ID: 1129850602

View in Genome Browser
Species Human (GRCh38)
Location 15:78791496-78791518
Sequence CCTCTCCTGAGCCTCAGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 1, 2: 1, 3: 23, 4: 213}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129850593_1129850602 5 Left 1129850593 15:78791468-78791490 CCTCCGAGGCCCCTTCCCAGAGT 0: 1
1: 0
2: 0
3: 20
4: 252
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850594_1129850602 2 Left 1129850594 15:78791471-78791493 CCGAGGCCCCTTCCCAGAGTTGC 0: 1
1: 0
2: 0
3: 48
4: 357
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850591_1129850602 23 Left 1129850591 15:78791450-78791472 CCTGGAGAGGACAAGAGGCCTCC 0: 1
1: 0
2: 1
3: 26
4: 232
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850595_1129850602 -4 Left 1129850595 15:78791477-78791499 CCCCTTCCCAGAGTTGCAGCCTC 0: 1
1: 0
2: 2
3: 37
4: 342
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850597_1129850602 -6 Left 1129850597 15:78791479-78791501 CCTTCCCAGAGTTGCAGCCTCTC 0: 1
1: 0
2: 2
3: 22
4: 273
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850596_1129850602 -5 Left 1129850596 15:78791478-78791500 CCCTTCCCAGAGTTGCAGCCTCT 0: 1
1: 1
2: 5
3: 32
4: 313
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213
1129850598_1129850602 -10 Left 1129850598 15:78791483-78791505 CCCAGAGTTGCAGCCTCTCCTGA 0: 1
1: 0
2: 1
3: 32
4: 260
Right 1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG 0: 1
1: 1
2: 1
3: 23
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129850602 Original CRISPR CCTCTCCTGAGCCTCAGTTT GGG Intronic
901434062 1:9235274-9235296 CCTCTCCTGGAACTCAGTTCCGG - Intronic
901770669 1:11528970-11528992 CCTCCCCTGAGCCCCAGGCTGGG + Intronic
902133657 1:14285447-14285469 AGGCTCCTGAGCCTCAGTCTTGG - Intergenic
902546417 1:17193378-17193400 CCTGTCCTGAGCCAAAGTGTGGG - Intergenic
902691944 1:18115494-18115516 TCTCCCCTGAGCCTGAGGTTTGG + Intronic
903671293 1:25037290-25037312 CCTCCCCTGAGCCGCACTTGAGG + Intergenic
904310810 1:29628401-29628423 CCTTTCCTGATCCACAGTATGGG - Intergenic
904539406 1:31222691-31222713 CCTCTCCTGAGCTTCAGTTTGGG - Intronic
904922808 1:34021824-34021846 CCACCCCTTAGCCTCAGTTGAGG - Intronic
905387506 1:37614615-37614637 GCTCTCTTGAGCCTCACCTTGGG - Intronic
906101958 1:43269755-43269777 CCACTCCCCAGCCTCAGTCTGGG - Intronic
906129795 1:43449295-43449317 CCTCTCTTGAACCTCAGCTCTGG - Intronic
906516496 1:46442206-46442228 CCTGTCCTGAGCCCATGTTTTGG - Intergenic
906810649 1:48823871-48823893 CCTCTGCTAGGCCTTAGTTTTGG + Intronic
906996826 1:50804897-50804919 CCTCTCCTGAGCCCTAGATCAGG - Intronic
908454583 1:64290691-64290713 ACTGTCCTGAGCCTCACTTCAGG + Intergenic
910114435 1:83716701-83716723 ACTCCCCTGGGCCTCAGCTTTGG - Intergenic
910908120 1:92203741-92203763 CCTCTCGTGATCCATAGTTTCGG - Intergenic
911742825 1:101405922-101405944 TCTCTCTTGAGCCTCAGTTATGG + Intergenic
913158518 1:116124050-116124072 CCTTTCCTGACCCTAGGTTTTGG + Exonic
913569115 1:120102691-120102713 CCTCAGCTATGCCTCAGTTTGGG - Intergenic
914289924 1:146263682-146263704 CCTCAGCTGTGCCTCAGTTTGGG - Intergenic
914550967 1:148714465-148714487 CCTCAGCTGTGCCTCAGTTTGGG - Intergenic
915352041 1:155232908-155232930 GCTCTCCTGAGTCTCTGTGTGGG - Intergenic
916880022 1:169011699-169011721 TCTCTCCTGTCTCTCAGTTTGGG - Intergenic
917675345 1:177313602-177313624 CCTCTGCTGAGCCTCATGTCAGG - Intergenic
918215552 1:182390303-182390325 TTTGTCCTAAGCCTCAGTTTCGG + Intronic
920180521 1:204129463-204129485 CCTCTGCTGAGACACAGTTGCGG + Intergenic
920379338 1:205526699-205526721 CCTCTCCTCAGCCTGTGTCTGGG + Intronic
920569505 1:207005929-207005951 CATCTCCTGAGACTCTGCTTTGG - Intergenic
920755079 1:208721618-208721640 CCTCTGCTCAACCTCAGTTTGGG - Intergenic
921840556 1:219823617-219823639 CCTCTCCTGAGCTCATGTTTAGG - Intronic
1063081434 10:2771115-2771137 CTTCTCCCAAGCCTCGGTTTGGG - Intergenic
1064569312 10:16675833-16675855 ACTTTCCTGGGCCTCAGATTTGG + Intronic
1067859960 10:49835682-49835704 TCTTTCCTGGGCCTCATTTTGGG - Intronic
1068664473 10:59658441-59658463 ACTGTCCTGTGCCTCCGTTTTGG - Intronic
1069868072 10:71516348-71516370 CCTTGCCTGAGCCTCAGTGCTGG + Intronic
1070351089 10:75592687-75592709 GCTCTCCTGTTCCTCAGTCTCGG + Intronic
1070668967 10:78364803-78364825 CCTCCCCTGAGTCTGAGTTTAGG - Intergenic
1072630323 10:97140933-97140955 CCTAGCCTGAGCCTCAGTGTTGG - Intronic
1072801167 10:98393339-98393361 CCTCTCCTGAGCTCCAGCTCCGG + Intronic
1075661837 10:124202681-124202703 CCTCTCCAGAAACTCACTTTTGG - Intergenic
1076570997 10:131432708-131432730 CCCCTCCTCAGCCTCTGTCTGGG - Intergenic
1076793396 10:132787881-132787903 CGCCTCCTGGGCCTCAGTTCGGG - Intergenic
1076864718 10:133160962-133160984 CCGCTCCTGAACCTCAGCTCCGG - Intronic
1077632326 11:3819156-3819178 CCTCGCCTCAGCCTCAGCCTTGG + Intronic
1078375676 11:10791435-10791457 GCTTCTCTGAGCCTCAGTTTGGG + Intergenic
1078509673 11:11976099-11976121 CCTCTCCTGAGCTTAAGTGTGGG + Intronic
1078982554 11:16553153-16553175 CTTCTGCTAAGCCCCAGTTTTGG - Intronic
1080599610 11:33809181-33809203 CTTCTCCTGATCCTCTGGTTTGG - Intergenic
1082870350 11:57938699-57938721 CCTCTCCTGTGCATCAGTAGAGG - Intergenic
1083351746 11:62034460-62034482 CCTCACCAAAGCCTCAGTTAGGG - Intergenic
1083626227 11:64073435-64073457 ACTCCCTTGAGCCTTAGTTTGGG + Intronic
1083815826 11:65132016-65132038 CCTCTCCTGAGCCCCAGGTTGGG + Intronic
1084590431 11:70086869-70086891 CCTCTGCTCAGGCTCTGTTTGGG + Intronic
1085160689 11:74341318-74341340 CCTGGGCTGAGCCCCAGTTTGGG - Intronic
1085799975 11:79580384-79580406 TTTCTCCTGAGCCTCTGCTTTGG - Intergenic
1087003817 11:93448688-93448710 CCTATACTGAATCTCAGTTTGGG + Intergenic
1088363747 11:109017796-109017818 AATCTTCTGAGCCTCAGTTTGGG + Intergenic
1089492407 11:118892293-118892315 CCTCTCAGGAGCCACAGTTGTGG - Intronic
1089543427 11:119205167-119205189 CTAATTCTGAGCCTCAGTTTTGG - Intergenic
1089661109 11:119985936-119985958 CCTCTGCAGAACCTCAGTTTTGG + Intergenic
1091033930 11:132216346-132216368 CCTCACCTGAGTTTCATTTTGGG - Intronic
1093140743 12:15507773-15507795 CCTCTCCTGGATCTCAGCTTAGG + Intronic
1093972365 12:25386497-25386519 CCTCTCAGAAGGCTCAGTTTTGG + Intergenic
1094414223 12:30201181-30201203 CCCCTCCTCAGCCCCATTTTGGG + Intergenic
1095828230 12:46553323-46553345 AGTCTTCTGAGCCCCAGTTTGGG + Intergenic
1097878485 12:64665852-64665874 CCTGGGCTGAGCCCCAGTTTGGG + Intronic
1099325731 12:81212414-81212436 CCTCTACTGAGACACAGTCTAGG + Intronic
1103053801 12:117802791-117802813 TCTCTCCTGAGCCTCACACTTGG - Intronic
1104098246 12:125581152-125581174 CCTTTCTTGAAACTCAGTTTGGG + Intronic
1104291170 12:127470100-127470122 CCTTTTCTGTGCTTCAGTTTTGG - Intergenic
1106206074 13:27595965-27595987 CCTTTTCTGAGCCTCAGTGTTGG - Intronic
1106367744 13:29099414-29099436 GCTCTCCATAGCCTCACTTTCGG + Intronic
1108358539 13:49649459-49649481 CCTCTGCTTAGCCACAGTTCTGG - Intergenic
1109340819 13:61055991-61056013 TCTCTCTGGAGCCTCAGTTCTGG + Intergenic
1112936710 13:104809595-104809617 CCTCTCCTTAGCCTCAGCCTGGG - Intergenic
1113630984 13:111883738-111883760 TCTCTCCTGGGCCTCAGATGGGG - Intergenic
1114259184 14:21025197-21025219 CCTTTCCTGAGCGGCAGTCTGGG - Intronic
1114556868 14:23567240-23567262 CCGCTCCTGGGCCTGAGTCTTGG + Exonic
1121235497 14:92388838-92388860 TGTCTCCTGGGCCCCAGTTTTGG - Intronic
1122717844 14:103706114-103706136 GGTCTCCTGAGCCTCCGTGTCGG - Intronic
1122771778 14:104100906-104100928 CCACTCCTGAGCCCCAGATAAGG - Intronic
1124354212 15:28983409-28983431 CCTGTTCTGATACTCAGTTTTGG + Intronic
1128513329 15:68326907-68326929 CCTCTCACGAGCCCCAGTGTGGG + Intronic
1129850602 15:78791496-78791518 CCTCTCCTGAGCCTCAGTTTGGG + Intronic
1130969153 15:88718632-88718654 GGCTTCCTGAGCCTCAGTTTTGG - Intergenic
1132711885 16:1272515-1272537 CCTCACCTGACCCTCACCTTGGG + Intergenic
1133155047 16:3868368-3868390 CCCCTCCTGAGCCCCGTTTTTGG - Intronic
1133434899 16:5770688-5770710 CCTGGGCTAAGCCTCAGTTTTGG + Intergenic
1134202707 16:12212089-12212111 CCTCTCCTGGGCCTCGGTGGTGG + Intronic
1136428824 16:30185666-30185688 GCCCTCCTGAGCCTCAGCCTGGG + Intronic
1137733620 16:50708403-50708425 CCCCTCCTGTTCCTGAGTTTGGG - Intronic
1141850341 16:86640770-86640792 TCTCTCCTGAGCCCCTGTCTTGG + Intergenic
1142981668 17:3675986-3676008 CCTCTCCAAAGCCTCAGTGGAGG + Intronic
1147884014 17:43672446-43672468 CCTCTCCTGGGGCTCAGTCAAGG - Intergenic
1154150496 18:11902802-11902824 CCTGCCCTGAGCCTCACTTTGGG - Intronic
1154317920 18:13320671-13320693 CCTGTGCTGAGCCTCACTGTTGG - Intronic
1156645936 18:39162341-39162363 CCTGGCCTAAGCCCCAGTTTTGG - Intergenic
1157522328 18:48353861-48353883 CCCCTCCTGGGCCTCAGTCTTGG - Intronic
1161590281 19:5126391-5126413 CCTCTCCTGAGCCTCCGGGGAGG + Intronic
1162392502 19:10398003-10398025 CCTCTCCTGAACCTCAGTGGAGG + Intronic
1163633140 19:18427085-18427107 CCTCTCTGGAGTCTCAGTGTTGG + Intronic
1163796735 19:19342271-19342293 CCTCTCCTGGGCCTTGGTGTTGG + Intronic
1164802881 19:31092254-31092276 GCCTTCCTGAGGCTCAGTTTTGG + Intergenic
1165313741 19:35042531-35042553 CCTTCCCTGAGCCCCAGCTTTGG + Intronic
1167557417 19:50205008-50205030 TCTGTCCTGAGCTTCAGTCTCGG - Intronic
1167607142 19:50487546-50487568 CCACTCCTGGGCCTCAGGCTTGG + Exonic
925068069 2:944936-944958 CCTAGGCTGAGCCCCAGTTTTGG - Intergenic
926631599 2:15141560-15141582 TCTTTCCTCAGCTTCAGTTTAGG - Intergenic
926861364 2:17313113-17313135 TCTCTACTCAGTCTCAGTTTTGG - Intergenic
927471683 2:23382378-23382400 CCTGTCCTGAGCCCCAATCTGGG - Intergenic
927614682 2:24581011-24581033 CCTCTCTTGACACTCAATTTAGG + Intronic
927826571 2:26313612-26313634 CCTCACCTGAGCCTCTCCTTGGG + Intronic
931654889 2:64502020-64502042 GCTCTTCTGTGCCTTAGTTTGGG - Intergenic
935380171 2:102443797-102443819 CCTCCTCTGAGCCTCTTTTTCGG - Intronic
936957882 2:118041347-118041369 CCTCTACTAATCTTCAGTTTGGG + Intergenic
937302924 2:120854212-120854234 CCTCTTCTGAGACTCAGCTCAGG - Intronic
939579031 2:143926413-143926435 CCTTTCCTGACTCTCAGATTGGG + Intergenic
939690922 2:145259176-145259198 CCTCTCCTAGGCCTTTGTTTGGG + Intergenic
941577960 2:167258935-167258957 CCTCTGCTGAGGCTTGGTTTTGG - Exonic
942132763 2:172897308-172897330 ACTCTCCTGAGACTCAGATTTGG + Intronic
942718412 2:178921366-178921388 ACTTTTCTGAGCATCAGTTTTGG + Intronic
943456257 2:188111171-188111193 CCTCTCTTGCGCCTCAGTTATGG + Intergenic
943829073 2:192435778-192435800 CCCCTCCTGAACCCCAATTTTGG - Intergenic
948244966 2:236473309-236473331 CCTCTCCCGAGACTCTGTTTGGG - Intronic
1172502636 20:35437779-35437801 CCTCTCCTTGGCCTCTGCTTTGG + Exonic
1173069215 20:39745279-39745301 CCCCTCCTCAGGCTTAGTTTTGG + Intergenic
1174159991 20:48543659-48543681 CCTCTTCTGACCCTCCATTTAGG - Intergenic
1174463716 20:50701105-50701127 CCCATCCTGAGCCTCATTTCAGG + Intergenic
1174635097 20:51992568-51992590 CCTCTCAGTAGCATCAGTTTAGG - Intergenic
1175370126 20:58482750-58482772 TCCCTTCTGAGCCTCCGTTTTGG - Intronic
1175636537 20:60589094-60589116 CCTCTCATGAGCATCAGTGGAGG + Intergenic
1177041830 21:16121971-16121993 CCTCTCTTGAGCTTCCGTTTGGG + Intergenic
1177470039 21:21548658-21548680 CCTCTACTAAGACCCAGTTTTGG + Intergenic
1178752235 21:35315912-35315934 CTTTCCCTGAGCCTCAGTCTTGG - Intronic
1179233620 21:39526725-39526747 CTTTTCCTCAGCCTAAGTTTGGG + Intergenic
1181690021 22:24554200-24554222 CCTTTCCTGAGCCTCAGAGGAGG - Intronic
1182075243 22:27491015-27491037 CCCCCTCTGCGCCTCAGTTTTGG + Intergenic
1182090535 22:27591589-27591611 GCTGTCCTGAGCCTCAGAGTGGG + Intergenic
1182274384 22:29177010-29177032 CCTCTCCTCAGTCTCAGCTGGGG - Intergenic
1182355931 22:29722212-29722234 CCTCTCCTGATCCCCAGTCCTGG + Intronic
1182477009 22:30581847-30581869 CCTATCCAGAGCCTCACTTGTGG - Intronic
1183401200 22:37605673-37605695 CCTACCCTGATCCCCAGTTTGGG + Intergenic
1183722423 22:39570482-39570504 CCCTGGCTGAGCCTCAGTTTTGG - Intergenic
1184248373 22:43246933-43246955 CCTCTCCAGAGCTTCAGCCTGGG + Intronic
1184557169 22:45239879-45239901 CTTCTCCTGGGCTTCAGTCTGGG + Intronic
1184892394 22:47388041-47388063 TCTCTGCTGAGCCTCAGGTGTGG + Intergenic
949738955 3:7207676-7207698 TCTCTCCTGGGCTTCAGCTTAGG + Intronic
950131740 3:10552067-10552089 CCTATCCTGGGGCCCAGTTTTGG + Intronic
950817560 3:15722294-15722316 GCTCACCTGAGCTTCATTTTCGG - Intronic
953272072 3:41455571-41455593 CCTCTCCTGAGCCAGACTTCTGG + Exonic
955513321 3:59703014-59703036 CCTCTCCTAACCTTCAGTGTGGG + Intergenic
955773103 3:62405799-62405821 CATCTCCTGAGCATAAGGTTTGG - Intronic
955803877 3:62713704-62713726 CCTGGGCTAAGCCTCAGTTTTGG + Intronic
959539433 3:107523341-107523363 CCTCTCCCGACCCAAAGTTTTGG - Intronic
959610922 3:108294166-108294188 TCTCCCCTGAGCCTTAGTGTAGG + Intergenic
960061610 3:113328621-113328643 TCTCTCCTCAGCCCCAGTCTGGG - Intronic
961655014 3:128436318-128436340 CCTCTCCTGGGCTGCAGCTTGGG + Intergenic
962319211 3:134376993-134377015 CCTCTCCTTAGCCCCGGTCTGGG + Intergenic
962800511 3:138886614-138886636 TCTCCCCTTTGCCTCAGTTTGGG + Intergenic
966690279 3:182734494-182734516 CCTCTCCTGAGCCACAGGTGAGG + Intergenic
969472722 4:7399148-7399170 CCTGTCCTCACCCTCTGTTTTGG + Intronic
969703849 4:8781654-8781676 CCTCTCCTGGGGTTCAGTTGGGG - Intergenic
969948700 4:10811610-10811632 CCTTTCCTGATGCCCAGTTTAGG - Intergenic
979155202 4:117378214-117378236 CCTTTCCTGAGCCTAATTTCGGG - Intergenic
979187204 4:117811769-117811791 CTACTCCACAGCCTCAGTTTAGG + Intergenic
980781185 4:137494487-137494509 CCTCACTTGAGCCTCAGCTGAGG - Intergenic
980831989 4:138141286-138141308 CCTCTCCTTAGGGACAGTTTTGG - Intergenic
980958767 4:139454160-139454182 CCTTTCCTCCGCCTCAGTTTGGG + Exonic
981329804 4:143495506-143495528 CCTCTCCTCAGCCTGAAGTTTGG - Intergenic
984282497 4:177688367-177688389 CCTCTACTGAACTTCAGTGTTGG + Intergenic
985484445 5:140670-140692 CCTCTACTGGGACACAGTTTGGG - Exonic
986818421 5:11438049-11438071 ACTCTCATCAGCATCAGTTTAGG - Intronic
988342598 5:29993393-29993415 CCTCTCCTGAGGTTCAGATCAGG - Intergenic
989073588 5:37538230-37538252 CCTCTCCTGCCTCTCATTTTGGG + Intronic
989280647 5:39639087-39639109 CCTATTCTGAACCTCAATTTGGG + Intergenic
989398474 5:40983832-40983854 CCTTTCCTGTGCCTCAGATCAGG + Intergenic
989641154 5:43584647-43584669 CCTGGGCTGAGCCCCAGTTTTGG + Intergenic
989760719 5:45012989-45013011 CCTCCCCAGAGCATCAGTTTTGG + Intergenic
992557526 5:77917687-77917709 CGTCTCCTGGGCCTGTGTTTTGG + Intergenic
997392662 5:133529703-133529725 CATTTGCTGAGCCTCTGTTTAGG - Intronic
997640682 5:135446912-135446934 CCTCTCCAGGGCCTCAGTGAGGG - Exonic
998891111 5:146746877-146746899 GCCTTCCTGAGCCTCAGTTTTGG - Intronic
1001136841 5:169109653-169109675 ACTCTCATGAGACTAAGTTTAGG + Intronic
1005836723 6:29714867-29714889 CCTCTCCTGTCCCTCACTTGGGG + Intergenic
1007421287 6:41721134-41721156 CCTCTGCTGACCCACAGTCTTGG + Intronic
1011388217 6:86820905-86820927 CCCCTTCTTAACCTCAGTTTAGG - Intergenic
1011497754 6:87953057-87953079 CCTTTCCTGAGCATCTGCTTTGG - Intergenic
1012542378 6:100376282-100376304 CCTCCCCTGAGCCTGAGTCGAGG + Intergenic
1013220555 6:108074209-108074231 ACTCTCCTGAGCCACAGTCCCGG + Intronic
1013318566 6:108964430-108964452 CCCCTCTTTAGCCTCAGCTTAGG - Intronic
1015875253 6:137816122-137816144 GCTTTCCTGAGCCTCAGCTGTGG - Intergenic
1016842819 6:148541626-148541648 CCTGTCCTTAGCCCTAGTTTTGG - Intronic
1018661148 6:166088371-166088393 CCCCTCCTGAGCCTCAGCCAGGG + Intergenic
1018793498 6:167168635-167168657 CCCCTCCTGAGCCTCAGCCGGGG - Intronic
1018823217 6:167389743-167389765 CCCCTCCTGAGCCTCAGCCGGGG + Intergenic
1018855239 6:167670041-167670063 CCTCACCTGAGCCTCTCTTATGG - Intergenic
1019263176 7:93754-93776 CCTCTCCTGAGTGTGAATTTCGG - Intergenic
1020677990 7:11202982-11203004 CCTCTCCTGTGCTTCCCTTTCGG + Intergenic
1022598869 7:31738057-31738079 CCTCTCCTGTGCCCCAGTGCTGG + Intergenic
1023041470 7:36176386-36176408 CTACCCCTGAGCCTCATTTTAGG + Intronic
1023956597 7:44891644-44891666 CCTCTCCTCAGCCTCAGAGCTGG - Intergenic
1026677899 7:72443591-72443613 CCTCTGTTGGGACTCAGTTTGGG + Intronic
1027267217 7:76501070-76501092 CCTCTACTGAGCCACGTTTTGGG + Intronic
1027319028 7:77000938-77000960 CCTCTGCTGAGCCACGTTTTGGG + Intergenic
1034676522 7:152896260-152896282 CCTTTCCTGAGCCTCTGTGCTGG - Intergenic
1034783422 7:153903091-153903113 AGTCTCCTGATCCTCAATTTTGG - Intronic
1040355766 8:46617168-46617190 CCAGTCCAGAGCCTCTGTTTCGG - Intergenic
1040482921 8:47842451-47842473 GCTCTCCTGAGGCTCTGTATAGG - Intronic
1042008164 8:64206177-64206199 GCTCTCCTGAGACGAAGTTTTGG + Intergenic
1043837278 8:85062321-85062343 CCTGGGCTGAGCCTCAATTTTGG - Intergenic
1046753329 8:117947536-117947558 AATCTCCTGAGGCTCACTTTAGG + Intronic
1048914437 8:139168204-139168226 TTTCTCCTGAGTCTCAGTTTTGG - Intergenic
1048940688 8:139398040-139398062 CATCTTCTCAGACTCAGTTTGGG + Intergenic
1049271631 8:141699150-141699172 CCTCTCCTGTGGCTCACATTAGG + Intergenic
1049311066 8:141934152-141934174 CATGTCCTGGGCCTGAGTTTGGG + Intergenic
1051739668 9:20239395-20239417 CCTGACCAGAGCCTCAGTTGTGG - Intergenic
1054945420 9:70791262-70791284 GCTTTCCTGAGCATCAATTTAGG - Intronic
1056280938 9:85040758-85040780 CCCCTCCTCAGCCTCAGCCTTGG + Intergenic
1056595726 9:88006612-88006634 CTTCTTCTGAGCCTGAGTCTGGG - Intergenic
1057482450 9:95456087-95456109 CCTCTCCTTAGCCTCCCTTGAGG + Intronic
1059769605 9:117413915-117413937 CCTTCTCTGAGCCTCAGTTCTGG - Intronic
1061352857 9:130079464-130079486 ACGTTTCTGAGCCTCAGTTTTGG + Intronic
1061764651 9:132874121-132874143 CCTTTTCTGAGCCTCTGGTTAGG - Intronic
1062333540 9:136055076-136055098 CCTCTGCAGAGCCTCACTTGAGG + Intronic
1187073594 X:15912419-15912441 CCTCAACTTAGGCTCAGTTTGGG + Intergenic
1190120726 X:47657372-47657394 CCTTCCCAGAGCCTCAATTTGGG - Intronic
1192313837 X:70036931-70036953 CTTCTCCTGAGCCTGGCTTTAGG - Exonic
1196160423 X:112476662-112476684 CCTGCCATGAGCTTCAGTTTTGG + Intergenic
1196425127 X:115561789-115561811 CCTCTCCAGAGCCCCAGGGTCGG - Intronic
1197190693 X:123644484-123644506 GCTTGTCTGAGCCTCAGTTTTGG - Intronic
1197271979 X:124434598-124434620 CCTCTCTGAAGCCTCAATTTTGG + Intronic
1198167284 X:134070473-134070495 CCTACCCTCAGCCTGAGTTTGGG + Intergenic
1198414425 X:136405497-136405519 AATCTCCTGAGCCCCAGTTCAGG - Intronic
1199205890 X:145147651-145147673 CCTCTCCTGTTCATCAATTTGGG + Intergenic
1201585855 Y:15560348-15560370 ACTCTCTTGAGCCTCAGAGTTGG + Intergenic
1201852213 Y:18497792-18497814 CTTGTTCTGAGCCTCAGTGTAGG - Intergenic
1201881108 Y:18822592-18822614 CTTGTTCTGAGCCTCAGTGTAGG + Intronic