ID: 1129852820

View in Genome Browser
Species Human (GRCh38)
Location 15:78804301-78804323
Sequence TCTCATGTGCCGGGGGTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129852812_1129852820 -1 Left 1129852812 15:78804279-78804301 CCAGTTCTAGTCTCAAGAGAAAT 0: 1
1: 0
2: 2
3: 6
4: 164
Right 1129852820 15:78804301-78804323 TCTCATGTGCCGGGGGTTGGGGG 0: 1
1: 0
2: 2
3: 15
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129852820 Original CRISPR TCTCATGTGCCGGGGGTTGG GGG Intronic
900415134 1:2531318-2531340 TCCCATGGACCGGTGGTTGGGGG - Intergenic
900625848 1:3608186-3608208 TCTCAAGGCCCTGGGGTTGGGGG + Intronic
901652948 1:10753470-10753492 GCTCATTTGCTGGGGCTTGGTGG + Intronic
903482989 1:23668160-23668182 ACTCAAGAGCCGGGGGTGGGAGG + Intergenic
903742684 1:25567443-25567465 TCTCCTGTGCTGGGGGGTGGGGG - Exonic
905019036 1:34795769-34795791 CATGATGTGCTGGGGGTTGGGGG + Intronic
905308220 1:37033418-37033440 TGCCATGGGGCGGGGGTTGGGGG - Intronic
906661914 1:47589022-47589044 TGTCCTTTGCCGGGGGGTGGTGG - Intergenic
906962429 1:50426698-50426720 TCTGCTGTGCCAGGGGCTGGGGG + Intergenic
907288179 1:53395625-53395647 CCTCAGGGGCCGGGGGTTGGGGG - Intergenic
909759635 1:79271487-79271509 TGTGCTGTGCTGGGGGTTGGGGG - Intergenic
912735426 1:112145865-112145887 TTTCTTGTGGCGGGGGTTGGGGG - Intergenic
913193542 1:116433574-116433596 TCTCCTGGGGCGGGGGTTGAAGG + Intergenic
914804691 1:150983440-150983462 TCTCAAGTGCCGGGGGAAAGGGG - Intronic
916436458 1:164782187-164782209 GCTCATGGGCCGGGGGATGGGGG + Intronic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1065412172 10:25441497-25441519 TCTCATGTGCTTGGGTTGGGTGG + Intronic
1067785094 10:49240057-49240079 TCTCAGCTGCCGAGGGTTTGAGG + Intergenic
1070131038 10:73655725-73655747 TGGCATATGGCGGGGGTTGGGGG - Intronic
1071737903 10:88322412-88322434 CCCCATGTGTCGGGGGTTGGGGG + Intronic
1077358189 11:2128224-2128246 TCTCCTGTGCCGGGCACTGGAGG - Intergenic
1078575067 11:12494319-12494341 TCTCATGGGTCGGGGGTATGAGG + Intronic
1078582378 11:12548389-12548411 TCTCATGTCCCTGAGGTGGGAGG + Intergenic
1081830389 11:46106481-46106503 TCTGAGGTGTTGGGGGTTGGGGG + Intronic
1082734342 11:56839284-56839306 TTTCCTGGGCGGGGGGTTGGGGG - Intergenic
1083000946 11:59290038-59290060 TCCCATTTGCCTGGGGGTGGAGG + Intergenic
1083149851 11:60785209-60785231 TTTCACCTGCCGGGGTTTGGCGG + Intergenic
1084010429 11:66345335-66345357 TCTCCTGAGCTGGGGGTGGGGGG - Intergenic
1085544102 11:77301297-77301319 TCTCATGAGCTGGGGAATGGCGG - Intronic
1085713733 11:78853662-78853684 TCTCATTGGCCAGGGGTTGTTGG + Intronic
1087020529 11:93598322-93598344 TTTCCTCTGCTGGGGGTTGGTGG + Intergenic
1088933263 11:114373637-114373659 TCTCATGTGCCTGGAGCTGAGGG - Intergenic
1091745757 12:2991981-2992003 TTTCCTGTGGTGGGGGTTGGGGG + Intronic
1093013184 12:14129711-14129733 TCTCTTGTGCGTGGGGGTGGGGG - Intergenic
1095482773 12:42652810-42652832 ACTCCTGTGCTGGGGGTTGCTGG - Intergenic
1096669784 12:53191758-53191780 TTACATGTGCCAGGGGCTGGGGG + Exonic
1097303138 12:58039837-58039859 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1097823016 12:64146539-64146561 TCTCTTGAGGCGGGGGTTAGAGG + Exonic
1098382813 12:69886683-69886705 TGTCATGTGCTGGGGGTAGGAGG - Intronic
1099524821 12:83706078-83706100 TCTCTTGTGCCTGGGGTGGGTGG + Intergenic
1101301131 12:103483807-103483829 TGTCATGTGGTGGGGGCTGGGGG - Intronic
1101481734 12:105104680-105104702 ACTCATGTCACGGGGGTTTGTGG + Intergenic
1101836875 12:108302128-108302150 TGTCATATGCCTGGGTTTGGGGG - Intronic
1101838400 12:108310951-108310973 TCTCCTGGGCGGGGGGTGGGGGG - Intronic
1102792147 12:115656109-115656131 TCTTTTTTGCAGGGGGTTGGGGG + Intergenic
1104776388 12:131392471-131392493 TCTCAGGTGCCAGGGCATGGGGG + Intergenic
1105804625 13:23945964-23945986 GCTCAGGAGCCGGTGGTTGGGGG - Intergenic
1107116578 13:36753731-36753753 TGTCATGGGTCGGGGGTTGCAGG - Intergenic
1112706208 13:102071955-102071977 TTTTATATGCTGGGGGTTGGAGG - Intronic
1114619175 14:24084736-24084758 TCTTATTGGCCTGGGGTTGGGGG + Intronic
1114850236 14:26374493-26374515 TCTCATGTGGCGGGGGTGGGCGG - Intergenic
1115916875 14:38325250-38325272 TTTCTTGTGTAGGGGGTTGGAGG + Intergenic
1116921900 14:50587517-50587539 TCTCAGGAGGCGGGGGTGGGAGG - Intronic
1118260186 14:64239155-64239177 CCTCATGTGCTGGGGGCAGGAGG - Intronic
1118901167 14:69987117-69987139 TCACATGTGGAGGGGGATGGTGG + Intronic
1119089203 14:71764853-71764875 TCACAGGTGCTGGGGGCTGGGGG + Intergenic
1121376064 14:93411563-93411585 TCTCAGCTGCCTGGGGCTGGAGG - Intronic
1121382325 14:93483685-93483707 TCTCATGTGTCGTGGGGTTGGGG - Intronic
1121784918 14:96650076-96650098 TCTCTTGTGCCTAGGGTTGTAGG + Intergenic
1122875149 14:104660484-104660506 TCCCAAGTGCAGGGGGGTGGGGG - Intergenic
1202906153 14_GL000194v1_random:73391-73413 GCTCAAGAGCCGGAGGTTGGGGG + Intergenic
1124615231 15:31236748-31236770 TCCCTTATGCTGGGGGTTGGGGG - Intergenic
1127414812 15:58748560-58748582 TTTCATGTGCAGGGGGGAGGGGG + Intronic
1128229126 15:66022743-66022765 TCACTTGAGCCTGGGGTTGGGGG + Intronic
1128234314 15:66057165-66057187 TCTCAGGAGCAGGGAGTTGGGGG - Intronic
1129852820 15:78804301-78804323 TCTCATGTGCCGGGGGTTGGGGG + Intronic
1132056080 15:98650505-98650527 TCTCCCGGGCCGGGGGATGGAGG + Intronic
1132622402 16:874054-874076 TCTCCTTTGCCGGGTGTGGGGGG + Intronic
1133583521 16:7169375-7169397 TGTTATGGGCCAGGGGTTGGGGG + Intronic
1133952594 16:10409105-10409127 TCCCATGGGCGGGGGGTAGGCGG + Intronic
1133997828 16:10761798-10761820 GCTCATGTGCCAGGACTTGGAGG + Exonic
1135946163 16:26866831-26866853 TCAAATGTTGCGGGGGTTGGGGG - Intergenic
1137972509 16:53000153-53000175 TGTCATGGGGTGGGGGTTGGGGG + Intergenic
1138383463 16:56619629-56619651 TGTCAGGGGTCGGGGGTTGGGGG - Intergenic
1140712376 16:77690509-77690531 TCTCATGTGGCGGGAGCAGGAGG + Intergenic
1140888810 16:79267916-79267938 TCTCAGGTGCCTGGGGGTGTGGG + Intergenic
1141138106 16:81479793-81479815 TTTCAAGAGCCGGGGGTAGGGGG - Intronic
1141285513 16:82668195-82668217 TCTTAGGTGCCAGGGTTTGGTGG - Intronic
1141717717 16:85736298-85736320 CCTCATGTGCAGGCTGTTGGTGG + Intronic
1143045529 17:4075817-4075839 TCTTTTGAGCGGGGGGTTGGGGG + Intronic
1143639599 17:8188633-8188655 TCTCAGGTGCCAGGGGCTGTGGG - Exonic
1143868115 17:9938786-9938808 TGTCATTTGCCAGGGGCTGGGGG - Intronic
1144863656 17:18321316-18321338 TCTGATGTGCCAGGCATTGGGGG + Intronic
1144958448 17:19031496-19031518 ATTCATGGGCCGGGGGTGGGGGG + Intronic
1146139433 17:30352470-30352492 TCTCAGCTACTGGGGGTTGGGGG - Intergenic
1146976072 17:37113111-37113133 CTCCATGTGCCGGGGGTTGATGG + Exonic
1147183577 17:38702117-38702139 TCGCAGGTGCCAGGGGTCGGGGG - Intergenic
1147326882 17:39673862-39673884 GCTGATGTGTTGGGGGTTGGGGG + Intronic
1148379516 17:47184750-47184772 TCTCTTGTGCCGGGATTGGGGGG + Intronic
1149577869 17:57726907-57726929 TCTCCTGAGCCTGGGGTTTGGGG + Intergenic
1149608243 17:57939939-57939961 TCCCAAGTGCCGGGGGTGTGTGG - Intronic
1149620276 17:58039679-58039701 GCTCATGTGCCTGAGGCTGGTGG + Intergenic
1149806355 17:59620695-59620717 TCTCCGGTGGTGGGGGTTGGGGG + Intronic
1152183486 17:78840188-78840210 TCTCGTGTGTCTGGGTTTGGCGG + Intronic
1154184117 18:12166869-12166891 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1159346440 18:67212776-67212798 ACTCATGTCACGGGGGTTTGTGG + Intergenic
1160028873 18:75241463-75241485 AGTCACGGGCCGGGGGTTGGCGG + Intronic
1160106389 18:75982337-75982359 TCTCATGTGCCTGAGGAAGGCGG - Intergenic
1160560960 18:79755529-79755551 AGTAATGTGCCGGGGGGTGGGGG + Exonic
1161284804 19:3463629-3463651 CCTCCTATGCCGGGGGTGGGGGG - Intronic
1161465560 19:4428453-4428475 TCTCAAGGGCCGGCGGTGGGGGG - Intronic
1161983021 19:7639648-7639670 TCTCAGGTGTGGGGGGTTGGAGG - Intronic
1161999226 19:7732371-7732393 TCTTATGGGCCTGGGGCTGGAGG + Intronic
1164851748 19:31489895-31489917 TCTCATTTGCTGGGGGTGGAGGG + Intergenic
1164890748 19:31821210-31821232 TCTCAAGTACTGGGGGTTAGAGG + Intergenic
1165170324 19:33887701-33887723 TCTCAGCTGGTGGGGGTTGGGGG - Intergenic
1167579693 19:50334179-50334201 TTTCTTGTCCCCGGGGTTGGGGG - Intronic
1168110411 19:54188992-54189014 TCACAAGGGCCGGGGGATGGGGG - Intronic
925599374 2:5591934-5591956 TGTCATGTGTGGGGGGTTGGTGG + Intergenic
927563911 2:24094194-24094216 TCTCATGTGCCTGGGACTGCAGG + Intronic
929873621 2:45778141-45778163 TCCCAAGTCCCTGGGGTTGGTGG + Intronic
931357361 2:61548876-61548898 TGTCATGAGCCCGGGGATGGTGG - Intergenic
932163415 2:69483591-69483613 TCTCTTTTTTCGGGGGTTGGGGG + Intronic
933412170 2:81940352-81940374 TCTCTTGTGGAGGGGGTGGGGGG - Intergenic
933567217 2:83964964-83964986 TGTCATGGGGTGGGGGTTGGGGG + Intergenic
934500472 2:94857190-94857212 GCTCAAGAGCCGGTGGTTGGGGG - Intergenic
934778648 2:96954964-96954986 CCTCTTGAGCCGGGAGTTGGAGG + Intronic
935332725 2:101988795-101988817 TCTCGTGGGAGGGGGGTTGGAGG + Intergenic
935854693 2:107261095-107261117 ATGCATGTGCAGGGGGTTGGTGG + Intergenic
937362233 2:121237350-121237372 CCTCACCTGCGGGGGGTTGGTGG - Intronic
945407867 2:209471638-209471660 TATTAAGTGCCGGGGGTGGGGGG - Intronic
945988030 2:216370832-216370854 TCTCAGGTGGTAGGGGTTGGGGG + Exonic
946278100 2:218645844-218645866 TCGCTTGAGCCGGGGGGTGGAGG - Intronic
946510273 2:220348516-220348538 CCCCATGTGCTGGGAGTTGGGGG + Intergenic
947895308 2:233665892-233665914 TCTCATATGCAGGTGGTGGGAGG - Intronic
948737341 2:240017548-240017570 TCCCACGGGCCCGGGGTTGGGGG - Intronic
1168954039 20:1821735-1821757 TCTAATGTACCGTCGGTTGGAGG + Intergenic
1170172276 20:13428623-13428645 TCTCATGATCTGGGGGTAGGAGG + Intronic
1171143941 20:22765681-22765703 TCGCATGTGCCTGGGGTGGGAGG + Intergenic
1175888230 20:62304048-62304070 TGTGAGGTGCCTGGGGTTGGAGG + Intronic
1176867993 21:14064285-14064307 TCTCAAGAGCCGGTGATTGGGGG + Intergenic
1178477487 21:32950138-32950160 TCTCATGTGCCCAGGGTTGGTGG + Intergenic
1178793674 21:35723477-35723499 TGTCATGTGAGAGGGGTTGGGGG - Intronic
1179943296 21:44653773-44653795 CCTGATGTGACTGGGGTTGGGGG + Intronic
1180061553 21:45387969-45387991 TCTCATGTGCCGGGAGAACGAGG + Intergenic
1180179572 21:46111834-46111856 ACCCAGGTGCCAGGGGTTGGGGG + Intronic
1183354166 22:37349568-37349590 TCTGATGTCCCTGGGGTAGGAGG - Intergenic
1184790432 22:46696450-46696472 TCTCAAGTGCAGGGGGCAGGGGG + Intronic
949615396 3:5748318-5748340 TCTTATGTGTCATGGGTTGGAGG + Intergenic
953472171 3:43176932-43176954 TCACATGTGCTATGGGTTGGAGG + Intergenic
955351276 3:58195140-58195162 TCTCATGTGCTGAGTGCTGGGGG - Intronic
955698859 3:61663542-61663564 TTCCATGGACCGGGGGTTGGGGG + Intronic
957618228 3:82560596-82560618 TTTCATGTTTCTGGGGTTGGGGG + Intergenic
958897360 3:99843988-99844010 TTCCATGGGCGGGGGGTTGGGGG - Intronic
960710819 3:120526206-120526228 TCACATGAGCCAGGAGTTGGAGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963051609 3:141148120-141148142 TCTGATGTGTCCTGGGTTGGGGG + Exonic
964246466 3:154659705-154659727 TCTCAGGTGGTGGGGGTGGGAGG + Intergenic
965873307 3:173286390-173286412 TTTAATGTGCTGGGGGTAGGTGG - Intergenic
967678017 3:192323801-192323823 TCTCATGTGGCAGGGCATGGTGG + Intronic
968647711 4:1748719-1748741 CCACCTGTGCCGTGGGTTGGAGG + Intergenic
969499074 4:7542147-7542169 CCTCATGGGCGGAGGGTTGGGGG + Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
970446411 4:16126536-16126558 TCTCATGTCCCTGGGGATGCCGG - Intergenic
972305296 4:37824986-37825008 TTTCAAGAGCTGGGGGTTGGGGG - Intergenic
972817745 4:42662602-42662624 ACTCATGTCCTGGGGGTTGTTGG + Intergenic
974062391 4:57047133-57047155 TCCCATGTGTCATGGGTTGGGGG + Intronic
985243543 4:187956527-187956549 TGTCATGTGGTGGGGGGTGGGGG + Intergenic
986266224 5:6193559-6193581 TCTCAGGTGCCTGAGGTTTGCGG - Intergenic
992563070 5:77971925-77971947 TATTATGTGCCGGGGAGTGGAGG - Intergenic
995805802 5:116051241-116051263 TCTCCTCTGCCGGGGGTTCCAGG - Intronic
996088859 5:119330883-119330905 TCTCAGGGGCTGGGGGTTAGGGG + Intronic
996655987 5:125937133-125937155 TTTCATGGGGCGGGGGTTGGGGG + Intergenic
996908489 5:128630088-128630110 TCTAATGTGCTGAGGTTTGGGGG + Intronic
998401398 5:141850753-141850775 TCTCGTGTGTAGGGGGGTGGGGG - Intergenic
998872733 5:146568805-146568827 TCTGATGTTTCTGGGGTTGGGGG + Intergenic
1000207771 5:159078671-159078693 TCTCATGTCACTGGGGTTGCAGG - Intronic
1000616101 5:163428569-163428591 TCTCATGAACTGGGGGTTGGTGG + Intergenic
1000940354 5:167353313-167353335 TGTAATGTGCAGGGGGGTGGTGG + Intronic
1001707880 5:173754901-173754923 TCTCTGGTTCTGGGGGTTGGGGG + Intergenic
1002318405 5:178360465-178360487 CCTCATGTGGGGGGGGATGGAGG + Intronic
1002471340 5:179437944-179437966 TCACATGAGCCTGGGGGTGGGGG + Intergenic
1006919426 6:37617779-37617801 TCGCTTGAACCGGGGGTTGGGGG - Intergenic
1007794837 6:44339102-44339124 TCTCAAGGGTCTGGGGTTGGGGG + Intronic
1009227905 6:61034640-61034662 TCTCATAAGCGGGGGGATGGGGG - Intergenic
1011234377 6:85199951-85199973 TTTCATGGGCCAGGGGGTGGGGG + Intergenic
1011495500 6:87933398-87933420 TCTGATGTTCAGGGAGTTGGGGG - Intergenic
1015498698 6:133908042-133908064 TCTTATGTGTCTGGTGTTGGGGG + Intergenic
1016793845 6:148096292-148096314 TCTCATGTTCAGAGAGTTGGTGG + Intergenic
1016889243 6:148989213-148989235 TTTCATTTGCGGGGGGTGGGGGG - Intronic
1018698647 6:166410162-166410184 TTTCATGACCCGGGGGTGGGGGG + Intronic
1023573628 7:41600138-41600160 TCCCATGTCCTGGGGGCTGGAGG - Intergenic
1023909803 7:44545620-44545642 TCTCAGGAGACGGAGGTTGGAGG - Intergenic
1027142601 7:75669628-75669650 TAGCACTTGCCGGGGGTTGGGGG - Intronic
1030389141 7:108903846-108903868 TCCCATCTTCCGGGAGTTGGGGG - Intergenic
1031427289 7:121621184-121621206 TAACATGTGGTGGGGGTTGGGGG + Intergenic
1032021601 7:128409811-128409833 TCTCGTGTCCCGGGTGTTGCCGG + Exonic
1034253954 7:149714538-149714560 TCCCATGTGCCAGGGGCTGATGG - Intergenic
1036658472 8:10692478-10692500 TCCCATGTGCCAGGTGCTGGGGG - Intronic
1036776308 8:11615172-11615194 TCTGATGTCCAGGGTGTTGGAGG - Intergenic
1036910911 8:12755835-12755857 TCGCCCCTGCCGGGGGTTGGGGG + Intronic
1039637987 8:39186506-39186528 TTTCATGAGCTGGGGGTTAGGGG + Intronic
1040537096 8:48319936-48319958 TCTCCTGTGGCTGGGCTTGGAGG + Intergenic
1046423199 8:114011588-114011610 TCTCTGGCCCCGGGGGTTGGGGG + Intergenic
1048178184 8:132171519-132171541 TCACATGGGCTGGGGGTTGCAGG - Intronic
1049329353 8:142042037-142042059 CCCCATGTGCCTGGGGGTGGAGG + Intergenic
1050161463 9:2724014-2724036 TTTTTTTTGCCGGGGGTTGGGGG + Intronic
1050830626 9:10007678-10007700 CCTCATGTGCATGGGGTTGTAGG - Intronic
1051887944 9:21914626-21914648 TCTCATGGGGTGGGGGTGGGGGG + Intronic
1052762488 9:32606961-32606983 TTTTGTGTGGCGGGGGTTGGGGG + Intergenic
1053430243 9:38037473-38037495 TCTCATGTGCCGAGCATTGGAGG - Intronic
1053656692 9:40223354-40223376 GCTCAAGAGCCGGTGGTTGGGGG + Exonic
1053907060 9:42852632-42852654 GCTCAAGAGCCGGTGGTTGGGGG + Intergenic
1054357145 9:64071869-64071891 GCTCAAGAGCCGGAGGTTGGGGG + Intergenic
1054368812 9:64369632-64369654 GCTCAAGAGCCGGTGGTTGGGGG + Exonic
1054527906 9:66152875-66152897 GCTCAAGAGCCGGTGGTTGGGGG - Exonic
1054676442 9:67859384-67859406 GCTCAAGAGCCGGTGGTTGGGGG + Exonic
1056810077 9:89757336-89757358 TCTCTTGTGCCTGGGATTAGTGG + Intergenic
1057197184 9:93121657-93121679 TCTTAAGTGCCTGGGCTTGGTGG - Exonic
1057802107 9:98196991-98197013 TCTCCTCTGCCTGGGGTTGGGGG + Intergenic
1059417208 9:114169351-114169373 GCTCGTGGGCCGGGGGCTGGAGG - Exonic
1060760350 9:126242161-126242183 CCTCATGTGCGGCGGGGTGGTGG - Intergenic
1062029890 9:134357453-134357475 TCGCCTGTGCAGGGGGTTGGGGG + Intronic
1185730709 X:2459052-2459074 TCACCTGTGCCAGGAGTTGGAGG + Intronic
1185805029 X:3049321-3049343 TTACATGTGACGGAGGTTGGGGG + Intronic
1190105811 X:47560701-47560723 TCTGGTGTGGCGGGGGCTGGGGG - Intergenic
1190275864 X:48898747-48898769 TGTCAAGTGGAGGGGGTTGGGGG + Intronic
1192970618 X:76225236-76225258 TGTCATGGGGTGGGGGTTGGGGG - Intergenic
1192989244 X:76430859-76430881 TCTCATGTATTGGGGGGTGGGGG + Exonic
1197631555 X:128866957-128866979 TCTGATGTGCCTGGGGTTTCCGG - Intergenic
1198086509 X:133287483-133287505 TGTCATGGGTTGGGGGTTGGTGG - Intergenic
1198192366 X:134320850-134320872 TATCAGGTGCTGGGGGTGGGAGG + Intergenic
1199785956 X:151104992-151105014 TTTCATGAGTCGGGGGTGGGGGG + Intergenic
1200344322 X:155433513-155433535 TGTCACGTGGCGGGGGTAGGGGG + Intergenic
1201276227 Y:12301285-12301307 TTACATGTGATGGGGGTTGGGGG - Intergenic