ID: 1129853046

View in Genome Browser
Species Human (GRCh38)
Location 15:78805782-78805804
Sequence CTGGCCATTTCTCCATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 1, 2: 1, 3: 11, 4: 184}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129853046_1129853049 13 Left 1129853046 15:78805782-78805804 CCTTCAAATGGAGAAATGGCCAG 0: 1
1: 1
2: 1
3: 11
4: 184
Right 1129853049 15:78805818-78805840 CACCTGTAATCGCAGCATTTTGG 0: 20
1: 4727
2: 87839
3: 227817
4: 292727
1129853046_1129853052 26 Left 1129853046 15:78805782-78805804 CCTTCAAATGGAGAAATGGCCAG 0: 1
1: 1
2: 1
3: 11
4: 184
Right 1129853052 15:78805831-78805853 AGCATTTTGGAAGACCGAGGAGG 0: 3
1: 318
2: 8824
3: 113837
4: 199932
1129853046_1129853053 27 Left 1129853046 15:78805782-78805804 CCTTCAAATGGAGAAATGGCCAG 0: 1
1: 1
2: 1
3: 11
4: 184
Right 1129853053 15:78805832-78805854 GCATTTTGGAAGACCGAGGAGGG 0: 1
1: 28
2: 979
3: 18707
4: 172385
1129853046_1129853051 23 Left 1129853046 15:78805782-78805804 CCTTCAAATGGAGAAATGGCCAG 0: 1
1: 1
2: 1
3: 11
4: 184
Right 1129853051 15:78805828-78805850 CGCAGCATTTTGGAAGACCGAGG 0: 1
1: 4
2: 549
3: 13955
4: 162953

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129853046 Original CRISPR CTGGCCATTTCTCCATTTGA AGG (reversed) Intronic
901301996 1:8206490-8206512 CCGGCCATTTCTCCAAATGTGGG - Intergenic
901951490 1:12751858-12751880 CTTGGAATTTCTCCATTTCATGG - Intronic
902176243 1:14653123-14653145 GTGGTCATTTCTCCTTTGGAGGG + Intronic
903772654 1:25773692-25773714 ATGGCCATTTCTTCCCTTGATGG - Intronic
903910066 1:26717261-26717283 TTTGCCATTTCTCCTATTGAGGG + Intronic
904909953 1:33927286-33927308 TTGGTCATTTCTTCATTTTAAGG - Intronic
905303480 1:37001564-37001586 CTGGCCATTTGCTCATTTGTGGG + Intronic
906933950 1:50195618-50195640 CTGGCCATTCAGCCCTTTGATGG - Exonic
907328314 1:53655162-53655184 CTGGGCATTCCTACATCTGAAGG - Intronic
907546761 1:55267247-55267269 AAGGCTATTTCTCCATTGGATGG + Intergenic
907596686 1:55726835-55726857 CTGGCCATTCCTCTCTTTGTGGG + Intergenic
908772304 1:67608180-67608202 CTGGCCATTTCTACAAATCAGGG - Intergenic
911442152 1:97940142-97940164 ATGTACATTTCTCCAATTGAAGG - Intergenic
912126846 1:106549978-106550000 CTGGTCATTGCCCTATTTGAAGG + Intergenic
912261893 1:108119172-108119194 TTGGCAATATCTACATTTGAAGG - Intergenic
913239076 1:116812746-116812768 TCTGCCATTTCTTCATTTGATGG + Intergenic
913660384 1:121001778-121001800 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
914011749 1:143784935-143784957 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
914166084 1:145176199-145176221 CTGGCCCTTCCTGCCTTTGATGG + Intergenic
914650375 1:149693594-149693616 CTGGCCCTTCCTGCCTTTGATGG - Intergenic
916014717 1:160739698-160739720 CTAGCCTTCTCTCCTTTTGAGGG + Intronic
917146535 1:171898126-171898148 CTGGCATTTTCTACATTTTATGG + Intronic
918356165 1:183708003-183708025 CTCCCCATTTCTCCAGTTGTCGG + Intronic
919880718 1:201898931-201898953 GAGGCCATTTCTCCATTTTAAGG + Intronic
923385706 1:233463419-233463441 ATGACTATGTCTCCATTTGACGG + Intergenic
924104502 1:240636854-240636876 CTGGGAATGTCTCCATTCGAGGG - Intergenic
1063331431 10:5163662-5163684 CAGGCCATTTCTCTGTTTAAAGG - Intergenic
1069191246 10:65494238-65494260 TTGGCTATTTCTTAATTTGAGGG + Intergenic
1071097305 10:81992429-81992451 TTGGCCATGTCTCCTTTTGCTGG + Intronic
1071797247 10:89020016-89020038 CAGGCTATTTCTCTGTTTGAAGG - Intergenic
1071988114 10:91073086-91073108 GTGACCATTTTTGCATTTGAAGG + Intergenic
1072299307 10:94043752-94043774 CCAGCCAGTTCTCCTTTTGATGG + Intronic
1072699308 10:97629002-97629024 CTGGCCATTGATCCATTAAAAGG + Intronic
1072864327 10:99042226-99042248 CTGGCCTCTTCTCCATAGGACGG - Intronic
1073901957 10:108232790-108232812 CTAGCCTTTCCTTCATTTGAAGG + Intergenic
1077515396 11:2998703-2998725 CTGGCCATTTCTCCAGGGGGTGG + Intergenic
1079095157 11:17505255-17505277 CTGGCCAGTTTCCCATCTGAGGG + Intronic
1084316186 11:68347221-68347243 CTGGACATTCCTACATTTAAAGG - Intronic
1084477365 11:69396549-69396571 CAGGCCCTTTATCCATTTGTGGG + Intergenic
1085690400 11:78659559-78659581 CTTGCCAATCCTCCATCTGACGG - Intronic
1086303955 11:85459907-85459929 CTGGCCACTTTTCCATGGGATGG + Intronic
1088115397 11:106306418-106306440 CTGACCATTTATCTCTTTGAGGG - Intergenic
1088147135 11:106694789-106694811 CTGGCCAGTTCTATATTTTATGG + Intronic
1089151884 11:116370774-116370796 CTTGCAAAATCTCCATTTGATGG - Intergenic
1089756418 11:120690800-120690822 CAGGCCATTTCTTCTTTTAATGG + Intronic
1091126554 11:133104487-133104509 TTGGGCATTTCTCCATTTTGTGG + Intronic
1092307267 12:7314209-7314231 CTGGCTCTTTCTCCAACTGATGG - Intronic
1093222992 12:16446384-16446406 ATGGTCATTTCTCCATTTCCTGG - Intronic
1093412662 12:18884953-18884975 CTGGTCTTTTCTCCATGTAAGGG - Intergenic
1093494618 12:19741757-19741779 CTGCCCATTTCTCCACATGGTGG + Intergenic
1097956690 12:65494134-65494156 CTTGTCATTTTTGCATTTGAAGG + Intergenic
1101289616 12:103354376-103354398 CTGCCCATTTCTCCAAGTCATGG + Intronic
1104366741 12:128184857-128184879 CTTGGCATTTCTTCATTTGCAGG - Intergenic
1105022402 12:132825888-132825910 CTGGTGATGTCTCCATTCGAGGG + Intronic
1105491855 13:20895977-20895999 CTGGCCATTTATTCAGTTTATGG - Intronic
1112368469 13:98774814-98774836 GTGGCCATTTTCCCATGTGAAGG + Intergenic
1113845985 13:113391917-113391939 CTCACCATTTCCCCCTTTGATGG - Intergenic
1118752485 14:68816933-68816955 CTGCCCTTTGCTACATTTGAAGG + Intergenic
1122228120 14:100291494-100291516 CTGGCCATGTCCCCATTTTATGG + Exonic
1122769553 14:104091920-104091942 GTGGCCAGGTCTCCATTTAAGGG + Intronic
1124508081 15:30296196-30296218 CTGGCCAGTTCCCCATTAGCTGG + Intergenic
1124735473 15:32242460-32242482 CTGGCCAGTTCCCCATTAGCTGG - Intergenic
1125208147 15:37178366-37178388 CTACCCATTTCTCCATTCCATGG + Intergenic
1126006706 15:44264827-44264849 CTGGCCATTTCCCCATATTTAGG + Intergenic
1128517976 15:68355281-68355303 ATGAGCATTTCTCCATGTGAAGG - Intronic
1129101211 15:73265827-73265849 TTGGCCATTTCTGGATTTGGAGG + Intronic
1129404119 15:75302941-75302963 CTGGCCATGTCTTCAAGTGAGGG - Intergenic
1129853046 15:78805782-78805804 CTGGCCATTTCTCCATTTGAAGG - Intronic
1130249918 15:82293255-82293277 CCGGCCATTTCTCCATTTGAAGG + Intergenic
1131594981 15:93788741-93788763 CTGGCCAAATCCACATTTGATGG - Intergenic
1133731370 16:8581343-8581365 CTAGCCATCTCTCCATCTGTGGG + Intronic
1137888709 16:52135092-52135114 CTGGTCTCTTTTCCATTTGAAGG - Intergenic
1137974554 16:53020313-53020335 CTGGCCCTTCCTCTATTGGAAGG - Intergenic
1138891373 16:61148396-61148418 CTTGCCCTTCCTCCATTTCAGGG + Intergenic
1139435657 16:66935176-66935198 CTTCCCATTTCTCCATCTGGGGG + Exonic
1141629453 16:85279089-85279111 CTGGGCATTTCTCCATCAGCTGG - Intergenic
1142737040 17:1907693-1907715 CCGGCCCCTTCTCCATTTGGGGG - Intergenic
1148207718 17:45790023-45790045 CTCACCACTTCTCCTTTTGATGG - Intronic
1148341433 17:46875747-46875769 CTGCCCACTTCTCCATTTTATGG + Intronic
1150842174 17:68619066-68619088 CTGGCCATTTCACCATGGCATGG - Intergenic
1155162312 18:23205992-23206014 CAGGCCCATGCTCCATTTGAAGG - Intronic
1156994315 18:43447743-43447765 CTGGCCTCTTCTCCATAGGATGG - Intergenic
1157919111 18:51697633-51697655 CTTGCCATTTCTCCAGTTGTGGG - Intergenic
1160086420 18:75781033-75781055 TTGGCCCTTTCTCCAGTTGGGGG + Intergenic
1160700583 19:505008-505030 CTGACCAGTTCTCAACTTGAAGG - Exonic
928872268 2:35994053-35994075 TTGCCCATTTCTCTATTTAATGG + Intergenic
929417908 2:41762211-41762233 ATGGCCATCTCACCCTTTGATGG + Intergenic
930042736 2:47140579-47140601 CTGGCCATCTCTCCAATTTTGGG + Intronic
931986491 2:67747375-67747397 TTGGCCATTCCTCCACTGGAGGG - Intergenic
937583138 2:123513577-123513599 CTGACCTTTACTCCTTTTGAGGG - Intergenic
937813843 2:126229221-126229243 CTGTCCCTTTCTCCAGTTGAAGG - Intergenic
939468253 2:142585731-142585753 CTGGACAGGTCTCCCTTTGAAGG + Intergenic
940979807 2:159989038-159989060 CTGGACATTTTTACCTTTGAGGG - Intronic
941779190 2:169426525-169426547 CTGGCCAATTCTGCATTTGCTGG - Intergenic
941796369 2:169603673-169603695 TTGGTCTTTTCTTCATTTGAAGG + Exonic
946230658 2:218289343-218289365 CTGGCCATTCTTTCATTTGAGGG - Intronic
947412341 2:229854339-229854361 CTGGCCATTGGTCAATTTTAAGG - Intronic
948590051 2:239043486-239043508 CTGGCCAGCTCTCCATTGCACGG + Intergenic
1168805908 20:672235-672257 CTGGTGCTTTCTTCATTTGAGGG + Intronic
1168887644 20:1270927-1270949 GGTGCCAGTTCTCCATTTGATGG + Intronic
1170042759 20:12055248-12055270 GTGGCCATTTCTCCATGTCTAGG + Intergenic
1171133375 20:22675530-22675552 CTGGGCACTTCCCCTTTTGAGGG + Intergenic
1172307738 20:33893377-33893399 CTGGCCTTTTCTCGTTGTGAGGG + Intergenic
1172745785 20:37207593-37207615 GTGGTCATGTCTCCATTTCAAGG - Intronic
1173335511 20:42109515-42109537 CTGTCCATTTCTCTCTATGAGGG + Intronic
1179463886 21:41557914-41557936 CTGCCCATTTCTACATCTGTGGG - Intergenic
1179492889 21:41752745-41752767 CAGCCCATTTCTGAATTTGAAGG - Intronic
1182292062 22:29287876-29287898 CTGGCCATTTTTCCCCTTAATGG - Intronic
1183530854 22:38352570-38352592 CTGCCCTGTCCTCCATTTGAGGG + Intronic
1183785975 22:40029413-40029435 CTGTCCACATCTCCAGTTGAGGG - Intronic
949425140 3:3908313-3908335 ATGGCAATATCTCCACTTGATGG - Intronic
949439667 3:4066929-4066951 CTGCCCATTTCTCAACTGGATGG + Intronic
949774089 3:7611791-7611813 CTGTCCATTTCTACCTTTAATGG - Intronic
950229048 3:11260005-11260027 CTGGCCATGGCTCCGGTTGACGG - Exonic
951690200 3:25387140-25387162 CAAGCCATTTCTTCATCTGAAGG - Intronic
952446203 3:33383586-33383608 TTGGCCAGTTCTCCATTTGAGGG - Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
959612840 3:108314380-108314402 CTGGCCTTTTTTCCATTTTGTGG + Intronic
960175332 3:114510887-114510909 AGGGCCTTTTTTCCATTTGAAGG + Intronic
961402816 3:126658979-126659001 CTGGCCATTTATCCACTTTTAGG - Intergenic
961611392 3:128142709-128142731 CTGGCCATTTTTGGCTTTGAAGG - Intronic
961911888 3:130326403-130326425 CTGCCCATTTCTTCCTGTGATGG - Intergenic
963318042 3:143782022-143782044 CTGGACATTTCTCACTGTGATGG + Intronic
964937297 3:162106048-162106070 GTTTACATTTCTCCATTTGAAGG - Intergenic
967830025 3:193910664-193910686 CTGACCATTTCTCAATTTTGTGG + Intergenic
968266341 3:197366354-197366376 CTGGCCATTTCAACTTTTTATGG + Intergenic
968563578 4:1297417-1297439 CTGGCCATTTCTAGCTTTGGAGG + Intronic
970150070 4:13080460-13080482 ATGGCCTTTTCTCCATGTGCCGG + Intergenic
976396105 4:84557389-84557411 CCAGACATTTCCCCATTTGAAGG - Intergenic
977878127 4:102172959-102172981 TTTATCATTTCTCCATTTGATGG - Intergenic
978071758 4:104481198-104481220 GTGGCCATTTGTCCATTTCGTGG + Intronic
978317417 4:107454451-107454473 CTTGCCATCTCTCCATTATATGG + Intergenic
979875528 4:125885734-125885756 CTGGCCAGTCTTCCATTTTAAGG + Intergenic
983243195 4:165257278-165257300 CTGGCCATAGCTACATGTGACGG + Intronic
983841730 4:172465147-172465169 CTTTCAATATCTCCATTTGATGG + Intronic
984664249 4:182408508-182408530 CTGGCCTTTTCTCCTCTTCAGGG - Intronic
988788733 5:34587884-34587906 CTGGCCAGTTCTTCTTTTGAAGG + Intergenic
990187368 5:53222819-53222841 CTGGCCATTTCACCATATCTGGG + Intergenic
991598998 5:68334152-68334174 CTGGCCATTTCTAAGTTTGGAGG + Intergenic
992423273 5:76628072-76628094 CTGGCCTTCCCTTCATTTGAGGG - Intronic
996706625 5:126504736-126504758 TGGGTCATTTCTCCTTTTGAGGG + Intergenic
998635635 5:143951908-143951930 TTGGTGATTTCTCCATTTAATGG - Intergenic
999600939 5:153264644-153264666 CTGGCCATTTCTCGATATGGTGG - Intergenic
1001801689 5:174549846-174549868 CTGAGCATTTCAGCATTTGATGG + Intergenic
1001889887 5:175330035-175330057 CTTGCCATTTCTCAGTGTGAGGG - Intergenic
1007617425 6:43188510-43188532 CTGGCCATTTCTGAAATTGGTGG - Exonic
1012866796 6:104627439-104627461 CTGGCCCTATCTCCACCTGAGGG - Intergenic
1018023257 6:159782966-159782988 CAGCCCTGTTCTCCATTTGAGGG - Intronic
1018276846 6:162141809-162141831 CTGCCCATTGTCCCATTTGATGG + Intronic
1018460917 6:163997422-163997444 ATGGCCCTTCCTCCATTTCAAGG + Intergenic
1018746493 6:166766179-166766201 CAGGCAATTTCACCAATTGAAGG - Intronic
1029118110 7:98248336-98248358 CTGGCCATGTCTTCATCTGTAGG - Intronic
1029217854 7:98964608-98964630 TTGGCAATTTCTACATTTTAGGG + Exonic
1030678018 7:112405175-112405197 ATGGCCATTTTTCTCTTTGAAGG + Intergenic
1032256185 7:130298950-130298972 CTTGCCATTTATACAATTGAGGG + Intronic
1033556615 7:142493672-142493694 CAGGCCATTTCTCCAAGTGTGGG + Intergenic
1034359785 7:150484513-150484535 CTAACGATTTCTGCATTTGATGG + Intergenic
1036598799 8:10240277-10240299 CTGGCCATTTGGACATTTGGTGG + Intronic
1037909963 8:22738427-22738449 CTGGCCAAGTTTCCACTTGATGG - Intronic
1038412971 8:27372664-27372686 CTGGCCATTGCTCCCTGTCATGG - Intronic
1038776905 8:30539517-30539539 CTGGCTATTTCTTCACCTGAAGG + Intronic
1039254146 8:35700530-35700552 CTGGTGATTACTCCATTTGCAGG - Intronic
1042812091 8:72837026-72837048 CTGAACATTTCTCCAGATGATGG + Intronic
1042973041 8:74432150-74432172 GTGGCCATTTTTCCTTTGGAGGG + Intronic
1046014448 8:108589039-108589061 ATGGCCATTTATACATTTTAGGG - Intergenic
1047389756 8:124440485-124440507 CTGGACATCCCTCCATCTGAAGG + Intergenic
1048450239 8:134527127-134527149 CTGGCCATTTCTGGCTTTGAAGG + Intronic
1048774284 8:137928589-137928611 ATGGCCTGTTCACCATTTGAAGG + Intergenic
1049842819 8:144784824-144784846 CTGGCCTTTTTTCTTTTTGATGG - Intronic
1051166675 9:14269823-14269845 CTTGCCATAACTCCATTTGAGGG - Intronic
1052775327 9:32727325-32727347 CTGGTAATGTCTCCATCTGAAGG - Intergenic
1056571537 9:87820904-87820926 CAGGCCATCTCTCCAGTTGGAGG + Intergenic
1057206088 9:93173456-93173478 GTGGCCATTTCTCCCTCTGTGGG + Intergenic
1058961693 9:109998053-109998075 CTGGCCAAGTCTCAATGTGATGG + Intronic
1059021080 9:110578019-110578041 TTGTCCATTTCTCCCTTGGAGGG - Intronic
1059535492 9:115076499-115076521 CTTGCCATTCCTCCATTCCAGGG + Exonic
1061467616 9:130794485-130794507 CTGGCCATTCGATCATTTGAAGG + Intronic
1061467827 9:130796537-130796559 CTGGCCATTCGATCATTTGAAGG - Intronic
1187606539 X:20890871-20890893 CTGGGCATCTCTGCTTTTGAAGG + Intergenic
1187821170 X:23290041-23290063 CTGGTGATTTCACCATCTGAGGG - Intergenic
1192093321 X:68184000-68184022 ATGGCAATTTCTCCACTAGAGGG + Intronic
1192580185 X:72274651-72274673 TTTGCCATGTCTCCATTTGTGGG - Intronic
1194060780 X:89194893-89194915 CAGGCTATTTCTCCGTGTGAGGG + Intergenic
1194195250 X:90883893-90883915 CTGGCCACTTTTCCATGGGATGG + Intergenic
1197879503 X:131151448-131151470 TTGCCCATTTTTCTATTTGATGG + Intergenic
1199024169 X:142918211-142918233 CTGGCCTTTTCTTCATTCAAGGG - Intergenic
1199683879 X:150247535-150247557 TTGGCCATTTGTACATTTTATGG - Intergenic
1200701773 Y:6408652-6408674 CTGGCAAACTCTCAATTTGAGGG - Intergenic
1200910308 Y:8525969-8525991 CTGGCAAATTCCCAATTTGAGGG + Intergenic
1200913929 Y:8554987-8555009 CTGGCAAATTCCCGATTTGAGGG + Intergenic
1200918454 Y:8592008-8592030 CTGGCAAACTCTCCATATGAGGG + Intergenic
1201032338 Y:9756046-9756068 CTGGCAAACTCTCAATTTGAGGG + Intergenic
1201400772 Y:13601782-13601804 CAGGCTGTTTCTCCATTTAAAGG - Intergenic
1202148485 Y:21823977-21823999 CTGTCAAATTCCCCATTTGAGGG + Intergenic
1202176570 Y:22104053-22104075 CTGGCAAACTCTCAATTTGAGGG - Intergenic
1202181205 Y:22141463-22141485 CTGGCCAACTATCGATTTGAGGG - Intergenic
1202210155 Y:22444937-22444959 CTGGCCAACTATCGATTTGAGGG + Intergenic
1202214791 Y:22482331-22482353 CTGGCAAACTCTCAATTTGAGGG + Intergenic