174036 GGGAGTGAAGAGAAGAAAGCAGG + Intergenic
1127973902 15:63983335-63983357 CAGTTTCAGGAGGAGGAAGCGGG + Intronic
1128128529 15:65210527-65210549 AAGGGTCAGGAGAGGAAAGCAGG + Intronic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1128349133 15:66877488-66877510 CAGAGACAGGAGAAAGAAGCAGG + Intergenic
1128823640 15:70687352-70687374 CAGAGTCTGCTGAAGAAAGAAGG - Intronic
1129005463 15:72369360-72369382 CAAAGTCAGCTGAAGAAAGGAGG - Intronic
1129738779 15:77979904-77979926 CAGGGTCAGGAGGAGAAAGCTGG - Intergenic
1129847176 15:78773276-78773298 CAGAGTCAGGAGAAGAAAGCTGG + Intronic
1130060461 15:80566244-80566266 CAGAGTTAGAGGAAGAAGGCAGG - Intronic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1130608670 15:85340447-85340469 CAGAAACAGGAGAAGAAAACAGG + Intergenic
1130773017 15:86944068-86944090 AAGAGTCAGGTGAAGAATGAAGG + Intronic
1131667414 15:94585228-94585250 CAAAGGCAGGAGGAGAAAGGGGG - Intergenic
1131799330 15:96053248-96053270 CCGAGCCAGGTGAAGAAAGCTGG + Intergenic
1132465046 16:73530-73552 CAGTGTCAGGAGAGAAATGCTGG - Intronic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1132768317 16:1546384-1546406 CAGAGCCAGGAGCAGAACCCAGG - Intronic
1133371462 16:5248691-5248713 CAGAGTTAGGACAAGAGGGCCGG + Intergenic
1133476771 16:6130696-6130718 AATAGTAAGGATAAGAAAGCTGG + Intronic
1133724440 16:8524278-8524300 CAACGTCAGGAGGAGAAACCTGG - Intergenic
1134327945 16:13224250-13224272 TAAAGTCAGGTGAAGAAGGCAGG - Intronic
1134391340 16:13823034-13823056 CAGAGTCAGGAGGTGAGACCAGG - Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1135340992 16:21647860-21647882 CAGGGTGCGGACAAGAAAGCAGG - Intronic
1135483925 16:22846881-22846903 CAGAGTCAGGATACAAAAGTGGG + Intronic
1135597995 16:23757703-23757725 TAGGGCCAAGAGAAGAAAGCTGG + Exonic
1136778665 16:32884485-32884507 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1136891955 16:33977029-33977051 CAAAGTTAGGAGAAGGATGCTGG + Intergenic
1137493331 16:48951203-48951225 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1137554995 16:49464962-49464984 CACAGTCAGGTGAAGAGCGCCGG + Intergenic
1137977809 16:53045906-53045928 CAGAGGCAGGGGCAGAAAGGGGG - Intergenic
1139277364 16:65740432-65740454 CAGAGTCAGGGAAAGAAACATGG - Intergenic
1139718632 16:68834681-68834703 CATACTCAGGAGATGAAAGAGGG - Exonic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1140376989 16:74452545-74452567 CTGTCTCAGCAGAAGAAAGCAGG + Intronic
1142122942 16:88396278-88396300 CAGAGCCAGGAGATGAAGACAGG - Intergenic
1142220310 16:88851054-88851076 CAGGGTCAGCAGATGAGAGCTGG - Intronic
1142332175 16:89462176-89462198 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1203081081 16_KI270728v1_random:1146579-1146601 CAAAGTTAGGAGAAGGATGCTGG - Intergenic
1142533456 17:598068-598090 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1143239677 17:5433463-5433485 TAGACTCAGGGGAAGAAAGGGGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143689503 17:8549795-8549817 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1144137698 17:12314326-12314348 CAGAGGCCAGAGAACAAAGCTGG - Intergenic
1144257761 17:13486464-13486486 CAGAGGCAGGAGAAGGCAGGAGG + Intergenic
1145284473 17:21495110-21495132 TGGAGTCAGGAGAAGGGAGCGGG - Intergenic
1145392987 17:22470384-22470406 TGGAGTCAGGAGAAGGGAGCGGG + Intergenic
1145920408 17:28605154-28605176 CTGAGTCAGGAGAATCAGGCAGG + Intronic
1146308072 17:31745945-31745967 CAGTGTCAAGTGAAGAAAACTGG - Intergenic
1146309993 17:31760724-31760746 CAGAGTCAGATGAAAAAAGAAGG - Intergenic
1146447302 17:32942615-32942637 TGGAGTCAGGAGAGGGAAGCTGG + Exonic
1147121417 17:38337479-38337501 GAGAGGCAGGAGAGGCAAGCAGG - Intronic
1147963929 17:44183198-44183220 CTGACTCAGGAGAAGACTGCTGG - Intergenic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149790029 17:59468672-59468694 CAGAGTCTGGAGAGCTAAGCAGG + Intergenic
1150517918 17:65833900-65833922 CAAAGTAAAGAGAACAAAGCTGG + Intronic
1150562853 17:66309809-66309831 CAGAGAAAGGAGAAGAAGACAGG + Intronic
1151238008 17:72735644-72735666 GACAGTCAGGTGAAGACAGCTGG - Intronic
1152128989 17:78465037-78465059 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1152308404 17:79534708-79534730 CGGTGTCTGGAGAAGAAATCAGG + Intergenic
1152790358 17:82275292-82275314 CAGAGAGAGGAGGACAAAGCAGG + Intergenic
1153633910 18:7097956-7097978 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1153643321 18:7173982-7174004 CAGAGGCAGGAGGACAAAGCTGG - Intergenic
1153784875 18:8525849-8525871 CTGAGGCTGGAGAAGAAAGCAGG + Intergenic
1155184101 18:23372390-23372412 GTTAGCCAGGAGAAGAAAGCAGG - Intronic
1155197222 18:23486443-23486465 CAAAATCAGGAGGAGAAGGCTGG + Intronic
1155517383 18:26637211-26637233 TAGAGTCAGGAGGAGGAAGGAGG - Intronic
1156839040 18:41589612-41589634 CAGAGTCATAAAAAGAAAACGGG - Intergenic
1157785168 18:50475066-50475088 GAGAGTCAGAAGAAAAAACCAGG - Intergenic
1158835738 18:61329970-61329992 CAGAGTCAGGGGAAGACCACTGG - Intergenic
1158841510 18:61393124-61393146 GAGAGTAAGAAGAAGAAATCTGG - Intronic
1159176457 18:64841588-64841610 CAGAATCAGTAGAGCAAAGCAGG - Intergenic
1159340602 18:67127565-67127587 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
1159796092 18:72846153-72846175 CAGAGCCAAGAGGAGCAAGCAGG + Intronic
1160225871 18:77010031-77010053 CAGAGTGAGGAGGAGTGAGCGGG + Intronic
1160346609 18:78137534-78137556 CACAGACAGGAGAGTAAAGCTGG + Intergenic
1161249764 19:3274179-3274201 CAAACTCAGGAGAAGGCAGCTGG - Intronic
1161300023 19:3538025-3538047 CAGAGTGAGGAGAGGAGGGCAGG + Intronic
1161416792 19:4151752-4151774 CAGAGTGAGGAGAGGAAGACAGG - Intergenic
1161439926 19:4285149-4285171 CACAGCCAGGAGAGGAGAGCAGG - Intronic
1161632070 19:5362548-5362570 GAGGCTCAGGAGAGGAAAGCGGG + Intergenic
1162016038 19:7846968-7846990 TAGGGTCAGAGGAAGAAAGCAGG - Intronic
1162377983 19:10316317-10316339 CAGAGTCAAGGGAGGGAAGCTGG + Exonic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1163902542 19:20117452-20117474 CAGAGCCAGAAGAAGGAAGGAGG - Intronic
1164748957 19:30636894-30636916 CAGAGTCCGCAGAAGAAGTCAGG + Intronic
1164782222 19:30902129-30902151 CACAGGCAGGAGAAATAAGCAGG - Intergenic
1164968568 19:32509915-32509937 CAATGTCAGGGGAAGGAAGCTGG + Intergenic
1165273537 19:34730891-34730913 AAGAGACAGGAGAGGACAGCGGG + Intergenic
1165350431 19:35272292-35272314 CACAGGCAGGAGAGGAAAGCTGG + Intronic
1166108266 19:40608177-40608199 CAGAGAGAGGACAAGAGAGCGGG - Intronic
1166273561 19:41734561-41734583 AAGTGTAATGAGAAGAAAGCAGG + Intronic
1166302753 19:41921689-41921711 CAGAGGCAGGAGAGGGATGCAGG + Intronic
1166354189 19:42217344-42217366 CAGAGTCAGGGGCAGTCAGCAGG - Intronic
1166450711 19:42898160-42898182 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166462611 19:43002502-43002524 AAGAGTAATGAGAAGAAAGTAGG - Intronic
1166501682 19:43345961-43345983 CAGCGTCCGGAGAAGAGAGGTGG + Intergenic
1167038648 19:47009226-47009248 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1167793370 19:51693899-51693921 CACAGACAGGGGAAGACAGCAGG + Intergenic
1168136362 19:54354966-54354988 AACAGTCAGGTGAATAAAGCTGG + Exonic
1168473914 19:56662603-56662625 CAGAGTCTGAAGAAGAAATCTGG - Exonic
926188067 2:10707180-10707202 CAGTGGCAGGGGAAGAAACCAGG + Intergenic
926215697 2:10903756-10903778 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
926292122 2:11539540-11539562 AAGGGTCAGGAGAAGAACACAGG - Intronic
926897464 2:17709956-17709978 CAGAGACAGGATAAGAAAGATGG + Intronic
926935999 2:18087003-18087025 CAGAGACAGGAGGAAAATGCAGG - Intronic
928341096 2:30443806-30443828 AGGAGTCAGGAGAGGAAAGCCGG + Intergenic
929003222 2:37368324-37368346 CAGAGTCAGGAGAAGATGCAGGG - Intronic
929770200 2:44885487-44885509 CAAAGGCAAGTGAAGAAAGCTGG - Intergenic
930158033 2:48125462-48125484 CTGAGGCAGGAGAATAAGGCGGG + Intergenic
931576251 2:63721836-63721858 CTGAGTCAGGAGAATCAGGCAGG - Intronic
931967697 2:67551600-67551622 GAGAGTAAGGAGAAGACATCAGG - Intergenic
931982287 2:67706902-67706924 CAGAGAGGGAAGAAGAAAGCAGG - Intergenic
932213997 2:69954589-69954611 CAGAGACAGGAGGAGAAGACGGG - Intergenic
933022671 2:77214261-77214283 CAGAGTTAGGATAAGAACACAGG - Intronic
933743104 2:85550358-85550380 CTGAGGCAGAACAAGAAAGCAGG + Intronic
933832893 2:86224890-86224912 CAGTGTCAGGGGAAGAATGGAGG + Intronic
934605314 2:95690743-95690765 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
934671772 2:96218397-96218419 CAGAATTAGGAGAAGAAAAAAGG - Intergenic
935844550 2:107151012-107151034 TAGAGTCAGGAAAAAAAAGGAGG - Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936286785 2:111187343-111187365 CAGAGTCAGGGGAGGTATGCAGG + Intergenic
936538771 2:113333296-113333318 CAGAATCAGGAGAAGCCAGTAGG + Intergenic
936540765 2:113349116-113349138 CAGAGTCAGATGGAGACAGCAGG - Intergenic
936799065 2:116244165-116244187 CAGGGTGAGGAGAATAGAGCAGG + Intergenic
936968428 2:118150348-118150370 CTGAGTCCAGAGAAGAAATCTGG - Intergenic
937097149 2:119242815-119242837 CAGAGTCAGGACCAGAATCCAGG + Intronic
937505147 2:122528354-122528376 CAGGGACAGGAGAAAGAAGCTGG + Intergenic
937653515 2:124347490-124347512 CAGATTGAGCAGAAGAAAGCTGG + Intronic
938730825 2:134145662-134145684 CAGAGTCAGAATTAGAAGGCAGG - Intronic
939345285 2:140957713-140957735 CAAAGGCAGTAAAAGAAAGCTGG + Intronic
939373847 2:141338305-141338327 AAGAGGAAGCAGAAGAAAGCAGG + Intronic
939455204 2:142425396-142425418 CAGAGTAAGGTGAAGAATGATGG - Intergenic
940525197 2:154805343-154805365 CAGAGGGAGTAGAAGAACGCCGG + Intronic
940635434 2:156292969-156292991 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
940788967 2:158011753-158011775 CATAGACAGGAGAGGAAAGGAGG - Intronic
941039139 2:160600665-160600687 CAGAGTGGCTAGAAGAAAGCAGG + Intergenic
941921231 2:170852953-170852975 AAGAGCCAAGAGAAGAAACCAGG - Intronic
942248023 2:174025276-174025298 CAGAGTCAGGAGACCAGAGCTGG - Intergenic
942625302 2:177894095-177894117 CACATTCAGGAGAAGAAGCCAGG - Intronic
943204312 2:184872958-184872980 AAGTGACAGGAGCAGAAAGCAGG + Intronic
943459400 2:188152675-188152697 CAGAGTAAGAAGTATAAAGCAGG + Intergenic
943863066 2:192893577-192893599 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
943920195 2:193697671-193697693 CAGACTAATGAAAAGAAAGCAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
945163202 2:206914322-206914344 CAGAGGCCGGAAAAGATAGCTGG + Intergenic
946034013 2:216727508-216727530 CAGAGTGCGGTGGAGAAAGCTGG + Intergenic
946144427 2:217718339-217718361 CAGAGAGAGGAGAAGAAGGGAGG - Intronic
946439724 2:219685101-219685123 AAGGGTCAGGAGAAGACAGTGGG + Intergenic
946595704 2:221303530-221303552 CAGAGACAAGAGAAGAACCCAGG - Intergenic
946918660 2:224554071-224554093 AAGAGTGAGGAGAAGAGAGAAGG - Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
948487892 2:238292362-238292384 CAGGGTGAGGCGAAGAAAGATGG - Intergenic
948893374 2:240917455-240917477 CAGAGTCCGGGGACGCAAGCAGG + Intergenic
948924571 2:241086928-241086950 AAGAGGCAGGAGATGAAATCGGG + Intronic
1168824242 20:798642-798664 CAGAGGCAGGTGCAGACAGCAGG - Intergenic
1168923546 20:1560693-1560715 CTGAGTTAGGATAAGAGAGCTGG + Intronic
1169045064 20:2528555-2528577 CAGAGTCAGGGAAAGAAAGTAGG - Intergenic
1169756817 20:9051808-9051830 CTGAGTCATGAGATGTAAGCAGG - Intergenic
1170057054 20:12217421-12217443 CAGAGTCAGGCAAAGAATTCTGG + Intergenic
1170343243 20:15353052-15353074 CTGAGCCAGAAGAACAAAGCTGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1171345162 20:24460271-24460293 CAGAGCCCAGAGAAGTAAGCAGG - Intergenic
1171774662 20:29354504-29354526 GAGAGTCAGGAAAAGCAAGTGGG + Intergenic
1171901673 20:30863856-30863878 GAGAGTCAGGAAAAGCAAGTGGG - Intergenic
1172145368 20:32754038-32754060 CAGACTCAGGTGAAGAAGACAGG - Intergenic
1172728732 20:37068945-37068967 CTGAGTCAGGAGAATCAGGCAGG - Intronic
1173029139 20:39338544-39338566 CAGAGGCTGGAGAAGCAGGCAGG + Intergenic
1173033660 20:39387890-39387912 CAGAGTCAGGAACAGATGGCAGG - Intergenic
1173369411 20:42421426-42421448 CACAGTCAGGACAAGAAACCAGG + Intronic
1173492314 20:43493019-43493041 CAGAGGCAGCAGAAGAGGGCAGG + Intergenic
1173659871 20:44725569-44725591 CAGAGCCGGGAGAGGAAAGGTGG + Intronic
1173833888 20:46112594-46112616 AAGAGTCAGCAGATGAAAGGTGG + Intergenic
1174049798 20:47759718-47759740 AAGAGCCAGGAGTACAAAGCAGG - Intronic
1174668156 20:52280154-52280176 AGGAGTCAGGAGAAAAAAGTAGG + Intergenic
1175048457 20:56129559-56129581 CAGGGTTAGGGGAAGAAAGCAGG + Intergenic
1175881421 20:62261601-62261623 CAGAGTCAGGGCTAGAAAACGGG - Intronic
1177332728 21:19683170-19683192 CAAAGAAGGGAGAAGAAAGCAGG - Intergenic
1178409903 21:32354454-32354476 CAAAGTCAGGATTAGAACGCAGG - Intronic
1179222296 21:39419158-39419180 CAGAGACAGGAGAAGAATAGTGG - Intronic
1179415806 21:41197817-41197839 CAGAGCCAGGATTTGAAAGCAGG + Intronic
1179634098 21:42696446-42696468 AAGACACAGGAGAAGAAAGTCGG + Intronic
1179794921 21:43776905-43776927 CAGAGGGATGAGAAGAAGGCAGG + Intergenic
1179984036 21:44911476-44911498 CATAGCCAGGAAGAGAAAGCTGG + Intronic
1180320144 22:11312735-11312757 GAGAGTCAGGAAAAGCAAGTGGG + Intergenic
1180335046 22:11569804-11569826 GAGAGTCAGGAAAAGCAAGTGGG - Intergenic
1180702300 22:17788219-17788241 CACAGTCGGGAGCAGAAGGCTGG + Exonic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182145265 22:27993436-27993458 CAGAGTGTGGAGAACAAAGTGGG - Exonic
1182285867 22:29246585-29246607 GAGAACCAGGAGAAGCAAGCAGG + Intronic
1182353291 22:29710752-29710774 GAGATTCAGGAGGAGGAAGCGGG + Intergenic
1182511746 22:30824929-30824951 CAGAGTCAGGACAAGAAGCCAGG - Intronic
1183004739 22:34891703-34891725 CAAACTGAGAAGAAGAAAGCAGG - Intergenic
1183031697 22:35111241-35111263 CAGAGACAGGAAGAGAAGGCTGG + Intergenic
1183270801 22:36861463-36861485 CAGTGTCTGGAGAGGAATGCAGG + Intronic
1183583468 22:38738989-38739011 CTGAGACAGGAGAGGAAGGCAGG + Intronic
1183729392 22:39609250-39609272 CAGAGTCAGGAGTTGAACCCAGG + Intronic
1184366093 22:44052371-44052393 CAGAATCAGGTGAGGAGAGCAGG - Intronic
1184840146 22:47047860-47047882 CAGAGTCTGCAGCAGAAAACAGG - Intronic
949308283 3:2668033-2668055 CTGAGTCAAAAGAACAAAGCTGG - Intronic
949358499 3:3206841-3206863 CAGAGTCAGGACTAGAACCCAGG + Intergenic
949501837 3:4687518-4687540 CAGAGGCAAGAGAGGATAGCAGG - Intronic
950047139 3:9955467-9955489 CAGAGTCTGCAGAAGGATGCTGG - Intergenic
950092013 3:10302592-10302614 CAGAGTCAGGACCAGAACCCAGG - Intronic
950234379 3:11306083-11306105 CAAAGTCAGGAGAAGAGAAGAGG - Intronic
950283458 3:11726209-11726231 CGGAGTGAAGAGAAGAAAACAGG - Intergenic
950440701 3:13008575-13008597 CACAGTCAGGAAAATGAAGCAGG - Intronic
950448978 3:13055054-13055076 CAGAGCCAGGACAGGAAGGCCGG - Intronic
950479997 3:13238208-13238230 CAGGACCAGGAGAGGAAAGCAGG - Intergenic
950614505 3:14148194-14148216 CAGATTCTGCCGAAGAAAGCTGG + Intronic
950719766 3:14874676-14874698 CCAAGTCAGGAGTAGAAATCAGG + Intronic
951584074 3:24197312-24197334 CAGAGGCAGGAAAAGATAGTGGG + Intronic
951874250 3:27403983-27404005 CAGAATCAGAAAAAGAGAGCTGG + Intronic
952131597 3:30370420-30370442 CAGAGTCAGAAGCAGATGGCAGG + Intergenic
952275554 3:31872299-31872321 CAGAGCAAGGACAAGAAAGCAGG + Intronic
952352676 3:32555574-32555596 TAGAGTGAGGAGAAGAGAACTGG - Intronic
952511778 3:34065629-34065651 CAGAGTCAGGGGAAGCATCCTGG - Intergenic
952773346 3:37021911-37021933 CAGACTCGGGAGAATATAGCAGG + Intronic
953292187 3:41676772-41676794 GAGAGTCAGGCGAAATAAGCTGG - Intronic
954272173 3:49518544-49518566 CAGGGTCAGGAGAATAAAGAAGG + Intronic
954277357 3:49551330-49551352 CATAGGCTGGAGAAGCAAGCTGG + Intergenic
954567453 3:51610503-51610525 CTGAGGCAGGAGAATAAACCTGG + Intronic
954925569 3:54231298-54231320 CAGAGTGAGGACCAGAAGGCAGG - Intronic
954934794 3:54316742-54316764 CAGACTCAGAAGAAAAAAGTGGG + Intronic
955370835 3:58350402-58350424 CAGAGTAAGGACAAGAACCCGGG - Intronic
955674710 3:61435617-61435639 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
956334453 3:68147405-68147427 CAGAGGCAGGAGCAGAAAGTTGG - Intronic
958122585 3:89310943-89310965 CAGAGTCAGGATAAGAACCTAGG - Intronic
958825061 3:99020400-99020422 CATTGTCAGGAAAAGAAAACTGG + Intergenic
959883627 3:111474106-111474128 GAGAGTGAGGAAAAGCAAGCTGG - Intronic
960697916 3:120413888-120413910 CTGAGTCAGGAGAATCAGGCAGG - Intronic
960959404 3:123058746-123058768 CAGCTTCAGGAGAATGAAGCTGG - Intergenic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
962242165 3:133758937-133758959 CAGAGGCTGGAGAGGAAAGTTGG + Intronic
962501840 3:136002512-136002534 CAGAGTCAGAAGCTGAGAGCTGG - Exonic
962812634 3:138972497-138972519 CAGAGACAGGAGAAGCCAGCTGG + Intergenic
962979580 3:140475591-140475613 CCAAGTCAGGATGAGAAAGCAGG - Intronic
963584024 3:147161647-147161669 AAGTGTCAGGGGAGGAAAGCGGG - Intergenic
964982182 3:162699076-162699098 TTGAGTCATAAGAAGAAAGCAGG + Intergenic
966578090 3:181526111-181526133 CACACTCATCAGAAGAAAGCTGG + Intergenic
967278327 3:187798260-187798282 CAGAGTCAAGAGAGGAAGACAGG + Intergenic
967534554 3:190587488-190587510 CAGAATTAGGACAAGAAACCAGG + Intronic
969798051 4:9541222-9541244 CAGAGTTAGGACAAGAGGGCTGG + Intergenic
969978746 4:11132333-11132355 CAGAGTCAGGATTTGAAACCAGG - Intergenic
970050398 4:11907761-11907783 CAGAGGCAGGAGATCAAAGGAGG + Intergenic
970754579 4:19409717-19409739 CAGTCTCAGGAGAAGAAAGCTGG - Intergenic
970992920 4:22234289-22234311 CAGGGTCTGGAAGAGAAAGCTGG - Intergenic
971139316 4:23906512-23906534 CTGAGGCAGGAGAAGAACCCAGG + Intergenic
971377553 4:26067412-26067434 CACAGTTGGGAGAAGAAGGCCGG + Intergenic
971597068 4:28543751-28543773 CAGAGTCAGGAAAAGAAAGGAGG - Intergenic
972746835 4:41942054-41942076 CAGAGTCAGGAGTGGAACTCAGG + Intronic
973820920 4:54660497-54660519 CAGAGTCATGAGAAAAAAAATGG - Intronic
974120573 4:57632926-57632948 AAGAGTCAAGAGAGGAAACCAGG - Intergenic
974594002 4:63994097-63994119 CAGATACAGGAAAAGAAAGAAGG - Intergenic
974745773 4:66073817-66073839 AAGAGAAAAGAGAAGAAAGCAGG - Intergenic
975488941 4:74967421-74967443 CAAAGTCAGGTGAAGAAATGGGG - Intronic
975570269 4:75809718-75809740 CATAGTGAGAAGAAGAATGCTGG - Intronic
976085804 4:81406029-81406051 TAGAGCCAGGAGTAGAAATCAGG + Intergenic
976469144 4:85407088-85407110 CAGAGGCAGCAGCAAAAAGCAGG - Intergenic
976518593 4:86000724-86000746 CAGAGACAGCAGGCGAAAGCAGG - Exonic
976573556 4:86641131-86641153 AAGAGTCAGGAGAAGAACTTGGG - Intronic
977204969 4:94157381-94157403 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
977503391 4:97869914-97869936 CAGAGTCAGGACAAGAACCCGGG + Intronic
977967948 4:103177417-103177439 AAGAGTCAAGAGAAGAATGGTGG - Intronic
978915925 4:114125858-114125880 CAGTGCCAGAAGAAGAAAGCAGG + Intergenic
979216233 4:118167610-118167632 TTGAGACAGGAGAACAAAGCTGG + Intronic
979405010 4:120299155-120299177 AAGAGGAAGGAGAAGAAAGGGGG - Intergenic
981523507 4:145689811-145689833 CATATGCAGAAGAAGAAAGCTGG + Intronic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
981991837 4:150930827-150930849 CAGTGTTAGGAGATGACAGCTGG + Intronic
982160073 4:152559845-152559867 CAGAGTCATGAGAACCAAACCGG - Intergenic
982379941 4:154739715-154739737 CAGAGTCAGGAGCAGAATGCAGG - Intronic
983575620 4:169258179-169258201 CATAGCCAGGACTAGAAAGCAGG + Intronic
983811600 4:172068914-172068936 CAAAGTCAGAACAAGAATGCAGG - Intronic
984089937 4:175360576-175360598 AAGAGCCTGGAGAAGCAAGCAGG + Intergenic
984382069 4:179007422-179007444 CAGAGTCCCGAAAAGAATGCAGG + Intergenic
984413000 4:179419433-179419455 CAGAGTCAGGAGCAGAAGAAAGG + Intergenic
984671383 4:182492057-182492079 CAGAGTATAGAAAAGAAAGCAGG + Intronic
986130687 5:4927129-4927151 CAGAGGGAGGAGAGAAAAGCAGG - Intergenic
986248461 5:6032357-6032379 CAGAGTGAGGAGATGAGATCAGG + Intergenic
986257093 5:6109541-6109563 CAGAGTCAGGTGGATAAGGCGGG - Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986526859 5:8688405-8688427 AAGAGGCAGGAGAAGCAAGGGGG + Intergenic
987069925 5:14326543-14326565 CAGAGGCAGAAGAGTAAAGCTGG - Intronic
987268154 5:16277748-16277770 CTGAGTCAGGAGAATCAGGCAGG + Intergenic
987304317 5:16623447-16623469 CAGAGAAAGCTGAAGAAAGCAGG - Intergenic
987643261 5:20638308-20638330 CTGAGTTAGAAGAATAAAGCTGG + Intergenic
988253028 5:28785094-28785116 CAGAGTCAGTAGAGGATAGAAGG + Intergenic
989735397 5:44697288-44697310 CAGAGTGGGGGGAAGTAAGCAGG - Intergenic
990169187 5:53028933-53028955 CAAAGACAGCAGAATAAAGCTGG - Intronic
990476116 5:56163158-56163180 CAGAGTGAGGGCAAGAATGCAGG - Intronic
991154506 5:63415499-63415521 CATAGTCAGCAGAACAAAGAGGG - Intergenic
991156933 5:63448712-63448734 CACAGTCAGGACAAGTCAGCAGG - Intergenic
991642706 5:68770605-68770627 TAGAGTGAGAAGAAGAAATCTGG - Intergenic
991674336 5:69076252-69076274 GAGTGTCTGGAGAAGGAAGCAGG - Intergenic
993060881 5:83037589-83037611 CAGAGTCATTAGAAGGAAGCAGG + Intergenic
994078899 5:95684128-95684150 GAGAGTCATGAGAGGCAAGCAGG - Intronic
994613839 5:102078581-102078603 CAGAGGCAAGAGAAAAAAGTTGG + Intergenic
995061110 5:107812773-107812795 CAGAGTCAGGAGGTGAGAGGAGG - Intergenic
995365674 5:111357313-111357335 CAGGGTCAGGAGATCAAAGCTGG + Intronic
995404490 5:111779357-111779379 CAGAGACAGAAGCACAAAGCAGG - Intronic
995547468 5:113247410-113247432 AAGAGTAAAGAGAACAAAGCAGG + Intronic
995737705 5:115320164-115320186 CAGAGGGAAGAGACGAAAGCAGG + Intergenic
997449451 5:133969877-133969899 CAGATTCAGGAGTAGAACACAGG - Intergenic
997524245 5:134542153-134542175 CATAGGCAGCAGAAGACAGCAGG - Intronic
997870797 5:137503688-137503710 CAGAACCATGAGAAGAAATCTGG - Intronic
998065875 5:139158169-139158191 CAGAGCCAGAATTAGAAAGCAGG + Intronic
998148484 5:139744062-139744084 CAGAGCCAGGAGGAGAAGGCAGG - Intergenic
998250871 5:140551342-140551364 CAGTGTCAGAAGAAGACAGCAGG - Intronic
998845733 5:146307819-146307841 CAGAGCCAGGATTTGAAAGCAGG - Intronic
999079708 5:148831544-148831566 CAGAGTCAGGACGAGAACCCAGG + Intergenic
1000216133 5:159158493-159158515 CAATGTCAGGGGATGAAAGCAGG + Exonic
1000703880 5:164487554-164487576 CACTGTCAGGAGAAGCATGCGGG + Intergenic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001209494 5:169796757-169796779 AGGAGTCAGGAGAAGATGGCTGG + Intronic
1001576068 5:172764607-172764629 CAGAGTCAGGACTTGAACGCAGG + Intergenic
1002283673 5:178148269-178148291 CAGAAACAGGAAAAGACAGCAGG - Exonic
1002316626 5:178348286-178348308 CAAAATAATGAGAAGAAAGCAGG - Intronic
1002581221 5:180210419-180210441 CAGAGTGAGGTGAAGGCAGCTGG - Intergenic
1002603544 5:180369002-180369024 CAGAGTCAGGGGACAGAAGCTGG - Intergenic
1003407588 6:5836547-5836569 CTGAGGCAGGAGAATAAGGCAGG + Intergenic
1004209189 6:13620493-13620515 TAGAGACAGGAGAATAAAGCTGG - Intronic
1004715577 6:18213630-18213652 CAAAGTGAGCAGAAGAAAGGTGG - Intronic
1004818380 6:19337403-19337425 CGGAGGCAGAAGGAGAAAGCGGG + Intergenic
1005441455 6:25873550-25873572 CAGAGTCAGCAGAAGATGGTAGG - Intronic
1006102315 6:31693178-31693200 TAGGGTCAGGAGCAGCAAGCTGG + Intronic
1006516648 6:34549276-34549298 CAGAGACAGGAGCAGAATGGTGG + Intronic
1006896852 6:37476690-37476712 CAGAGTCAGGAGGAGACAGATGG + Intronic
1007385283 6:41516390-41516412 CAGGGGCAGGGGAAGAGAGCTGG - Intergenic
1007582268 6:42966588-42966610 CTCAGCCAGGAGAGGAAAGCCGG + Exonic
1007643322 6:43361255-43361277 CAGAATAAGGAGAAGAAATTAGG + Intronic
1009283028 6:61775841-61775863 CTGAGTCAAAAGAACAAAGCTGG + Intronic
1009873222 6:69473904-69473926 CAGAGTGAGAAAAAGGAAGCAGG - Intergenic
1010512999 6:76743761-76743783 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1010595666 6:77760620-77760642 TAAAGTCAGGAGAAGACAGAAGG - Intronic
1010669393 6:78669861-78669883 CACACTCCGGAGAAGAAAACCGG + Intergenic
1011553173 6:88548311-88548333 AAGAGTGAGGGGAAGAAGGCAGG + Intergenic
1011750420 6:90449617-90449639 CAGAGTTGGCAGAAGACAGCAGG + Intergenic
1011885685 6:92092045-92092067 CTGAGGCAGGAGAATGAAGCCGG + Intergenic
1012747159 6:103106041-103106063 CAGATTAAGAAGCAGAAAGCAGG - Intergenic
1012786960 6:103642638-103642660 CAGAGTCTCAAGAAGAAAGAAGG + Intergenic
1012909404 6:105102333-105102355 AGGAGTCAGGAGCAGACAGCTGG + Intronic
1013261393 6:108446805-108446827 CAGAGGCAGCATAAGAGAGCTGG - Intronic
1013518234 6:110908979-110909001 CTGAGTCAAAAGAACAAAGCTGG + Intergenic
1013552785 6:111225455-111225477 CTGAGGCAGGAGAAGAATCCAGG + Intronic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1014796585 6:125731860-125731882 CAGAGCTCGGAGATGAAAGCTGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1016932396 6:149424189-149424211 CAGAGTTGGGAGAGGACAGCAGG - Intergenic
1017600049 6:156070437-156070459 TAGAGTCTGCAGAGGAAAGCAGG - Intergenic
1017927406 6:158922283-158922305 CCGAGCCAGGAGGAGGAAGCCGG - Intergenic
1018317722 6:162573493-162573515 CAGACTTAGTAGAAGCAAGCTGG - Intronic
1019064444 6:169284941-169284963 GAGAGACAGGACAGGAAAGCAGG + Intergenic
1021441583 7:20682973-20682995 CCAGGTCAAGAGAAGAAAGCTGG - Intronic
1021498474 7:21303091-21303113 CAGAGTGAGGGGAAGCCAGCAGG - Intergenic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021651793 7:22839940-22839962 GAAAGTCAGTAGAAGAAAGATGG + Intergenic
1021796946 7:24265354-24265376 AAGAAGCAGGAGAAGCAAGCAGG + Intergenic
1021816550 7:24452726-24452748 CAGATTCAGCAGAAGATACCAGG + Intergenic
1022575367 7:31492257-31492279 CAGTGTCGGGGGAAGAAACCTGG + Intergenic
1023048514 7:36231703-36231725 CAGAATCAGCAGAAGAAAGGCGG + Intronic
1023747639 7:43336493-43336515 CAGAGTCCTGAGAGGGAAGCTGG - Intronic
1023882850 7:44330218-44330240 CAGATGCAGGAGCAGAAAGCTGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024839701 7:53571652-53571674 CAGACCCAGGAGAAGGAAGAGGG - Intergenic
1024915721 7:54497381-54497403 AAGGGTCAGGAGAAGAGAGATGG + Intergenic
1025035066 7:55588805-55588827 CAGAGTCAGGAGAATGGGGCAGG - Intergenic
1025072320 7:55910952-55910974 CACAGTCAGGAGAAGCAGACGGG - Intronic
1025800676 7:64784207-64784229 CTGAGGCAGGAGAAGCAGGCAGG - Intergenic
1026293416 7:69029240-69029262 CAGAGTCAGCTGAAGAGAGATGG - Intergenic
1026571148 7:71532169-71532191 CAAAGTCAGGAGAAGGAAACAGG - Intronic
1026913967 7:74108765-74108787 CAGAGGCAGGAGAGGGGAGCTGG + Intronic
1027514420 7:79124451-79124473 CAGAGCCAGAAGAGGAAAACAGG + Intronic
1028131126 7:87175117-87175139 CTGAGGCAGGAGAATATAGCTGG - Intronic
1028557758 7:92141457-92141479 CAGAGAGAAAAGAAGAAAGCTGG - Intronic
1029745111 7:102512294-102512316 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1029763103 7:102611455-102611477 GAGAGAAAGGAGAAGAAAGGAGG + Intronic
1030891554 7:115005223-115005245 CAGAGCCAAGACCAGAAAGCTGG + Intronic
1031020459 7:116621944-116621966 CACAGTCACGAGAAGAAAAATGG + Intergenic
1032181700 7:129684916-129684938 CTGAGGCAGGAGAACAAAGGAGG + Intronic
1032503235 7:132415633-132415655 GAGAGTGAGGAGGAGAAAGAGGG - Intronic
1032996675 7:137454797-137454819 CAGAGTCACTAGGATAAAGCTGG - Intronic
1033172172 7:139093911-139093933 CAGAGTGATCAGAAGAAAGTCGG - Intronic
1033293917 7:140114264-140114286 CTGAGGCAGGAGAATCAAGCAGG - Intronic
1033362518 7:140647850-140647872 CAGAGTCAGGAGAAGGAGTGAGG + Intronic
1034421704 7:150994140-150994162 CAGAGTCGGCAGGTGAAAGCTGG + Intronic
1035254669 7:157618705-157618727 AAGAGTATGGAGAAGAAAGTAGG + Exonic
1035339461 7:158151168-158151190 GAGAGGCAGGAGCAGAAAGGCGG - Intronic
1035339488 7:158151278-158151300 GAGAGGCAGGAGCAGAAAGGCGG - Intronic
1035339508 7:158151351-158151373 GAGAGGCAGGAGCAGAAAGGCGG - Intronic
1035741480 8:1931113-1931135 CAGAGACAGGACGGGAAAGCCGG - Intronic
1035911584 8:3572281-3572303 CAGAGCCTGGGGCAGAAAGCAGG + Intronic
1035951521 8:4027291-4027313 GTGAGTCAGGAGTAGAAAGTAGG + Intronic
1035971046 8:4249663-4249685 CAGCGGTAGGAGAAGAGAGCTGG - Intronic
1036634161 8:10537449-10537471 CAGAGGCTGGGGAGGAAAGCAGG + Intronic
1037179962 8:15993496-15993518 GAGAGTCAGAAGAAGCAAACTGG - Intergenic
1038960850 8:32517954-32517976 GAGAAACAGGAGAAGAAAACAGG + Intronic
1040576245 8:48654040-48654062 GTGAGTCAGGAGAAGGGAGCTGG + Intergenic
1040713327 8:50216504-50216526 CAGACTTAGGGGATGAAAGCAGG + Intronic
1040745991 8:50643230-50643252 CAGTGTCAGCATAAGAAAGCAGG - Intronic
1040839540 8:51770576-51770598 AAGAGACAGGAGGAGACAGCAGG - Intronic
1040914976 8:52559470-52559492 GAGAGTGAGGAGGAGAAAGGTGG - Intronic
1041856721 8:62464728-62464750 CAGAGTCAGGACTAAAAAACTGG - Intronic
1042459605 8:69048156-69048178 AAGAGACAGAAGAAGAAAACAGG + Intergenic
1042596804 8:70458171-70458193 CAGAGCCAGGAGAACACAGAGGG - Intergenic
1043548097 8:81337683-81337705 GAGAGTCAGGAGAGGAGAGGCGG + Intergenic
1043928664 8:86066173-86066195 TAGAGTCAGGATTAGAACGCAGG + Intronic
1044773268 8:95660373-95660395 CAGAGTCATAAGAATAAATCTGG - Intergenic
1045535486 8:103023175-103023197 GAGAGGCAGGTGGAGAAAGCTGG + Intronic
1045659057 8:104417498-104417520 TAGAGTCAGGAGAAGAAATCAGG - Intronic
1045813217 8:106248494-106248516 AACAGTAAAGAGAAGAAAGCTGG + Intergenic
1046283022 8:112058773-112058795 CAGAGTCAGCACAAGAACTCTGG - Intergenic
1047132741 8:122039088-122039110 CAGAGTGTTGAGAAGGAAGCGGG - Intergenic
1047264445 8:123292722-123292744 TAGAGTCAGCATAAAAAAGCAGG + Intergenic
1047279663 8:123434153-123434175 CAGAGGCAGGAGAGCAATGCAGG - Intronic
1047429125 8:124775614-124775636 CAGAGTCAGGACAGGATATCGGG - Intergenic
1047665606 8:127087459-127087481 CAGAGTCAGATGAAGACTGCTGG + Intergenic
1047804817 8:128348211-128348233 CCGAGCCAAAAGAAGAAAGCTGG + Intergenic
1048209807 8:132445380-132445402 CAGAGTCTGGAGGAGAGAGGCGG - Intronic
1048866796 8:138767388-138767410 CAGAGTCAGGATTAGAATCCAGG - Intronic
1048914438 8:139168212-139168234 GAGACTCAGGAGAAAAAAGCAGG + Intergenic
1050188183 9:2997203-2997225 CAGAGTTAGGAGAATAAAGAAGG - Intergenic
1050711845 9:8474324-8474346 CAGAGTTTGGAGAAAAAAGAAGG - Intronic
1051055563 9:12980975-12980997 GAGAGACAGGAGGAGAAACCAGG - Intergenic
1051276706 9:15405933-15405955 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1052040723 9:23735875-23735897 CAGAGCAAGGAGAGGAAAACAGG + Intronic
1052866297 9:33466477-33466499 CAGAGTCAGGAGTTGGAAGTGGG + Intronic
1052963469 9:34320012-34320034 TAGTGTCAGGAGAAGAGGGCTGG - Intronic
1053467854 9:38324132-38324154 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1053681638 9:40489570-40489592 CAGGGTCAGGCTAAGAAACCTGG + Intergenic
1053705429 9:40748406-40748428 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054282075 9:63135364-63135386 CAGGGTCAGGCTAAGAAACCTGG - Intergenic
1054294730 9:63325087-63325109 CAGGGTCAGGCTAAGAAACCTGG + Intergenic
1054392749 9:64629574-64629596 CAGGGTCAGGCTAAGAAACCTGG + Intergenic
1054415504 9:64872013-64872035 TAGTGTCAGGAGAAGGAAGCTGG + Intergenic
1054427399 9:65134783-65134805 CAGGGTCAGGCTAAGAAACCTGG + Intergenic
1054502978 9:65886757-65886779 CAGGGTCAGGCTAAGAAACCTGG - Intronic
1054875428 9:70091364-70091386 CAGAGTCAGGGAGAGAAGGCAGG + Intronic
1055132399 9:72791215-72791237 CAGAGACAAGAGAATAATGCAGG - Intronic
1056385358 9:86092362-86092384 CAGAGTCAGGAGAAGGAAAGAGG - Intronic
1057097881 9:92328411-92328433 CAGAGACAGGATTTGAAAGCAGG - Intronic
1057396032 9:94681266-94681288 CAGAGGCAAGTGAAGAAAACTGG - Intergenic
1057788260 9:98104831-98104853 GAGAGTGAGGAGATGAAAGGAGG + Intronic
1058314194 9:103543931-103543953 CAGAGAGAGGAGAATAAAGTTGG - Intergenic
1058372084 9:104281228-104281250 CAGAGTCAGGAAAAGAAGTTAGG - Intergenic
1058745821 9:107989623-107989645 CAGAGGCTGGAGAAGAAACCAGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059565967 9:115383122-115383144 TAAGGTCAGGAGAAGAAAGAGGG + Intronic
1061263245 9:129491398-129491420 CGGAATCAGGAGAAGACAGAGGG + Intergenic
1061433843 9:130548162-130548184 CAGGGGCAGGGGAAGAAAGCAGG - Intergenic
1062029842 9:134357253-134357275 CAGAGCCCGGAGCAGAAACCTGG + Intronic
1062038970 9:134395562-134395584 CAGACTCTGGAGGAGAAAGGAGG - Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062436108 9:136547195-136547217 CAGAGGCAGGCACAGAAAGCAGG + Intergenic
1203368363 Un_KI270442v1:278489-278511 GAGAGTCAGGAAAAGCAAGTGGG + Intergenic
1203398148 Un_KI270519v1:47083-47105 CTGAGTCAAAAGAACAAAGCGGG + Intergenic
1186033045 X:5390947-5390969 CAGATGCAGGACAAGAACGCAGG - Intergenic
1186140665 X:6568477-6568499 CTGTGTTAGGAGGAGAAAGCAGG + Intergenic
1186382449 X:9075011-9075033 CAGAGGCAGGAGAAGCAGGTAGG + Intronic
1186579084 X:10797876-10797898 CAAAGTCTGGAGAAGAAAACAGG - Intronic
1187848081 X:23562093-23562115 CTAAGTCAAAAGAAGAAAGCTGG - Intergenic
1187992639 X:24892064-24892086 CAGAGTTAGAAGAAGAAAGCCGG + Intronic
1188236659 X:27739915-27739937 CAGAGAAAGGAGAATAAATCTGG + Intronic
1190463152 X:50698907-50698929 CAGAGTTAGGAGGAGGAAGGTGG - Intronic
1191724160 X:64261315-64261337 CAGAGCCAGGACTAGAACGCAGG + Intergenic
1192080237 X:68040760-68040782 CAGAGCCAGGGGCAGAAAACAGG - Intergenic
1192300522 X:69896688-69896710 CAGAGGCAGGACTAGAAATCAGG + Intronic
1192374196 X:70542455-70542477 GAGAGTCAGGACTAGAATGCAGG - Intronic
1192469999 X:71390257-71390279 CAGTGACAGGAGATGAAAGGAGG - Intronic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192553592 X:72072602-72072624 AACTGTCAGGAGAAGATAGCAGG - Intergenic
1192722266 X:73711515-73711537 GAGAGTAAGGGGAAGAAACCTGG + Intergenic
1192918625 X:75681959-75681981 CTAAGCCAGAAGAAGAAAGCTGG - Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194379753 X:93177762-93177784 CAGAGTCATGCTAAGAAAGGAGG - Intergenic
1195273603 X:103256441-103256463 GAGAGTCAGAAGAAGACAGAGGG + Intergenic
1196889107 X:120275240-120275262 CAGAGTCTGGGGAGGGAAGCTGG + Intronic
1196931378 X:120684998-120685020 GAGACTCAGAAGAAGAAAGAAGG - Intergenic
1197650180 X:129055746-129055768 CAGAGTCAGAAGAAGCACTCTGG + Intergenic
1197722062 X:129751971-129751993 AAGAGTCAGGAAAAGACAACAGG - Intronic
1198367079 X:135951666-135951688 CAGAGTCAGGAGGAGATGGATGG + Intergenic
1198474749 X:136984231-136984253 CAGAGTCAGATGAAGACTGCTGG + Intergenic
1199586284 X:149420235-149420257 CTGAGTCAGGAGAATCAGGCAGG - Intergenic
1199665763 X:150095310-150095332 CAGAGTCTGGAGAAGAGACAGGG + Intergenic
1199665824 X:150095659-150095681 CAGAGTCAGGAGGAGGATGGTGG - Intergenic
1200093719 X:153647645-153647667 CCGAGACAGGAGCAGAAAGGGGG + Intronic
1200101160 X:153689564-153689586 CAAGGTCAGGAGAAGGATGCTGG + Intronic