ID: 1129854149

View in Genome Browser
Species Human (GRCh38)
Location 15:78811871-78811893
Sequence TCCGCAGATAGCTTTGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854149_1129854161 27 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854149_1129854162 28 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854149_1129854160 24 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129854149_1129854155 10 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854155 15:78811904-78811926 GGCCCTCCCTGGACAGACAGCGG 0: 1
1: 0
2: 2
3: 39
4: 320
1129854149_1129854153 -1 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854149_1129854163 29 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854149 Original CRISPR TCCGCAGATAGCTTTGAAGC AGG (reversed) Intronic
902691353 1:18111601-18111623 TCCGCAGCTAGTATTGTAGCTGG + Intronic
902735919 1:18400700-18400722 TCCTCAGGTAACTTTGACGCAGG + Intergenic
905283832 1:36866360-36866382 TCAGCAGAGGGCTTTGGAGCTGG + Intronic
908188943 1:61680678-61680700 ACCGCAGTTATATTTGAAGCTGG - Intergenic
1063074262 10:2699456-2699478 TCTGCAGAAAGCTCTGAGGCTGG + Intergenic
1067534913 10:47102009-47102031 TCCCCAGAGAGCTCTAAAGCTGG + Intergenic
1068659760 10:59611916-59611938 TCCACAGAGTGCTTTGAATCTGG - Intergenic
1070269971 10:74944150-74944172 TTCACAGATTGCTCTGAAGCTGG + Intronic
1075223365 10:120603310-120603332 TCAGCAAACAGATTTGAAGCTGG - Intergenic
1076909811 10:133381354-133381376 CCCGCAGCTACCTTTGATGCGGG + Intronic
1077187098 11:1240253-1240275 TCCGCAGATGGCGATCAAGCAGG - Exonic
1077208114 11:1353725-1353747 TCCGCAGCTACCTGTGGAGCCGG + Intergenic
1078126014 11:8564158-8564180 TCTTCAGATAGCTTTCCAGCTGG - Intronic
1078470301 11:11580992-11581014 GCCGCAGGGAGCTGTGAAGCAGG - Intronic
1079410133 11:20179824-20179846 CCAGCAGATAGCAGTGAAGCTGG - Intergenic
1089878847 11:121753911-121753933 ACCACAGAAAGCCTTGAAGCTGG + Intergenic
1092758294 12:11785300-11785322 TCAGCAGATATCTCTGAAGGAGG - Intronic
1093731270 12:22568298-22568320 GCCGTAGATAGCTTTGGAACAGG + Intergenic
1097655726 12:62360109-62360131 TCCTCAGATGGATTTGAAGCAGG + Intronic
1099137464 12:78924958-78924980 TCAGCAGATAGCCTGGAAGTAGG + Intronic
1103056961 12:117828980-117829002 TCCACAGGTAGCTTTGAAGCTGG - Intronic
1103486077 12:121283517-121283539 TCTTCAGATAGCTTTGAACCTGG - Intronic
1107177926 13:37421684-37421706 CCCACAGCTAGCTTTGAAGATGG - Intergenic
1107279643 13:38719194-38719216 TACGCTGCTGGCTTTGAAGCTGG - Intronic
1110720785 13:78759091-78759113 TCTGCAGTTAGTTTTGATGCTGG - Intergenic
1111279428 13:85999918-85999940 TCCACAGATAACTTTAAAGATGG + Intergenic
1115069764 14:29306794-29306816 TCCCCAGATGGTTTTGAAGTAGG + Intergenic
1116439501 14:44936208-44936230 TGAGCAGATAGCTATGAAGTGGG + Intronic
1120093865 14:80365613-80365635 TCCCCAGGTAACTTTGAAGGTGG + Intronic
1120615547 14:86699444-86699466 TCAGCATAAAGCTTTGCAGCAGG + Intergenic
1125367086 15:38929477-38929499 TCTTCAGATAGCTTTGAGGTTGG + Intergenic
1129854149 15:78811871-78811893 TCCGCAGATAGCTTTGAAGCAGG - Intronic
1134875199 16:17691982-17692004 TCCACAGATAACTTTGGAGATGG - Intergenic
1142274553 16:89110709-89110731 TGGGAAGATTGCTTTGAAGCTGG + Intronic
1143583029 17:7837231-7837253 TCCCCAGATTGATTTGAAGTGGG + Intergenic
1145990291 17:29075256-29075278 TCCCCAGAAGGCTCTGAAGCAGG + Exonic
1159949135 18:74467001-74467023 TCCTCAGATAGCAGTGAAGAGGG + Intergenic
927099554 2:19777423-19777445 TTGGCAGATAGCTTTGGGGCTGG - Intergenic
929094688 2:38252082-38252104 TCTGCAGGGAGCTTTGCAGCTGG - Intergenic
933554456 2:83814549-83814571 TCCATAGATAGTTCTGAAGCTGG - Intergenic
938324456 2:130389068-130389090 TATGCAGCTAGCTTTGAAGATGG - Intergenic
939263977 2:139848333-139848355 TCCACTGAAAGGTTTGAAGCAGG + Intergenic
939431747 2:142118401-142118423 TATTCAGATAGCTGTGAAGCTGG - Intronic
945514625 2:210747787-210747809 TACACAAATAGCTTTGAAGAAGG - Intergenic
948014085 2:234673648-234673670 TCTGAAGAAAGCTTTCAAGCTGG - Intergenic
948598556 2:239095788-239095810 TCCACAGATGGGTTTTAAGCTGG - Intronic
1173178828 20:40786331-40786353 TCCTCTGATAGCCTTGTAGCGGG + Intergenic
1174446222 20:50593086-50593108 TCTGCAGGTAGCTGTGAAACTGG + Exonic
1175678641 20:60968337-60968359 TTCAAAGATAGCTTTGAAGGTGG + Intergenic
1176028561 20:62999038-62999060 TCTGCAGAGAGCCTTGAAGGAGG + Intergenic
1183590160 22:38775365-38775387 CCCGCAGAGAGCTTCAAAGCTGG + Intronic
956225634 3:66954575-66954597 TCTGCTGAAAGCTTTGAGGCAGG - Intergenic
956573876 3:70729712-70729734 TCTGGAGAAAGCTTTGATGCAGG + Intergenic
961431951 3:126889855-126889877 TCCGCAGAAAGCGTTCCAGCAGG + Intronic
961570086 3:127791356-127791378 TTCTCAGAGAGCTTTGAAGCAGG - Intronic
961707162 3:128796098-128796120 TTTGCAGATAGATCTGAAGCAGG - Intronic
967008770 3:185411056-185411078 TCCGATGATAGCTTTGAAGGGGG - Intronic
967191756 3:186990942-186990964 TCTGCAGACAGCCTGGAAGCAGG - Intronic
969667741 4:8571628-8571650 TCTGTGGATAGCTTTGAGGCTGG + Intronic
970264500 4:14266197-14266219 TCAGAAGAGAGCTCTGAAGCAGG + Intergenic
983713035 4:170743558-170743580 TCATAAGAAAGCTTTGAAGCAGG + Intergenic
992475764 5:77100338-77100360 ACAGCAGATAGCTTTGATCCTGG - Intergenic
992696029 5:79288384-79288406 ACTGCAGATGGCTTTGAAGAAGG - Intronic
992723695 5:79585239-79585261 TCCTCAGACAACTTGGAAGCTGG - Intergenic
998411481 5:141914589-141914611 TCCGCACTTAGCTCTTAAGCTGG + Intergenic
1000715220 5:164634813-164634835 TACTCATATAGCTATGAAGCAGG + Intergenic
1001231569 5:169993311-169993333 TCAGCAGACAGTTTTGAGGCAGG - Intronic
1003435860 6:6087393-6087415 TCAGTAGATAGCTTTCAAACTGG + Intergenic
1004913404 6:20308345-20308367 TCCACTGATAGCTTTTCAGCAGG - Intergenic
1005086342 6:22010882-22010904 TCCGCAGGCTGCTTTGAAGCTGG + Intergenic
1007180709 6:39927359-39927381 TCCGCAGGTAGCTGTGCTGCCGG + Exonic
1022828222 7:34038306-34038328 TGCACTGATAGCTTTGAAGATGG + Intronic
1028135727 7:87220771-87220793 TCTGCAGATAGCCTTGCACCTGG + Intergenic
1044918472 8:97142363-97142385 TGAGAAGAAAGCTTTGAAGCAGG + Intronic
1048653662 8:136510877-136510899 TCCACAGGGAGCTTTGAAGCTGG + Intergenic
1055969836 9:81900656-81900678 TCCCCAGAGAGCTATGCAGCAGG - Intergenic
1057301963 9:93891701-93891723 TCCAAAGTTAGCTTTGCAGCTGG - Intergenic
1061553336 9:131350416-131350438 GCCGCAGAGAGATTAGAAGCTGG - Intergenic
1061940649 9:133882085-133882107 TCCCCAGATAGCTGTGTGGCAGG + Intronic
1191803375 X:65105697-65105719 TCCTCAGGCAGCTTTGAAGTAGG - Intergenic
1198122564 X:133608338-133608360 TCCATAGATGTCTTTGAAGCAGG - Intronic