ID: 1129854147

View in Genome Browser
Species Human (GRCh38)
Location 15:78811870-78811892
Sequence CCGCAGATAGCTTTGAAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854147_1129854161 28 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854147_1129854153 0 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854147_1129854160 25 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129854147_1129854163 30 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854147_1129854155 11 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854155 15:78811904-78811926 GGCCCTCCCTGGACAGACAGCGG 0: 1
1: 0
2: 2
3: 39
4: 320
1129854147_1129854152 -10 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854152 15:78811883-78811905 CTATCTGCGGAGACAGGCCTGGG 0: 1
1: 0
2: 1
3: 8
4: 104
1129854147_1129854162 29 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854147 Original CRISPR CCGCAGATAGCTTTGAAGCA GGG (reversed) Intronic
908064193 1:60384718-60384740 CCTCAGAAAGCTTTCAATCATGG - Intergenic
911402083 1:97387916-97387938 CCGCAGAAAGGTTTAAAGGAGGG + Intronic
916674646 1:167055140-167055162 CCGGAGCTAGCTTAGAAGCTCGG - Intronic
921249934 1:213288029-213288051 AGGCAGGTAGCTTTGAAGCCAGG + Intergenic
923139970 1:231152835-231152857 CCTCAGTGAGCTTTGAATCATGG + Intergenic
1064507786 10:16051975-16051997 CAGCAGATAACTTTGCAGCATGG + Intergenic
1066243508 10:33560587-33560609 CCACATATAGCTTTGGAACAAGG + Intergenic
1067841185 10:49680595-49680617 CCGCAGATAAGTTTTAGGCAGGG + Intronic
1071769177 10:88705485-88705507 CTTCAGATTACTTTGAAGCATGG + Intergenic
1080026715 11:27622830-27622852 AGGCAGATAACTCTGAAGCATGG - Intergenic
1083401048 11:62423741-62423763 CCCTAGAAAGCTTTGAAGGATGG - Intergenic
1086626870 11:88966950-88966972 CCACAGCTAGCTTTGAAAGATGG - Intronic
1088678094 11:112215842-112215864 CCTCAGAAAGCTTAGAATCATGG + Intronic
1089878849 11:121753912-121753934 CCACAGAAAGCCTTGAAGCTGGG + Intergenic
1092758293 12:11785299-11785321 CAGCAGATATCTCTGAAGGAGGG - Intronic
1093369210 12:18346405-18346427 CTGCAGAAATCTTGGAAGCATGG - Intronic
1097655728 12:62360110-62360132 CCTCAGATGGATTTGAAGCAGGG + Intronic
1104120347 12:125793047-125793069 CCTCAGGAAGCTTTCAAGCATGG + Intergenic
1108821116 13:54351200-54351222 CTGCAGTTGGCTTTGAAGTATGG + Intergenic
1111102393 13:83605297-83605319 CCCCAGAAAGCTTACAAGCAAGG - Intergenic
1111319483 13:86608142-86608164 CCTCAGATAGCTTACAATCATGG - Intergenic
1113380069 13:109796202-109796224 CAGCAGAGAGCATTGCAGCAGGG + Intergenic
1113557661 13:111251422-111251444 CCGCTGATGGATTTGAAGCTTGG + Intronic
1118036764 14:61876782-61876804 CCGCAGGTAGGTAGGAAGCAGGG + Intergenic
1120596415 14:86442721-86442743 GCCCAGACAGCTTTGTAGCATGG - Intergenic
1128324899 15:66717953-66717975 CCACATATAATTTTGAAGCAAGG + Intronic
1129854147 15:78811870-78811892 CCGCAGATAGCTTTGAAGCAGGG - Intronic
1138336352 16:56256446-56256468 CTTCAGAGAGCTTTGGAGCAAGG - Intronic
1142919592 17:3172589-3172611 CCTCAGATAGCTTTTACTCATGG - Intergenic
1144651476 17:17010058-17010080 CCTCAGAGAGCTTAGAAGCTAGG - Intergenic
1149955958 17:61050032-61050054 CAGCAGATATCTTTGAAGTATGG + Intronic
1153778353 18:8473419-8473441 CCTCAGAGAGCTTTGACTCATGG + Intergenic
1155372427 18:25115838-25115860 CCACAGCTTGCTTTGAGGCAGGG + Intronic
1157317446 18:46604089-46604111 CCACAGGTAGATTTGAAGAAAGG - Intronic
1158796492 18:60852524-60852546 TTTCAGACAGCTTTGAAGCAAGG + Intergenic
1159141569 18:64401998-64402020 CTGCAGAAAGATTTCAAGCAGGG - Intergenic
1162194516 19:8974065-8974087 CCTCAGATATCCTTGACGCACGG - Exonic
1163398686 19:17078758-17078780 AAGCAGATACCTTTGAAGCCCGG + Intronic
929277658 2:40043202-40043224 CCTCAGATGGCTTTGAACCCAGG - Intergenic
931926863 2:67083055-67083077 CAACAAATAGTTTTGAAGCATGG - Intergenic
932015837 2:68024980-68025002 CTGTAGATTGCTTTGTAGCATGG + Intergenic
933688465 2:85161389-85161411 CTGCAGTTATCTTTGCAGCAGGG + Intronic
935187139 2:100744651-100744673 CCCCAGATAGCTTTGAACGGAGG + Intergenic
942560527 2:177213392-177213414 CCGCAAATGGCCTCGAAGCATGG + Intronic
944933220 2:204541999-204542021 CCAAAGATAGCTTTGAGGTAAGG - Intergenic
947249961 2:228090821-228090843 CCTCAGATAGCTTACAATCATGG - Intronic
1170717673 20:18846054-18846076 CCTCAGGGAGCTTTTAAGCATGG - Intergenic
1171175410 20:23048381-23048403 TCGCAGTTGGCTCTGAAGCACGG + Exonic
1172993359 20:39052105-39052127 CCCCAGCTAGCTTTGATGCCTGG - Intergenic
1174073408 20:47914721-47914743 CCACAGAAAGCTTTGATTCATGG + Intergenic
1174150717 20:48484345-48484367 CCACAGAAAGCTTTGATTCATGG - Intergenic
1175573954 20:60046536-60046558 CTGAAGATAGATTTGAGGCAGGG + Intergenic
1177043282 21:16139382-16139404 CCTCAGGGAGCTTTCAAGCATGG + Intergenic
1181595804 22:23913781-23913803 CCTCAGATTGTTTTGAATCAAGG - Intergenic
949892706 3:8745239-8745261 CCGCAGGGAGCTTTCAACCATGG - Intronic
952186241 3:30972273-30972295 TCCCAGATTGCTTTGAAGCTAGG - Intergenic
955358254 3:58250018-58250040 CTGCAGAGGGCTTGGAAGCAGGG - Intronic
956573877 3:70729713-70729735 CTGGAGAAAGCTTTGATGCAGGG + Intergenic
956914250 3:73854296-73854318 CAGCAGAAAGCTTTTAAACAGGG - Intergenic
960516065 3:118604098-118604120 CCGCAGGAAGCTTTTAATCATGG - Intergenic
961181557 3:124882045-124882067 CCACAGCTAGCTTTGAAGTCAGG - Intronic
961431953 3:126889856-126889878 CCGCAGAAAGCGTTCCAGCAGGG + Intronic
967191755 3:186990941-186990963 CTGCAGACAGCCTGGAAGCAGGG - Intronic
968020142 3:195378568-195378590 CCGCACCTGGCCTTGAAGCAAGG - Intronic
969059345 4:4422678-4422700 CCGCTGGGAGGTTTGAAGCAGGG + Intronic
969906785 4:10404520-10404542 TCCCAAATAGATTTGAAGCAAGG + Intergenic
970349774 4:15190599-15190621 CCCCATATAGCTTTGGATCAGGG + Intergenic
977818972 4:101449834-101449856 CCATAGATAGTCTTGAAGCATGG - Intronic
981783907 4:148456287-148456309 GGGCAGATAGGTTTGAACCATGG + Intergenic
983740238 4:171121893-171121915 CCACAGATAGCATTCAAACATGG + Intergenic
985701810 5:1378062-1378084 CCCCAGATAGCACTGAGGCAGGG - Intergenic
986795552 5:11207721-11207743 GCTCAGTTAGCTGTGAAGCAAGG - Intronic
992696028 5:79288383-79288405 CTGCAGATGGCTTTGAAGAAGGG - Intronic
995195717 5:109364995-109365017 CTGAAGAAAGCTTTGAAGAAAGG + Intronic
999563650 5:152833492-152833514 CCTCTGAAAACTTTGAAGCATGG + Intergenic
1000016469 5:157282217-157282239 CCACAGAAAGCTTTCAATCATGG + Intronic
1001744109 5:174077348-174077370 CCCCAGAATGGTTTGAAGCAGGG - Intronic
1002914059 6:1514958-1514980 CACCAGATAGCTGTGAACCAAGG - Intergenic
1004777476 6:18863894-18863916 CCTCATAGAGCTTTGAATCATGG - Intergenic
1004913402 6:20308344-20308366 CCACTGATAGCTTTTCAGCAGGG - Intergenic
1009042714 6:58199346-58199368 TCCCAGATATCTTTGAAACATGG - Intergenic
1009218551 6:60953577-60953599 TCCCAGATATCTTTGAAACATGG - Intergenic
1022894320 7:34734287-34734309 CCCCAGATAGTTGTGATGCAAGG + Intronic
1024171935 7:46797873-46797895 CCTCAGAAAACTTAGAAGCATGG + Intergenic
1024308042 7:47944594-47944616 CTGTAGAGAGCTTTGAAGGAAGG - Intronic
1025232169 7:57210034-57210056 CCACAGAAAGCTTTGATTCATGG + Intergenic
1026601641 7:71782383-71782405 CCTCAGAAAGCTTTGACCCATGG - Exonic
1032732915 7:134661808-134661830 GAGCAGATGGCTTTGAATCATGG + Exonic
1037927200 8:22852993-22853015 TCGCAGCTCGCTTGGAAGCATGG - Intronic
1038689970 8:29752418-29752440 CCACAGCTAGTTTTGAAGCCAGG - Intergenic
1044918473 8:97142364-97142386 GAGAAGAAAGCTTTGAAGCAGGG + Intronic
1048735796 8:137500215-137500237 CCACAGAAAGCTTAGAATCACGG + Intergenic
1051122483 9:13766362-13766384 CCAGAGAAAGCTTTGAAGCTAGG + Intergenic
1055206525 9:73737465-73737487 CCGCTGAAAGGTTTTAAGCAGGG + Intergenic
1055661000 9:78504026-78504048 TCACAGAAAGCTCTGAAGCAGGG + Intergenic
1061553334 9:131350415-131350437 CCGCAGAGAGATTAGAAGCTGGG - Intergenic
1190752370 X:53373352-53373374 CTGTAGAAAGGTTTGAAGCAAGG - Intergenic
1193442797 X:81564177-81564199 CCTCAGGAAGCTTTGATGCATGG - Intergenic
1195227498 X:102813452-102813474 CCTCAGAGAGCTTTTAATCATGG + Intergenic
1196646998 X:118128569-118128591 CCATAGAAAGCTTTGGAGCAAGG + Intergenic