ID: 1129849016

View in Genome Browser
Species Human (GRCh38)
Location 15:78781223-78781245
Sequence TGGGCCCCACCCAAGCAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129849016_1129849025 18 Left 1129849016 15:78781223-78781245 CCAACCTGCTTGGGTGGGGCCCA 0: 2
1: 0
2: 2
3: 23
4: 193
Right 1129849025 15:78781264-78781286 ATCCCCAGCAAGGAGACCAAAGG 0: 1
1: 0
2: 1
3: 21
4: 180
1129849016_1129849029 25 Left 1129849016 15:78781223-78781245 CCAACCTGCTTGGGTGGGGCCCA 0: 2
1: 0
2: 2
3: 23
4: 193
Right 1129849029 15:78781271-78781293 GCAAGGAGACCAAAGGCTGCAGG 0: 1
1: 1
2: 1
3: 32
4: 282
1129849016_1129849030 29 Left 1129849016 15:78781223-78781245 CCAACCTGCTTGGGTGGGGCCCA 0: 2
1: 0
2: 2
3: 23
4: 193
Right 1129849030 15:78781275-78781297 GGAGACCAAAGGCTGCAGGCTGG 0: 2
1: 0
2: 4
3: 29
4: 331
1129849016_1129849021 8 Left 1129849016 15:78781223-78781245 CCAACCTGCTTGGGTGGGGCCCA 0: 2
1: 0
2: 2
3: 23
4: 193
Right 1129849021 15:78781254-78781276 CTCCTGTCCCATCCCCAGCAAGG 0: 1
1: 1
2: 6
3: 61
4: 503

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129849016 Original CRISPR TGGGCCCCACCCAAGCAGGT TGG (reversed) Intronic
900332447 1:2142772-2142794 CCGGCCCCACCCAAACAAGTGGG + Intronic
900368521 1:2321213-2321235 TGGGCCCCACGCCAGCAGCAAGG - Intergenic
900472362 1:2861166-2861188 TCGGCCCCACCAAGGCAGGGAGG - Intergenic
900564255 1:3324627-3324649 TGGCCCCCACCCAAGCACTGAGG + Intronic
901788783 1:11642315-11642337 TGGGCCCCTCCCAACTAGGGAGG - Intergenic
903221490 1:21872162-21872184 TGGGCCCCAGCCAAGCACCAGGG - Intronic
903440609 1:23385293-23385315 TGGGGCTCACCCAAGGAGGGTGG - Intronic
904044133 1:27600182-27600204 TGGGCCCCCCCCAGGGAGGGGGG - Intronic
904196925 1:28792684-28792706 TGGGTCCCTCCCAAGTAGCTGGG - Intergenic
904370257 1:30043717-30043739 TGACCCCCACCCAAGTAGGATGG + Intergenic
905417166 1:37811937-37811959 TTGGCCCTTCCCAGGCAGGTAGG - Exonic
905559553 1:38915758-38915780 GGGGCCCCATCCAAGCCCGTGGG + Intronic
913081233 1:115389115-115389137 TGGGACCCACCCATCCAGGCAGG + Intergenic
914247456 1:145896741-145896763 TGGGTCCCACCCTAGAAGCTGGG + Intronic
917943636 1:179947710-179947732 TGGGGTCCACTCAAGCTGGTAGG + Intergenic
918320143 1:183356443-183356465 TGGGCACCACCCAGCCAGGTGGG + Intronic
921347310 1:214199627-214199649 TGGGCCCCATCAAAGAAGGAAGG - Intergenic
922720207 1:227896443-227896465 TGGGCCCCTCCCGGGCAGGGCGG - Intergenic
922745369 1:228040071-228040093 GGGGGCCCAGCCAGGCAGGTGGG + Intronic
923407182 1:233673750-233673772 CGGCCCCCACCCTAGCAGGCAGG + Intergenic
1064199475 10:13272433-13272455 TGGGTCCCAGCCACGCATGTTGG + Intergenic
1067495272 10:46755921-46755943 TGGGCCTCACAAAAGCAGTTGGG + Intergenic
1067599382 10:47584467-47584489 TGGGCCTCACAAAAGCAGTTGGG - Intergenic
1067949043 10:50711053-50711075 TGGGCCTCACAAAAGCAGTTGGG - Intergenic
1069710288 10:70483541-70483563 TGGGCCCCAGCCCAGCCTGTTGG - Intronic
1070014419 10:72511880-72511902 TGGGCACCACCCAATCAGCTAGG - Intronic
1070160702 10:73865245-73865267 TGGGCCCCGCCAAAACAGGGAGG - Intronic
1070546700 10:77458216-77458238 ATGGCCCCACCCATGCAGGAGGG + Intronic
1070785714 10:79161098-79161120 TGAGCCCCACCCAACAAGGATGG + Intronic
1070884358 10:79876059-79876081 TGGGCCTCACAAAAGCAGTTGGG - Intergenic
1071650914 10:87392356-87392378 TGGGCCTCACAAAAGCAGTTGGG - Intergenic
1072009013 10:91287422-91287444 TGAGGCTCACCAAAGCAGGTGGG - Intergenic
1072783597 10:98266373-98266395 TGGGCCCCATCAGAGCATGTCGG - Intronic
1073048261 10:100652705-100652727 TGAGCCCCACCCAAGCAAATAGG + Intergenic
1073063293 10:100744766-100744788 TGGGTCCCACCGAGGCAGGTGGG + Intronic
1073901077 10:108221859-108221881 GGTGCCCCACGCAAGCAGGCTGG + Intergenic
1074532930 10:114309437-114309459 GGGTCCCCACCCCAGCAGGGAGG - Intronic
1074978413 10:118599576-118599598 TGGGCCACTCCCAAGCAAGACGG + Intergenic
1076593993 10:131613763-131613785 TGGCCCACACACAGGCAGGTGGG + Intergenic
1078424700 11:11239521-11239543 TGGGCCCCATCTAATCAGTTGGG - Intergenic
1079756492 11:24271090-24271112 TGGGCACCATCCAATCAGCTGGG - Intergenic
1079849440 11:25512291-25512313 TGGGCACCATCCAATCAGTTGGG + Intergenic
1080722059 11:34859486-34859508 TTGGCTCCACACCAGCAGGTGGG - Intronic
1081672552 11:44950072-44950094 AGGCCCCCACCCCAGAAGGTCGG + Exonic
1081776838 11:45681516-45681538 TGGGCCCCACCCCAGGTGGAGGG + Intergenic
1081813571 11:45926624-45926646 TGGGTCCCACCAAAGCAGAGAGG - Intronic
1081911278 11:46701352-46701374 AGGGAGCCACCCAAGAAGGTGGG - Intronic
1083150640 11:60789872-60789894 TGGGCACCACCACAGGAGGTAGG + Intronic
1083253156 11:61481354-61481376 TGGCCCCCACCCAAGAAGTCAGG - Intronic
1083677151 11:64332513-64332535 TGGGCCCCAGCCAGGCCGCTGGG + Intergenic
1087541645 11:99529171-99529193 TGGGCACCATCCAATCAGCTGGG - Intronic
1089865357 11:121626810-121626832 TGGCCCCTACCCCAGCAGGATGG + Intronic
1090825309 11:130380952-130380974 TGAGCCCCACCCAGGCTGATGGG + Intergenic
1094843796 12:34352746-34352768 TGGGCCCCACGCATGCACGGTGG + Intergenic
1094845170 12:34358352-34358374 TGGGCCCCACCCATGCGCGGCGG + Intergenic
1094845545 12:34359852-34359874 TGGGCCCCACACATGCACGGTGG + Intergenic
1094848598 12:34372378-34372400 TGGGCCCCACGCATGCATGGTGG + Intergenic
1094849885 12:34377617-34377639 TGGGCCCCACGCATGCATGGCGG + Intergenic
1094856676 12:34405967-34405989 TGGGCCCCACTCATGCATGCTGG - Intergenic
1096221537 12:49832039-49832061 TGAGCCCCTACCAAGCAGCTGGG + Intergenic
1096623065 12:52876559-52876581 GGGGCCCCACTCAAGCAGGCTGG - Intergenic
1101169936 12:102081013-102081035 TGGGCCCCATCCAGGCAGTCTGG - Intronic
1101724011 12:107374546-107374568 GTGGCCCCACCCAACCAGCTGGG + Intronic
1105409724 13:20161376-20161398 TGGGCGCCCCGCAAGCGGGTCGG - Intergenic
1114645518 14:24254024-24254046 CAGGACCCAACCAAGCAGGTTGG - Intronic
1117461126 14:55945731-55945753 TGGGCTCCACCCAATCTGCTGGG - Intergenic
1121048240 14:90803385-90803407 TGGAGCCCAACCAAGCAGGCTGG + Intronic
1122272925 14:100576387-100576409 TGGGCGCAACCCCAGGAGGTCGG - Intronic
1122695617 14:103550745-103550767 TGGGCCCCTCCCAGGCCGCTGGG - Intergenic
1129161548 15:73750914-73750936 TGTGCCAAACCCAAGAAGGTTGG + Intronic
1129737065 15:77972412-77972434 TGGGCCCCACCCAAGCAGGTTGG + Intergenic
1129849016 15:78781223-78781245 TGGGCCCCACCCAAGCAGGTTGG - Intronic
1132636060 16:947320-947342 AGGGCCCCACCCACCCAGTTGGG + Intronic
1132732705 16:1370617-1370639 TGGGCCCCCCCCAAAGAGGCCGG + Intronic
1133810191 16:9155491-9155513 TAGGGCCCACCCAATTAGGTTGG - Intergenic
1137274368 16:46923801-46923823 TGGGCCCCACCAATGCATCTGGG - Intronic
1138454490 16:57113555-57113577 TGGGACCCACCCAGGAAGATGGG - Intronic
1138563087 16:57813710-57813732 CGGGCACCACTCATGCAGGTGGG + Intronic
1138612952 16:58141937-58141959 TGGGCCCCTTCCAAGCACTTGGG - Intergenic
1140278140 16:73529455-73529477 TGGCACCCACCCAGGCAGGGAGG + Intergenic
1203093258 16_KI270728v1_random:1229911-1229933 TGGGCTTCCCCCGAGCAGGTGGG + Intergenic
1142666040 17:1464411-1464433 CGGGCCCCACTCAAGGATGTAGG - Exonic
1144157224 17:12517607-12517629 CAGGCCCCACCCCAGAAGGTGGG + Intergenic
1145993121 17:29091034-29091056 TGGGACCCACCCCAGCAGGCAGG - Intronic
1146020571 17:29275134-29275156 TCAGCCCCCCCCAAGCAGCTGGG + Intronic
1146665475 17:34699773-34699795 TGGGGCCATCCCAAGCTGGTGGG - Intergenic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1148368145 17:47072163-47072185 TTGGCCCCACCCCAGCAACTTGG - Intergenic
1151708439 17:75785119-75785141 TGGGACCGGCCCCAGCAGGTTGG - Intronic
1152008777 17:77698017-77698039 TGGACCCAGCCCAAGCAGCTGGG + Intergenic
1152258606 17:79254613-79254635 TAAGACCAACCCAAGCAGGTGGG - Intronic
1152361342 17:79834523-79834545 CGGGTCCCAGGCAAGCAGGTCGG + Exonic
1154124333 18:11676229-11676251 AGGGCACCACCCATCCAGGTGGG + Intergenic
1154387979 18:13912686-13912708 TGGGCCCTAGCAAAGCAGTTGGG - Intronic
1156375461 18:36511492-36511514 TGGGCCCCACCCCAGAAATTTGG + Intronic
1156468226 18:37361621-37361643 TGGGCCCCACCCAAGTGTGGAGG + Intronic
1157897583 18:51483626-51483648 AGGTCCTCACCCAAGCAGGTGGG + Intergenic
1158451452 18:57569681-57569703 TGGGGCACACCCCAGCAGTTTGG - Intronic
1159892041 18:73962118-73962140 TTGGCCACAGGCAAGCAGGTAGG + Intergenic
1162906302 19:13826021-13826043 TGGGCCACACCTCTGCAGGTGGG + Intronic
1163637937 19:18446042-18446064 TCGCCCCCATCCAAGGAGGTGGG + Intronic
1164942501 19:32262305-32262327 TGGCAGCCTCCCAAGCAGGTGGG - Intergenic
1165311072 19:35029966-35029988 CGGACCTCACCCAAGCAGGCGGG - Intergenic
1167053838 19:47096375-47096397 TGGGCCGCACCCCAGCGGGAAGG - Intronic
1167123234 19:47531599-47531621 TGGGCCCCAGGAAAGCAGGGAGG + Intronic
927916709 2:26941775-26941797 TGGGACCCAGCCAAGCAGGCTGG + Intronic
927922661 2:26985462-26985484 TGGGCCACACCTGAGCAAGTGGG - Intronic
929115562 2:38441175-38441197 TGGGGCCCTCCAAAGCAAGTTGG + Intergenic
929777703 2:44939033-44939055 CGGTCGCCACCCAAGCAGGCGGG + Intergenic
933849229 2:86352370-86352392 TGGGCACCATCCAATCAGCTGGG + Intergenic
936561305 2:113541856-113541878 CGGGCCCCTCTCCAGCAGGTCGG - Intergenic
939917485 2:148065165-148065187 TGAGTACTACCCAAGCAGGTTGG - Intronic
942689611 2:178571622-178571644 TGGGGCCCACCCAAGTATGATGG - Exonic
944757104 2:202774616-202774638 GGGGGCTCAGCCAAGCAGGTGGG + Exonic
946613317 2:221482347-221482369 TGACCACCAACCAAGCAGGTAGG - Exonic
948468041 2:238161533-238161555 TGGGCTCCTACCAAGCAGGTGGG - Intronic
1170218661 20:13918076-13918098 TGGGCCCTAGCCAAGCACGGTGG - Intronic
1170816898 20:19721314-19721336 TGGGCATGACCCAAGGAGGTGGG - Exonic
1172173487 20:32958802-32958824 AGGGCCCCATCCAAGCACTTGGG - Intronic
1172843388 20:37915354-37915376 TGGGCCCCACCCCAGGACCTTGG - Intronic
1173947840 20:46965646-46965668 TGGGCCTGAACCAACCAGGTGGG - Intronic
1175958402 20:62622945-62622967 TGGCCCCAACCCAACCAGTTGGG - Intergenic
1179971670 21:44839232-44839254 TGGTCCCCTCCCACGCTGGTTGG - Intergenic
1180184168 21:46131319-46131341 TGGTGACCACCCAGGCAGGTGGG + Intronic
1180303263 22:11054123-11054145 TGGGACCCACCCCATCAAGTGGG - Intergenic
1181013877 22:20057332-20057354 TGGGCACCACCCTAGCAAATGGG - Intronic
1184543022 22:45142416-45142438 TGATACCCACCCAGGCAGGTGGG - Intergenic
1184652386 22:45925183-45925205 TGGGCCCTAGGCTAGCAGGTGGG + Intronic
1184921021 22:47605977-47605999 AGGGCCCCACCCTCCCAGGTAGG + Intergenic
1185362625 22:50417750-50417772 TGGAGCCCACCCATGCATGTGGG + Intronic
950189441 3:10966447-10966469 TTGGACCCACCCTGGCAGGTGGG + Intergenic
950346278 3:12296471-12296493 TGGGCCCCACTCTATCAGGTGGG - Intronic
950612309 3:14134310-14134332 TGGGCCTGACCCATGAAGGTGGG + Intronic
953434968 3:42871095-42871117 TGGGCCCCTCCCATGCAAGCAGG + Intronic
953884012 3:46705451-46705473 TGGGCTCCACCCAGGCAGATGGG - Intronic
954633481 3:52059142-52059164 TGGGCCCCCACCGGGCAGGTTGG + Intergenic
954693139 3:52406486-52406508 TAGGCCCCACCCCAACAGGCAGG + Intronic
957097688 3:75792256-75792278 TGGGCCCCACCCACTCAGCCTGG + Intergenic
959503780 3:107135960-107135982 TGGGACCCATCCCAGCAGGTTGG + Intergenic
959703128 3:109316624-109316646 GGGGCCACACCCAACCGGGTAGG - Intergenic
962110748 3:132444061-132444083 TGGGCCCCACAGCAGGAGGTAGG + Intronic
962240459 3:133747102-133747124 GGGGCCCCACCTCAGGAGGTCGG - Intronic
964816240 3:160720200-160720222 TGGGCAGCACCCAAGCAGCGAGG + Intergenic
965763285 3:172103856-172103878 TGTGCCTCAACCAAGCAGCTGGG + Intronic
966177034 3:177149656-177149678 TGGGCCATACGAAAGCAGGTAGG - Intronic
967119058 3:186366391-186366413 AGGGCCCCACCCAGGCAAGGGGG - Intergenic
968009824 3:195266803-195266825 TGGGCCCCACCCCAGCCTGTGGG - Intronic
968036426 3:195551893-195551915 CAGGCCCCAACCAAGCAGGAAGG + Intergenic
968501330 4:951570-951592 TGGGCCCTCCCCAAGAAGGGTGG - Intronic
968814099 4:2812768-2812790 TGGGCCCCACCCCAGCAGGCTGG - Intronic
968900159 4:3427153-3427175 TGACACCCACCCAGGCAGGTGGG + Intronic
970768718 4:19584099-19584121 TGGGCTCCACCCAAGGAGCTGGG + Intergenic
975118701 4:70705591-70705613 TCGCCCCCGCCCAAGCACGTGGG - Intronic
975812629 4:78184764-78184786 TGGGCCTGACCTAATCAGGTGGG - Intronic
981353569 4:143761151-143761173 TTGCCTCCACCCATGCAGGTGGG + Intergenic
981389899 4:144177066-144177088 TGGAAACCACCCTAGCAGGTTGG + Intergenic
985322599 4:188731465-188731487 GGGGCCCCCACCAAGCAGGCTGG - Intergenic
986150043 5:5120190-5120212 TGGGTGGCACCCAAGCAGGAGGG - Intergenic
986667565 5:10116701-10116723 TGTGCCCCACACCAGCAGGAGGG - Intergenic
991441737 5:66657844-66657866 TGGACCCCACCCATACAGGTTGG + Intronic
992594284 5:78329987-78330009 TGGGCCCCACCAAATCCTGTAGG - Intergenic
996126716 5:119734293-119734315 TGGGCACCATCCAATCAGCTGGG + Intergenic
996698428 5:126423705-126423727 TGGGACCCATCCAAGGAGGTGGG + Intronic
997768719 5:136532090-136532112 TGGGCACCATCCAATCAGCTAGG + Intergenic
998135801 5:139673928-139673950 TGGCACCCACCCCAGCAGGAGGG + Intronic
998502754 5:142647576-142647598 TGGGTCCCATCTAAACAGGTAGG - Intronic
1000970999 5:167714566-167714588 TGGGCCATACGCTAGCAGGTTGG - Intronic
1003035918 6:2640108-2640130 AGAGCCCCACCCAAGCAGGACGG - Intergenic
1007363496 6:41374320-41374342 TGGGCCGCACCGAAGGCGGTAGG + Intergenic
1007398412 6:41590102-41590124 TGGGCCCCCACCATGCAGGGAGG - Exonic
1007496454 6:42263220-42263242 ATGTCCCCACCCAGGCAGGTGGG + Intronic
1007829663 6:44628819-44628841 TGAACCCCACCCAAGCAAGGAGG + Intergenic
1007896526 6:45367037-45367059 TGGGCCCCACGAAAGAAGGTTGG + Intronic
1013589783 6:111610223-111610245 TGTGCTCCACCCAAGCATGTAGG - Intergenic
1016984509 6:149885015-149885037 TGGGCTCCAACAAAGCAGGCTGG - Intronic
1019209566 6:170394371-170394393 TGGGCCCCAGACAAGGGGGTTGG + Intronic
1022802858 7:33792486-33792508 TGGGCTCCACCAGAGCAGGAGGG - Intergenic
1023999297 7:45180374-45180396 TGGTCCCCACTGAAGCAGGGTGG + Intronic
1024453774 7:49579915-49579937 TGGGTGCCAGCCACGCAGGTCGG - Intergenic
1030191597 7:106816038-106816060 TGGGCACCATCCAATCAGCTGGG + Intergenic
1032161500 7:129514334-129514356 TGGGCCCTACCCTCGCAGGAAGG + Intergenic
1033150214 7:138907792-138907814 TGGGCCCTAACCAAGAAGGTGGG + Intronic
1034936086 7:155201903-155201925 TGGGCCTCTTCCAAGCAGCTGGG + Intergenic
1035428955 7:158803133-158803155 TGGCCCCCACCTATGCTGGTGGG - Intronic
1036294988 8:7528394-7528416 TGAGCCCAACCCCAGTAGGTGGG + Intergenic
1036327576 8:7792597-7792619 TGAGCCCAACCCCAGTAGGTGGG - Intergenic
1036575350 8:10022704-10022726 TGGGCCCCACCTAAGAAGTCTGG + Intergenic
1037614899 8:20510197-20510219 TGGACTCCACCAAAGCAGTTTGG - Intergenic
1038447708 8:27615353-27615375 TGGAACCCAACCAAGCAGGGTGG + Intergenic
1039829490 8:41201590-41201612 TGGGCTCCCCACAAGCATGTGGG - Intergenic
1041272490 8:56122865-56122887 TGGGCCCAACCCAAGCATGGTGG + Intergenic
1041284209 8:56243840-56243862 TGGACCCCACCCAACCCTGTTGG - Intergenic
1042493783 8:69433489-69433511 TGGGACCCATCCCAGCAGGGTGG + Intergenic
1044062844 8:87661280-87661302 TGGGCTCCATCCAATCAGATGGG + Intergenic
1047893051 8:129334186-129334208 TGGACCCAACCAAAGGAGGTTGG + Intergenic
1048289389 8:133168894-133168916 TGTGCCCCACCTGAGCAAGTGGG - Intergenic
1048393049 8:133986243-133986265 TGAGCCCCTCCCAAGTAGCTGGG - Intergenic
1049252399 8:141596317-141596339 TCAGCTCCACCCAAGCAGCTGGG - Intergenic
1049388285 8:142355115-142355137 TGGGCCCCCGCCATGCAGGCAGG + Intronic
1049597190 8:143490153-143490175 TGGGAGCCTCCCCAGCAGGTGGG + Intronic
1049779779 8:144423599-144423621 GGGGAGCCACCCAAGCAGGAAGG + Exonic
1052835464 9:33246748-33246770 TGGGGCCCACCCAAGCAAGCAGG - Intronic
1053118433 9:35525974-35525996 TGGCCACCACCCAAGCAGTTGGG - Intronic
1055326476 9:75135979-75136001 TGGGCCTGACCTAACCAGGTGGG - Intronic
1056718774 9:89055680-89055702 TGGGCTTCTCCCAAGCAGGAGGG + Intronic
1057422565 9:94924158-94924180 TGGGCCACAGCACAGCAGGTGGG + Exonic
1060234168 9:121850635-121850657 TGGGCACCATCCAATCAGCTGGG - Intronic
1060517999 9:124277773-124277795 CAGGCCCCATCCAGGCAGGTCGG + Intronic
1060569519 9:124625653-124625675 TGTGGCCCAGCCAAGCAAGTTGG - Intronic
1061615253 9:131774923-131774945 TGGGCCCCAGGCAAGGAGCTTGG - Intergenic
1062005764 9:134237726-134237748 GGAGCCCCACTCAATCAGGTCGG + Intergenic
1062162738 9:135088752-135088774 GGGGCCCCACCCAAGCCCCTCGG - Intronic
1062605992 9:137349105-137349127 CCGGCCGCACCCAGGCAGGTGGG - Exonic
1190740371 X:53284576-53284598 TTGACCCCACCCAAGCAGGTTGG + Intronic
1194143527 X:90235016-90235038 TGAGCCTCACCCAAACAGGAGGG - Intergenic
1194888416 X:99348039-99348061 TGGGCAGCACCTAAGCAAGTGGG - Intergenic
1195089925 X:101449021-101449043 TGTGCCTCACCCACGCAGCTGGG + Intronic
1196616372 X:117770605-117770627 TGGAACCCAGCCAAGTAGGTGGG - Intergenic
1199575313 X:149307972-149307994 TAGGCCTCACCCAAGCTTGTTGG - Intergenic
1200489280 Y:3804337-3804359 TGAGCCTCACCCAAACAGGAGGG - Intergenic