ID: 1129854153

View in Genome Browser
Species Human (GRCh38)
Location 15:78811893-78811915
Sequence AGACAGGCCTGGGCCCTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 489
Summary {0: 1, 1: 1, 2: 2, 3: 47, 4: 438}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854145_1129854153 12 Left 1129854145 15:78811858-78811880 CCACACCGGGGGCCCTGCTTCAA 0: 1
1: 0
2: 1
3: 3
4: 98
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854147_1129854153 0 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854146_1129854153 7 Left 1129854146 15:78811863-78811885 CCGGGGGCCCTGCTTCAAAGCTA 0: 1
1: 0
2: 1
3: 11
4: 148
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854142_1129854153 23 Left 1129854142 15:78811847-78811869 CCTCCAGAGGGCCACACCGGGGG 0: 1
1: 0
2: 1
3: 9
4: 114
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854144_1129854153 20 Left 1129854144 15:78811850-78811872 CCAGAGGGCCACACCGGGGGCCC 0: 1
1: 0
2: 0
3: 22
4: 174
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438
1129854149_1129854153 -1 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG 0: 1
1: 1
2: 2
3: 47
4: 438

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854153 Original CRISPR AGACAGGCCTGGGCCCTCCC TGG Intronic
900136036 1:1117218-1117240 GGACGGGCCTGGGAGCTCCCGGG - Intergenic
900201934 1:1411924-1411946 AGACAGACCTGGGACCTCGACGG - Intergenic
900243910 1:1629133-1629155 CTACAGGCCTCGGGCCTCCCCGG + Exonic
900294223 1:1940592-1940614 AGACACGCCAGAGCCCTCACGGG - Intronic
900358522 1:2276377-2276399 CGACTGGCCTGGACCCTCCAGGG + Intronic
900574918 1:3378368-3378390 AAGCAGGCCTGGGCAGTCCCAGG - Intronic
900616306 1:3567204-3567226 ACAGAGCCCTGGTCCCTCCCAGG + Intronic
900912809 1:5613983-5614005 GGGCAGGCCTGGGAACTCCCAGG - Intergenic
900987246 1:6080338-6080360 AGAGATTCCTGGGCTCTCCCTGG + Intronic
900996193 1:6124780-6124802 AGTCAGGCCTGGGCCAGGCCCGG + Intronic
901325263 1:8361520-8361542 AGACAGGGCTCTGCCCTCCTGGG - Intronic
901626771 1:10629295-10629317 AGACAGCCCAGGGTCCCCCCGGG - Intronic
901747590 1:11384768-11384790 TCACAGGTCTGGCCCCTCCCTGG - Intergenic
902625038 1:17671555-17671577 GCACAGGCCTGGGTCCTTCCTGG + Intronic
903546116 1:24124337-24124359 AGACAGGACAGTGCCTTCCCAGG - Intronic
903771913 1:25769636-25769658 AGGGAGGCCTGGGCTCTGCCGGG - Intronic
903938603 1:26913511-26913533 AGACAGACCCCAGCCCTCCCTGG - Exonic
903996162 1:27306657-27306679 AGGCAGGCCAGAGCCCTCCAGGG - Exonic
904563347 1:31413180-31413202 TGCCGGGCCTGGCCCCTCCCCGG - Intronic
904978391 1:34476236-34476258 AGGCTGGGCTGGGCCCTCACTGG + Intergenic
905883786 1:41480999-41481021 AGGCAGGCCTGGGTCCTCATTGG - Intronic
907247273 1:53116181-53116203 AGGCAGGGCAGGGCCCTCACAGG - Intronic
908688604 1:66752410-66752432 ACAGAGCCCTCGGCCCTCCCCGG - Intergenic
910558279 1:88561581-88561603 TGACAGACCTGGGCACTACCAGG + Intergenic
918043424 1:180926927-180926949 AGCCATGCCTGGGCCCTGCCAGG + Intronic
918066642 1:181105816-181105838 AGACAAAGCGGGGCCCTCCCGGG + Intergenic
918377334 1:183922352-183922374 AGACAGGCATGTTCCTTCCCAGG + Intronic
920051617 1:203167914-203167936 AGTCTGGCCTGGGGCCTACCAGG + Exonic
920193553 1:204211309-204211331 AGGCAGGCCTGGGCCCCACCAGG - Intronic
921297494 1:213718432-213718454 AGACTGGTCTGGGTCCTTCCTGG + Intergenic
923436440 1:233971877-233971899 TGACAGGCCTGGGCCATGCAGGG - Intronic
923685115 1:236148284-236148306 AGACAGGTCTGTGCCCTGCAGGG + Intronic
1062835702 10:634245-634267 AGACAGGCCTCACCCCTTCCTGG + Intronic
1062882311 10:988582-988604 CTACAGGCCCGGACCCTCCCCGG - Intronic
1063415690 10:5870913-5870935 GGACAGGCCTGGGCGCTCCTGGG - Intronic
1063593132 10:7410910-7410932 AGCGAGGCCGGTGCCCTCCCGGG - Intronic
1063727311 10:8652126-8652148 AGAAAGGACTGGGCTCTCTCTGG + Intergenic
1063914296 10:10866070-10866092 AGACAGGCCGCGGCTCTTCCTGG - Intergenic
1064007258 10:11708568-11708590 AGACAGACCTAGGGCCTACCTGG + Intergenic
1064976868 10:21126075-21126097 AGAAGGGCCTGAGGCCTCCCAGG - Exonic
1065854760 10:29821171-29821193 ACACTGCCCTGGGCCCTGCCCGG - Intergenic
1067308847 10:45093305-45093327 AGAAAGGCCTGTTCTCTCCCTGG - Intergenic
1067835112 10:49633546-49633568 AGACAGGCTTGGGGCCTCAGAGG + Intronic
1068966027 10:62912775-62912797 AGACAGCCTTGGACCTTCCCAGG + Intronic
1069627487 10:69877186-69877208 TGACATGCCTGGGTCATCCCTGG + Intronic
1069879247 10:71581421-71581443 AGACAGGCCTGAGCCCACAATGG + Intronic
1069996402 10:72344648-72344670 AAAGAGGCCTGGGGCCTGCCTGG + Intronic
1070537881 10:77392990-77393012 AGAACGGGCTGGGCTCTCCCTGG - Intronic
1071528466 10:86372081-86372103 AGGCTGGCCCAGGCCCTCCCAGG + Intergenic
1071940469 10:90586160-90586182 AGACGGGACAGGGCCCCCCCAGG + Intergenic
1072733892 10:97866179-97866201 AGACAGGCCGGGGCCCTGCAGGG - Exonic
1073192488 10:101661622-101661644 TGCCAGCCCTGGGCCCTCCATGG + Intronic
1073323603 10:102629981-102630003 GGACAGGCCTGGGCAATCTCTGG + Intronic
1073432513 10:103495228-103495250 AGACACTGCTGGGTCCTCCCGGG + Intronic
1073432833 10:103497777-103497799 AGACACCCCTGGGCTTTCCCAGG + Intronic
1074046368 10:109843284-109843306 AGACATGACTGCCCCCTCCCAGG + Intergenic
1074285300 10:112092120-112092142 AGAAAGGCCTGGGGCCCCACTGG + Intergenic
1074426322 10:113354650-113354672 ACACAGGCATGGAGCCTCCCAGG - Intergenic
1075094280 10:119460850-119460872 AGACAGAGCTGGGCCCTGCGGGG - Intergenic
1075747270 10:124736595-124736617 GGAGAGGCCTCGGCCCTGCCTGG - Intronic
1075825981 10:125357326-125357348 AGCCAGGCATGGTCCTTCCCAGG - Intergenic
1075871066 10:125773179-125773201 AGACAGCCCTGAGCACCCCCGGG + Intronic
1075923861 10:126235223-126235245 AGTCAGGCCAGGTCCCTCCCTGG - Intronic
1076000153 10:126906864-126906886 GGACAGCCCTGGGTCCTACCGGG + Intronic
1076590584 10:131579721-131579743 AGGCAGTACTGGGGCCTCCCGGG - Intergenic
1076610768 10:131724844-131724866 AGAGGGGCCTGGGCCCTCTCTGG - Intergenic
1076761572 10:132608510-132608532 AGACAGGCTGGTGCCCTCGCAGG + Intronic
1076782326 10:132731168-132731190 AGTCAGGCCTGGGTTCCCCCCGG + Intronic
1076798868 10:132811541-132811563 ACCCTGGCCTGGGCCCTCCACGG + Intronic
1077106452 11:844506-844528 GGACAGGCCTGGGCCCCCAGGGG - Exonic
1077452942 11:2661878-2661900 AGCCAGGCCTGTGAGCTCCCAGG - Intronic
1077637674 11:3855007-3855029 AGACAGGACTCGGCGCTCCTGGG - Intronic
1077920855 11:6640892-6640914 AGCAGGGCCTGGGCCCTCCGGGG + Exonic
1078162827 11:8856668-8856690 AGGCAGGCCCAGGCCCTCTCTGG + Intronic
1078443007 11:11383121-11383143 AGAGTGGCCTGTGACCTCCCAGG - Intronic
1080409199 11:32007537-32007559 ATCCAGGCTTTGGCCCTCCCAGG + Intronic
1083610329 11:64001200-64001222 AGGCAGGCCTGGGTCCAGCCCGG + Intronic
1083664796 11:64268580-64268602 GGGCAGGCCTGGACCCTCCGTGG + Exonic
1083714984 11:64569915-64569937 AGACAGGCCTGGGCTGCCCAGGG + Intronic
1083766757 11:64844961-64844983 AGACTTACCTGGGCCCTCCCTGG + Intergenic
1083783498 11:64930586-64930608 GGACAGGCCTGGGCCTCACCTGG - Exonic
1083793990 11:65003968-65003990 AGACAGCCTTGTGCCCTCTCTGG + Intergenic
1084033112 11:66492558-66492580 ACCCAGGCCTGGGCCCTACTGGG - Intronic
1084146986 11:67270265-67270287 AGCCCTGCCTGGGCGCTCCCAGG + Intronic
1084562852 11:69914024-69914046 ACCCAGGCCTGGGCTCCCCCAGG + Intergenic
1084749820 11:71197264-71197286 GCACATGGCTGGGCCCTCCCGGG + Intronic
1085049834 11:73374685-73374707 AGAGGGGCCTGGACCCTCTCTGG + Intergenic
1085306328 11:75488127-75488149 TGACAGGCCTCTCCCCTCCCTGG + Intronic
1085523492 11:77151474-77151496 CGACAGGCCTGGGCACTTCCTGG + Intronic
1088928657 11:114327254-114327276 AGCCAAGTCTGGGTCCTCCCTGG - Intergenic
1089170072 11:116505788-116505810 AGACAGGACTCTGCCCTCCATGG - Intergenic
1089328927 11:117676641-117676663 AGACAGCTCTAGGCCCTCCCTGG - Intronic
1091750646 12:3019517-3019539 AGACACCCCTCGGCCCTCCCAGG - Intronic
1094830151 12:34296447-34296469 GGCCTGGCCTGGGTCCTCCCAGG + Intergenic
1095983892 12:47987219-47987241 AGGCAGGACTGGGCTCTCCTGGG + Intronic
1097184219 12:57188073-57188095 AGGCAGGCCTGAGCCCAGCCAGG + Intronic
1102027150 12:109720124-109720146 ATACAGGCCTGGGCCAGTCCTGG + Intronic
1102135065 12:110567284-110567306 TGAGAGGCCTAGGCCCACCCTGG - Intronic
1102258610 12:111430119-111430141 AGAGAGGACTGGGACCTACCTGG - Intronic
1102455958 12:113070891-113070913 AAATAGTCCTGGTCCCTCCCTGG + Intronic
1103080514 12:118020198-118020220 AGTGATGCCTGGGCCTTCCCTGG + Intronic
1103445060 12:120989061-120989083 GGAGAGTCCTGGGCCCTCCCAGG - Intronic
1103904173 12:124319052-124319074 AGACACTCCTGGGCCCCCACAGG + Intergenic
1103921828 12:124403213-124403235 ACGCAGGCCTGGGGCCTTCCTGG - Intronic
1104772013 12:131369425-131369447 AGAGAGGCCAGGACACTCCCAGG - Intergenic
1104916679 12:132269156-132269178 AGGCCGCCCTGGGTCCTCCCTGG - Intronic
1104952849 12:132450240-132450262 AGCCGGGCCTGGGCCTTCCTGGG - Intergenic
1104970455 12:132528461-132528483 AGAAAGGCCTGGGCCCAGGCTGG + Intronic
1105006916 12:132727311-132727333 AGCCAGGCCTGGGCAGTCCTGGG - Exonic
1105250843 13:18697703-18697725 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1105279416 13:18954499-18954521 AGAGAGGGATGGGCCCCCCCAGG - Intergenic
1106208702 13:27621646-27621668 AGACAGGCCTGCGGGCGCCCCGG - Exonic
1106249337 13:27971951-27971973 AGACAGCCCTGGCCCCTAGCAGG + Intergenic
1106812828 13:33376923-33376945 AGACAGGCCTGGGGCCACTGTGG + Intergenic
1107094390 13:36518925-36518947 AGAAAGGCCTGCTCTCTCCCTGG + Intergenic
1108228698 13:48317119-48317141 AGACAGGGCTGGGCCCGGCCTGG + Intronic
1113375441 13:109761130-109761152 AGAGAGGACCGGGGCCTCCCTGG - Intronic
1113952645 13:114080385-114080407 CGGCAGTGCTGGGCCCTCCCTGG - Intronic
1114417853 14:22556291-22556313 ACACAGGCCTGAGGCCTCTCTGG + Intergenic
1121671663 14:95714614-95714636 AGTTAGGCCTGGGCTTTCCCGGG + Intergenic
1122072036 14:99211195-99211217 AGACAGGCCTGGGGCAGACCTGG - Intronic
1122226382 14:100282934-100282956 ACACAGGACTGGGAACTCCCAGG + Intergenic
1122318651 14:100840335-100840357 AAACAGCCCTGGGAGCTCCCAGG - Intergenic
1122538067 14:102480141-102480163 GTCCAGGCCTCGGCCCTCCCTGG + Intronic
1122782487 14:104149549-104149571 GGATAGGGCTGGGGCCTCCCTGG + Intronic
1122837836 14:104438771-104438793 TGACAGGGCTGGGTCCTTCCGGG - Intergenic
1123048137 14:105528242-105528264 AAGGAGGCCTCGGCCCTCCCAGG - Intronic
1124425138 15:29557147-29557169 AGACAGGGCTGGGGCCAGCCAGG - Intronic
1124494289 15:30176966-30176988 TGACAGGCCTGTGCCCAGCCTGG - Intergenic
1124708579 15:31985846-31985868 TGACAGGCCTGGGGCCTTCAAGG + Intergenic
1124749281 15:32361679-32361701 TGACAGGCCTGTGCCCAGCCTGG + Intergenic
1125504327 15:40258225-40258247 GGACAGGGCTGGCCCCTCCAGGG - Intronic
1125524031 15:40364254-40364276 AGGTAGGCCTGGGCCTTCCCTGG + Exonic
1128228197 15:66017469-66017491 AGACAGACCTGGCCCCATCCAGG - Intronic
1128661144 15:69501858-69501880 AGAGCTGCCTGTGCCCTCCCTGG - Intergenic
1128790252 15:70427992-70428014 ATCCAGGCCTGTCCCCTCCCAGG + Intergenic
1129389129 15:75211811-75211833 GGACAGGCCTGGGGCCTCCTGGG - Exonic
1129463005 15:75709385-75709407 ACTGAGGCCTGGTCCCTCCCTGG - Intronic
1129854153 15:78811893-78811915 AGACAGGCCTGGGCCCTCCCTGG + Intronic
1129986208 15:79922100-79922122 ATACAGGCCTGGGCAAACCCAGG + Intronic
1130884436 15:88081514-88081536 TGACAGGCATGGGCCCTTTCTGG + Intronic
1131301466 15:91203220-91203242 AGCCAGGCCAGGCCCCTACCTGG - Intronic
1132400465 15:101501952-101501974 AGACAGGCCCGAGGACTCCCTGG + Intronic
1132537898 16:492408-492430 AGGCCGCCCAGGGCCCTCCCCGG + Intronic
1132537929 16:492471-492493 AGGCCGCCCAGGGCCCTCCCGGG + Intronic
1132537943 16:492501-492523 AGGCCGCCCAGGGCCCTCCCGGG + Intronic
1132610396 16:813248-813270 GTTCAGGCCTGGGCGCTCCCTGG - Intronic
1132628234 16:902540-902562 AGACTGTCCTCGGCCTTCCCTGG - Intronic
1132682551 16:1149136-1149158 ACACAGGCTCGGGCCCTGCCTGG - Intergenic
1132941456 16:2510461-2510483 AGACAGGGCCTGGCCCACCCTGG + Intronic
1133018685 16:2956398-2956420 AGCCAGCCCTGGGCACTCCCGGG + Intergenic
1133337296 16:5014569-5014591 AGACAGGGCCGGGGACTCCCTGG + Intronic
1133730925 16:8577948-8577970 GGACAGGGCTTGGCCCTCACTGG - Intronic
1133787449 16:8984437-8984459 AGACTGGGATGGGCTCTCCCTGG + Intergenic
1134134785 16:11671070-11671092 AGACAAGCCTGAGCCATGCCAGG - Intronic
1137049388 16:35694885-35694907 AGACACACCTGGGCCACCCCAGG - Intergenic
1138309175 16:56008601-56008623 AGCTAGACCTGGCCCCTCCCGGG - Intergenic
1138415835 16:56870793-56870815 TGCCAGGCCTGGGCCCTCCCTGG + Intronic
1139447097 16:67004645-67004667 AGAGAGTCATGGGCCCTTCCTGG + Intronic
1139575691 16:67840809-67840831 AGAACTGCCTGGCCCCTCCCTGG + Intronic
1142103177 16:88286316-88286338 AGCCAGGCCGTGGCTCTCCCAGG - Intergenic
1142147414 16:88498358-88498380 AGACAGGGATGGGCCTGCCCTGG + Intronic
1142167867 16:88602529-88602551 CCACTGGCCTGGGCTCTCCCTGG - Intronic
1142186073 16:88695306-88695328 AGACAGCTCTGGGCCCTGTCTGG - Intergenic
1142500472 17:330069-330091 AGAGAGGCCTGGGCCCAGCTTGG + Intronic
1143118315 17:4592861-4592883 ACAGGGGCCTGGGACCTCCCAGG - Intronic
1143514343 17:7411865-7411887 AGACAGGCCTCAGCCCACTCAGG + Intronic
1143521662 17:7447585-7447607 AGACAGGCCTGGGTCCTGACGGG + Exonic
1143805190 17:9420455-9420477 AGATAGGCGAGGGTCCTCCCTGG - Intronic
1144652219 17:17014327-17014349 GCTCAGGCCAGGGCCCTCCCAGG + Intergenic
1144774636 17:17779186-17779208 AGGCAGGCCTGGGGCCACCCGGG - Intronic
1144824459 17:18098036-18098058 AGACAGTCCTGAGGCCTCCAAGG + Intronic
1145062750 17:19743150-19743172 ACACAGGCCTGAGCCCATCCTGG + Intronic
1145875915 17:28318281-28318303 AGACAGGCCTGCGCCCAGCGTGG + Intergenic
1146945284 17:36869421-36869443 AGGCTGGCCAGGGCCCTCGCTGG + Intergenic
1147164717 17:38587080-38587102 GCACAGACCTGGGCACTCCCAGG + Intronic
1147428245 17:40356390-40356412 ACAGAGGCCTGGGCCCTCAGTGG + Exonic
1149443030 17:56691035-56691057 AAACAGGCCTGTGCCAACCCTGG - Intergenic
1149551369 17:57542654-57542676 AGTCAGGGCTGGGCACCCCCTGG + Intronic
1149560593 17:57605426-57605448 AGACAGACCACTGCCCTCCCTGG - Intronic
1150822381 17:68445894-68445916 AGCAAGCCCTGGGCTCTCCCCGG + Intronic
1151523402 17:74647275-74647297 ACACATCCCTGGGTCCTCCCAGG + Intergenic
1151586067 17:75009155-75009177 AGACCTGCCTCTGCCCTCCCTGG + Intergenic
1152332207 17:79679800-79679822 GGACAGGCCTGGGCCCAGCCTGG - Intergenic
1152531142 17:80919956-80919978 AGGCAGGCCTGGGCCCACAGAGG + Intronic
1152654376 17:81513090-81513112 TGACGGGCCTGGCCCCTCCCCGG + Intronic
1152737390 17:82004218-82004240 AGACAGTGCTGGGGCATCCCTGG - Intronic
1153894058 18:9543216-9543238 GGAAAGGCCTGCACCCTCCCTGG + Intergenic
1154438006 18:14361223-14361245 TCACAGGGCTGGGCCCACCCTGG - Intergenic
1157359542 18:46964727-46964749 AGCCAGCCCCGGGCCCACCCAGG + Intronic
1157361136 18:47024246-47024268 AGCCAGCCCCGGGCCCACCCAGG + Intronic
1157362126 18:47030161-47030183 AGCCAGCCCCGGGCCCACCCAGG + Intronic
1160449095 18:78949693-78949715 GGACAGTCCTTGGCCCTGCCGGG - Intergenic
1160836403 19:1126720-1126742 AGGCTGGCATGGGCCCTCACCGG + Intronic
1160866094 19:1256738-1256760 AGACAGGCCTGGGCAACCTCAGG - Intronic
1160895659 19:1400833-1400855 AGGCAGGCCAGGGCCACCCCGGG + Intronic
1160917396 19:1503765-1503787 CGCCAGGCCTGGGCCGTCCCAGG + Intergenic
1161095573 19:2388523-2388545 GGGCAGGCCTGGGCCCTTCTGGG - Intergenic
1161160218 19:2757552-2757574 AGACAGGCCTGACCCCTCGCTGG + Intronic
1161447715 19:4327670-4327692 AGTCTGGCCTGGTCCCTCGCTGG - Intronic
1161505219 19:4640044-4640066 AGCCAGGCCTAGGCCAGCCCGGG + Exonic
1161557993 19:4955254-4955276 GGATAGGGCTGGGCCCTCCTGGG + Intronic
1162679704 19:12331660-12331682 ATGCAGGGCTGGGGCCTCCCAGG - Intronic
1163156221 19:15441052-15441074 TGAGAGGCTTGGGTCCTCCCTGG - Intronic
1163222136 19:15929350-15929372 AGAGGGGCCTGGGCCCTGCAGGG + Intronic
1163250897 19:16125726-16125748 ACACTGGCCTGGCCCCACCCCGG + Intronic
1163438929 19:17311855-17311877 AGCCACGGCTGGGCCCTCACAGG - Intronic
1163559163 19:18008881-18008903 AGACACTCCGGGGGCCTCCCAGG - Intronic
1163584630 19:18157092-18157114 AAGCAGGCCTGGCACCTCCCGGG - Intronic
1163644947 19:18483875-18483897 AAGCAGGCCTGGGCCATGCCTGG - Intronic
1163687473 19:18719889-18719911 GGACGGGCCTGGGGCCTTCCCGG - Intronic
1165093436 19:33398027-33398049 AGCCAGGGCTGGGCCATCCCTGG + Intronic
1165323230 19:35099114-35099136 AGGCAGGGCTGGGGTCTCCCTGG - Intergenic
1165444434 19:35849158-35849180 GGACAGGCCTGGGCCAGCTCAGG + Intronic
1166688762 19:44810693-44810715 AGCCAGGCCTGGCCCTGCCCTGG + Intronic
1166998293 19:46730271-46730293 ACACAGGCCCAGTCCCTCCCAGG + Intronic
1167606214 19:50482253-50482275 TGACCAGCCTGGGCCCTCACCGG - Exonic
1167697943 19:51025969-51025991 AGTCAGCCATGGGACCTCCCCGG + Intronic
1168316640 19:55487455-55487477 TGCCAGGCCTGGCCCCTCTCTGG + Exonic
1168459154 19:56539092-56539114 AGTCGGGCCTCGGCCCGCCCGGG - Exonic
1168528493 19:57106830-57106852 AGGCAGTCCTGCGCCCGCCCAGG - Intergenic
925060189 2:884963-884985 TGACAGGCCTGGACTTTCCCTGG + Intergenic
925350538 2:3198093-3198115 AGACAGGCAGGGGCTCTGCCTGG + Intronic
926205971 2:10834585-10834607 AGAAGGACCTGGACCCTCCCAGG - Intronic
927784750 2:25965925-25965947 AGACAGGGCTGGGAGCTCCAGGG + Intronic
927853830 2:26515941-26515963 AGAAAGGCCAGGGCCCAGCCAGG + Intronic
929451572 2:42041706-42041728 AGAAAGGGCTGGTCCCTTCCTGG - Intergenic
932309595 2:70729031-70729053 AGCCTGGCCTGGGCCTTCACTGG + Intronic
932340795 2:70961526-70961548 GGCAAGGCCTGGCCCCTCCCAGG - Intronic
933182637 2:79244583-79244605 AGACAGGCATGGGCATTCACAGG + Intronic
933297222 2:80504378-80504400 AGATAAGGCTGGGCTCTCCCAGG + Intronic
933808642 2:86018213-86018235 CGACAGGGCTGTGCCCGCCCAGG + Intergenic
934678237 2:96265272-96265294 AGCCTGGCCTCGGCCCTGCCTGG - Exonic
934758157 2:96839035-96839057 AGACAGGCCCGGCCCCTGCATGG + Exonic
934896809 2:98126777-98126799 AGAAAGCCCTGGCCCCTCCCAGG - Intronic
935821977 2:106902327-106902349 AGAGAGGCCAAGGCCCTACCAGG - Intergenic
935975800 2:108577302-108577324 AGAAAGGCCTAGGCCTTACCGGG - Intronic
936373585 2:111922534-111922556 AGCCAGGTCTGGGCCCTGCGGGG - Intronic
937323054 2:120972410-120972432 AGAAGGGCCTGGGCCATTCCGGG - Intronic
937448109 2:121975687-121975709 TTAGAGGCCTGGTCCCTCCCTGG - Intergenic
938904473 2:135825524-135825546 AGACAGGCTGGGGGCCTCCGAGG - Intronic
940033294 2:149287585-149287607 AGTCAGGGTTGGGCCTTCCCTGG - Intergenic
940905722 2:159167743-159167765 AGTCAGGCCTGGAGCCACCCAGG + Intronic
945979383 2:216296817-216296839 AGAAAGGCCAGTGCCCTCTCTGG - Intronic
946284778 2:218694646-218694668 AAACATGTCTGTGCCCTCCCTGG - Intronic
946332684 2:219019219-219019241 GGCCAGGGCAGGGCCCTCCCAGG + Intronic
946365344 2:219245568-219245590 AGACCGGGGTGGGCCCTGCCAGG + Intronic
946398029 2:219453113-219453135 AGCCAGGCCTGGGCCCCCTCAGG - Intronic
946625823 2:221611238-221611260 GGACAGGCTGTGGCCCTCCCTGG + Intergenic
947628235 2:231634696-231634718 TGACAGGCCTGGGCCCTACTAGG + Intergenic
948209031 2:236178794-236178816 AGAAGGTCCTGGTCCCTCCCCGG - Intergenic
948284111 2:236770644-236770666 ACACAGCCCTGGGTCCACCCTGG - Intergenic
948318238 2:237046631-237046653 AATCAGGCCTCGGTCCTCCCGGG + Intergenic
948327353 2:237136421-237136443 AGGAAGTCCTGTGCCCTCCCAGG - Intergenic
948596296 2:239081789-239081811 ACAGTGGCCTGGGCCCTGCCCGG + Intronic
948805048 2:240450268-240450290 AGAGAGGTCTGGGCGGTCCCAGG - Intronic
948858730 2:240742811-240742833 TGACTGGGCTGTGCCCTCCCAGG - Intronic
948862012 2:240757212-240757234 GGCCTGGCCCGGGCCCTCCCAGG - Intronic
949064462 2:241981290-241981312 AGGGTGGCCGGGGCCCTCCCAGG - Intergenic
1171043866 20:21792080-21792102 AGACTGACCTTGGCCCTGCCAGG - Intergenic
1171222228 20:23409111-23409133 AGACAGGCCTGGCTGCTCCAGGG - Intronic
1171303597 20:24085495-24085517 AGACAGGCCTAGGCTCACCTTGG + Intergenic
1171335990 20:24386000-24386022 ATACAGGCCTGGGGGCTCACAGG + Intergenic
1172169181 20:32918553-32918575 AGACAGGCCTGTGCCCCAGCAGG + Intronic
1172523345 20:35583102-35583124 AGTGTGGCCTGGGCCCTCCCTGG - Intergenic
1174514600 20:51082329-51082351 AGACAGGTCTGGCCACTCCTTGG + Intergenic
1175184682 20:57172163-57172185 AGACATGCCTGGCACCTTCCAGG + Intronic
1175221913 20:57422136-57422158 ACACAGACTTGGGCCCTGCCTGG + Intergenic
1175530352 20:59670650-59670672 AGAAAAGCCTGGGGTCTCCCCGG - Intronic
1175774815 20:61646458-61646480 AGACACACCTGGGCTCACCCTGG + Intronic
1175808540 20:61845074-61845096 AGTCAGGCCTGGGCCCACACTGG + Intronic
1175921198 20:62451293-62451315 CCACAGGCCTGGGCCCCACCAGG - Intergenic
1176109484 20:63404928-63404950 AGCCCGGCCAGGGCACTCCCAGG - Intergenic
1176138957 20:63536880-63536902 GGACAGTCCTGGGCACTCCTGGG + Intronic
1176198436 20:63848433-63848455 AGGCTGGCCCTGGCCCTCCCAGG + Intergenic
1176231249 20:64034188-64034210 AGACAGGCCGGGACCCTCCAGGG - Intronic
1176388362 21:6150988-6151010 AGGCAGGCCTGGGCGAGCCCTGG + Intergenic
1176457672 21:6928246-6928268 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1176835844 21:13793330-13793352 TCACAGGGCTGGGCCCACCCTGG + Intergenic
1178807547 21:35851960-35851982 AGAAAGGCAGGGGCGCTCCCAGG + Intronic
1179445387 21:41426866-41426888 TGCCATGCCTGGGGCCTCCCCGG + Intronic
1179473858 21:41631055-41631077 AGCGAGGCCTGGGCTGTCCCAGG + Intergenic
1179566174 21:42250533-42250555 AAACAGGGCTGGGACCTCCCAGG + Intronic
1179605455 21:42513165-42513187 GGACTGGCCAGGCCCCTCCCTGG + Intronic
1179735110 21:43387260-43387282 AGGCAGGCCTGGGCGAGCCCTGG - Intergenic
1179957318 21:44748887-44748909 AGACAGGGCTGGCCCCAGCCCGG - Intergenic
1180141471 21:45895989-45896011 AGGCAGCCGTGGGGCCTCCCTGG + Intronic
1180763163 22:18223884-18223906 AGACAGGGCTGGGCCTGGCCTGG - Intergenic
1180802481 22:18638355-18638377 GGACTGGCCTGGGCCCCCACAGG + Intergenic
1180803862 22:18650279-18650301 AGACAGGGCTGGGCCTGGCCTGG + Intergenic
1180806901 22:18719170-18719192 AGACAGGGCTGGGCCTGGCCTGG - Intergenic
1180853715 22:19033910-19033932 GGACTGGCCTGGGCCCCCACAGG + Intergenic
1181108448 22:20588083-20588105 ACACTGGCCTGGGCACTGCCTGG - Intergenic
1181168132 22:20994132-20994154 AGCCACGCCGGGGGCCTCCCTGG - Exonic
1181217856 22:21344980-21345002 AGACAGGGCTGGGCCTGGCCTGG - Intergenic
1181219242 22:21356906-21356928 GGACTGGCCTGGGCCCCCACAGG - Intergenic
1181541094 22:23573756-23573778 AGACAGCCCTGTGCCTTCCTAGG + Intronic
1181542941 22:23583727-23583749 AGACTGGATTGGGGCCTCCCAGG - Intergenic
1181550993 22:23639113-23639135 AGACAGCCCTGTGCCTTCCTAGG + Intergenic
1181797288 22:25319574-25319596 AGACAGCCCTGTGCCTTCCTAGG - Intergenic
1181945423 22:26513124-26513146 GAACAGTCATGGGCCCTCCCTGG + Intergenic
1182428700 22:30288147-30288169 ACGCCAGCCTGGGCCCTCCCTGG - Intronic
1182452292 22:30428777-30428799 AGACAGGGCCGGGCCCACCCAGG - Exonic
1182487288 22:30647055-30647077 ATTCAGGCCAGGGCCATCCCAGG - Exonic
1183026001 22:35066384-35066406 AGACAGGCCTGGCAGCACCCAGG + Exonic
1183058078 22:35319168-35319190 AGACAGGCCTGGGAGCTTCATGG + Intronic
1183305483 22:37080744-37080766 AGAAAGGGCTGGGACTTCCCAGG + Intronic
1183520967 22:38295813-38295835 AGGCAGGCCTGGGACCACCGGGG + Intronic
1183587266 22:38760193-38760215 AGACATGCCCCTGCCCTCCCGGG + Intronic
1183619721 22:38965362-38965384 AGGGAGGCCAGGACCCTCCCTGG - Intronic
1183689213 22:39378811-39378833 GGAGAGGCCTGGGCCCCCGCTGG - Intronic
1183947153 22:41332943-41332965 AGTCAGGCCTGGCTCATCCCAGG + Intronic
1184929799 22:47672656-47672678 AGACAGGCCTGTGCCCGGCATGG + Intergenic
1185067505 22:48639553-48639575 GGCCAGGGCTGGGGCCTCCCTGG - Intronic
1185134105 22:49058961-49058983 ACCCAGACCTGGGGCCTCCCAGG + Intergenic
1185291914 22:50031514-50031536 GGGCAGGCCTGGGCCCTCAGCGG + Intronic
1185362294 22:50415603-50415625 TGGCAGGCCTGGGCCGTACCTGG - Intronic
949569207 3:5275627-5275649 AGGCAGGCCTGGGTCAGCCCAGG + Intergenic
950454836 3:13086480-13086502 AGAAAGGCCCTGACCCTCCCAGG - Intergenic
953690524 3:45114065-45114087 ACACATGCCTGGACCATCCCAGG + Intronic
953884698 3:46708623-46708645 GGACATCCCTGGGCTCTCCCTGG - Intronic
954152571 3:48664827-48664849 AGACAGGCAGGGGCTCTGCCGGG + Intergenic
954648165 3:52143959-52143981 AGATGGGTCTGGACCCTCCCAGG + Intronic
955593092 3:60558670-60558692 TGCTAGGCCTGGGCCCTTCCTGG - Intronic
956706548 3:72004121-72004143 AGTTAAGCCTGTGCCCTCCCAGG + Intergenic
960596422 3:119412015-119412037 ACAAAGGCCTGTGCCATCCCAGG + Intronic
961360606 3:126364915-126364937 AGCCAGGCCTGGGCCAGCCCTGG + Intergenic
963305934 3:143652955-143652977 AGAAAGGACTGGGAGCTCCCTGG + Intronic
966314022 3:178625266-178625288 AGGCAGGCAGGGGCCCACCCAGG + Intronic
966879675 3:184342983-184343005 AGGCAGGCCTGGACACTCCAGGG + Intronic
967979938 3:195059700-195059722 AGACAGGACAGGGCCTTCTCAGG - Intergenic
968481867 4:836863-836885 GGACAGGCCTGGCCCCTCGCCGG + Intergenic
968663455 4:1808480-1808502 ACACAGGGCCGGCCCCTCCCTGG - Exonic
968808239 4:2788555-2788577 GGACAGGAGTGGCCCCTCCCAGG - Intergenic
968890219 4:3364839-3364861 AGCCAGGCCCTGGCTCTCCCAGG - Intronic
968946049 4:3664886-3664908 AGACAGCCCTGGGCACTGCCAGG + Intergenic
969050691 4:4370819-4370841 CGTCAGGCCTGGCTCCTCCCAGG + Intronic
969307984 4:6336528-6336550 AGCCAGGCCTGGCACCACCCTGG + Intronic
969447833 4:7255755-7255777 AGACAGGCCAGGGCATGCCCTGG + Intronic
969520932 4:7677458-7677480 AGACAGGCCTGGGCCGGTCCTGG - Intronic
969704219 4:8783260-8783282 AGGGAGCCCTGGGCCCTGCCTGG - Intergenic
977693806 4:99946328-99946350 AGACAGGCCGGGGGCCCCGCAGG + Intronic
978402980 4:108350267-108350289 ACACAGGACTGAGCCCTCCATGG + Intergenic
980253745 4:130349949-130349971 AGACAGGGCTGTGCACTCCATGG - Intergenic
985673579 5:1218904-1218926 GGCCAGGCCTGTGCCCTCCACGG - Exonic
986600480 5:9467753-9467775 AGGCAGGCCTAAGCCCGCCCTGG + Intronic
990947020 5:61260347-61260369 AAACAGGCCCTGGCACTCCCAGG + Intergenic
992039474 5:72816296-72816318 AGACTGTGCTGGGCCCTCCTAGG - Exonic
992986256 5:82233687-82233709 AGAGGGGCCTGGGCCTTCTCTGG - Intronic
995636769 5:114201944-114201966 AGAAAGGGCAGGTCCCTCCCAGG + Intergenic
995744289 5:115387552-115387574 AGAGAGGCCTGGTCTCTCCAAGG - Intergenic
997283331 5:132662063-132662085 TGACAGGCAGGTGCCCTCCCTGG + Intergenic
997633695 5:135389202-135389224 AGGCAGGCCTGGGGCCTTCCAGG - Intronic
997969778 5:138391764-138391786 AGAGAGGCTTGGGCCCCCACTGG - Exonic
998040139 5:138946413-138946435 AGGCAGGCCTGGGCTCCCCTGGG + Intergenic
998253347 5:140567192-140567214 TGCCAGGCCTGGGCCGTCCCAGG + Exonic
998476375 5:142425618-142425640 AGACAGGCCTGGAGGCTCTCAGG + Intergenic
998536250 5:142933746-142933768 AGGCAGTCATGGGCCCTGCCAGG + Intronic
999511528 5:152257469-152257491 ACACAGTCCTGGGCCCTATCAGG - Intergenic
999692715 5:154162576-154162598 AGTCATGCCTGGGACTTCCCTGG - Intronic
1001425279 5:171618529-171618551 AGATAGGCCTGGGCAGCCCCAGG - Intergenic
1001427213 5:171630480-171630502 AGACGGGACTGGGGCCCCCCTGG + Intergenic
1001776059 5:174329928-174329950 AGACAGGCCAGGAACCTCTCTGG + Intergenic
1002416996 5:179125942-179125964 AGACAGGCCAGGGGCCACCAGGG - Intronic
1002963019 6:1934919-1934941 AGACAGGCCTGGGTCCGGCTCGG - Intronic
1003175977 6:3752222-3752244 GGACTGGCCTGGGCCCTCGTCGG - Intergenic
1004583474 6:16977123-16977145 ATCCTGGCCTGGGCCCTTCCTGG - Intergenic
1005498469 6:26409570-26409592 AGACAGGCAGGGTCCCTGCCAGG - Exonic
1006109027 6:31733835-31733857 AGGCAGTGCTGTGCCCTCCCAGG - Exonic
1006191493 6:32212519-32212541 AGAGAGGCCCGGTCCATCCCTGG + Exonic
1006809127 6:36808542-36808564 GGAGGGTCCTGGGCCCTCCCTGG - Intronic
1007261638 6:40568194-40568216 AGAGAGGCCTAGGCCAGCCCAGG - Intronic
1007414569 6:41684182-41684204 AGGCAGGCCTGAGCACCCCCAGG + Exonic
1007663172 6:43498845-43498867 TGACAGGCCTGGGCCATTACTGG - Intronic
1010559746 6:77334168-77334190 TGACAGGGCTGGGCCAGCCCAGG + Intergenic
1011671182 6:89684597-89684619 AGACAGGCCTGGGCAAGACCAGG + Intronic
1014905039 6:127015651-127015673 AGACAGGCCTGAATCCTCCTGGG + Intergenic
1017048222 6:150366772-150366794 AGGCAGGCCTGGGACCTCCTAGG + Intergenic
1018090646 6:160345048-160345070 AGAGAGGCCTGGGGCCTTGCGGG + Intergenic
1018228659 6:161655070-161655092 AGGCATTCCTGGGCCCACCCAGG + Intronic
1018228679 6:161655152-161655174 AGGCATTCCTGGGCCCACCCAGG + Intronic
1018228717 6:161655316-161655338 AGGCATTCCTGGGCCCACCCAGG + Intronic
1018672655 6:166192675-166192697 GCACAGCCCTTGGCCCTCCCGGG + Intergenic
1018724311 6:166598947-166598969 AGGCCGGGCTGGGCCCTGCCTGG - Intronic
1019344155 7:521403-521425 AGCCAGGCCTTGTCCCTCCAGGG + Intergenic
1019484634 7:1283953-1283975 AGAAGGACCTGGGCCCTCTCTGG + Intergenic
1019488972 7:1302229-1302251 AGACGGGCCGGGGCCCTTCCAGG - Intergenic
1019524096 7:1472976-1472998 AGCCAGCCCTGGGCCGTCCGAGG - Intronic
1019702810 7:2482244-2482266 AGAGAGTCCTTGCCCCTCCCTGG + Intergenic
1019737964 7:2659760-2659782 TCACAGGCCCGGCCCCTCCCAGG - Intronic
1019778130 7:2924416-2924438 AGACAGCCCTGGGACCTGCTGGG + Intronic
1020096103 7:5370513-5370535 GGCCAGGCCTCTGCCCTCCCCGG - Exonic
1020112035 7:5452629-5452651 GACCAGGCCTGGGGCCTCCCCGG - Intronic
1020252840 7:6483637-6483659 CGACAGGCGTGGCCCCTCTCTGG - Intronic
1022687364 7:32609332-32609354 AAACAGGCCTGACTCCTCCCTGG + Intergenic
1023181525 7:37488596-37488618 AGACTGGCCTGGGCCTGTCCAGG + Intergenic
1023826673 7:44014523-44014545 AAACAGGCCAGGGCTGTCCCAGG + Intergenic
1023872928 7:44272393-44272415 AGTCAGGCCTGGGCAGCCCCGGG + Intronic
1025144695 7:56493351-56493373 AGACAGGACCGAGCCCTCCAGGG + Intergenic
1026968599 7:74454714-74454736 ACACAGGCCAGCCCCCTCCCCGG - Intronic
1028262483 7:88683578-88683600 TGACTGGCCTGGGCACTCACAGG + Intergenic
1029528736 7:101111457-101111479 AGACTGGCCTGGGGAATCCCGGG + Intergenic
1029585609 7:101468872-101468894 AGCCAGGCCTGGGAACTGCCAGG - Intronic
1029737832 7:102474278-102474300 AAACAGGCCAGGGCTGTCCCAGG + Intronic
1029754962 7:102567927-102567949 AAACAGGCCAGGGCTGTCCCAGG + Intronic
1029772912 7:102667007-102667029 AAACAGGCCAGGGCTGTCCCAGG + Intronic
1030758888 7:113325613-113325635 AGAAAGGCCTGGGCTCAACCTGG + Intergenic
1031408471 7:121413831-121413853 TGACAGGCTTGGGCCCTCTTGGG + Intergenic
1032525491 7:132576342-132576364 GGACAGACCTGGGCCGACCCGGG - Intronic
1033154890 7:138948361-138948383 TGGCAGGCCTGGGCACTCCTTGG - Intronic
1033199823 7:139359419-139359441 AGACAGGCCTGCTCCCGGCCGGG + Intronic
1033410817 7:141115751-141115773 AGACAGGCCTTTGCCCTCAGAGG - Intronic
1034073608 7:148211001-148211023 AGGCAGGCCTGGTTCCTTCCAGG - Intronic
1034415584 7:150962835-150962857 AGATAGGCCTGGGCTCTCAGAGG + Intronic
1034490933 7:151392682-151392704 TGACAGGCCTGGGAGGTCCCTGG - Intronic
1035074810 7:156170240-156170262 AGCGAGGCCTGGCCCCTTCCAGG + Intergenic
1035205560 7:157291912-157291934 CGCCAGCCCGGGGCCCTCCCGGG - Intergenic
1035758083 8:2049163-2049185 AAACACGGCTGGGCCCTCCCAGG + Intronic
1035786617 8:2266241-2266263 AGGCAGGCTTGGGCCTTGCCTGG + Intergenic
1035806190 8:2455475-2455497 AGGCAGGCTTGGGCCTTGCCTGG - Intergenic
1035967783 8:4213670-4213692 AAGCAGCCATGGGCCCTCCCTGG + Intronic
1036049367 8:5179078-5179100 GGACAGGCCTAGGCCCTCCCTGG + Intergenic
1036209309 8:6829076-6829098 AGGCAGGACTGGGCCCTCCAGGG + Intronic
1038646429 8:29365921-29365943 GGTCAGGCCTGGGCCCTGCCTGG - Intergenic
1040552547 8:48449672-48449694 GCACAGGCCTGGGCTGTCCCAGG - Intergenic
1041725540 8:61013932-61013954 AGACAGGCCTCGGGCCTCCTGGG + Intergenic
1041755011 8:61304289-61304311 AGACTGGCATGAGCCCTCACGGG - Intronic
1043561545 8:81499626-81499648 GGACAGGGCTGGGCTCTTCCTGG - Intergenic
1044854161 8:96457631-96457653 AGACTGGCATGGGGGCTCCCAGG - Intergenic
1045295087 8:100865597-100865619 GGACAGGCCTGGTCCCACCTGGG - Intergenic
1045555745 8:103213170-103213192 AGCCATCCCTGGTCCCTCCCTGG - Intronic
1045560364 8:103255905-103255927 AGACAGGCCTTTGCACTCACAGG - Intergenic
1047603607 8:126452202-126452224 AAACAGGCCTGGGCACATCCTGG - Intergenic
1048308486 8:133300018-133300040 AGACAGGCAAGGGCCTCCCCTGG - Intronic
1048494033 8:134920599-134920621 AGAGAAGCCTGGTCCATCCCAGG + Intergenic
1048922933 8:139247126-139247148 AGATGGGCCTGGGCCAACCCTGG + Intergenic
1049193020 8:141299197-141299219 AGTCCGGGCTGGGCCCTCCTTGG - Intronic
1049341603 8:142115379-142115401 AGAAGGGTCTGGGCTCTCCCAGG + Intergenic
1049408440 8:142461909-142461931 AGCCAGGACTGGGCTCACCCCGG + Intronic
1049422681 8:142523906-142523928 CCCCAGGCCTGGGCCCTTCCTGG - Intronic
1049462315 8:142735845-142735867 GTACAGGCCTGGGCTCTCCAGGG + Exonic
1049624757 8:143615018-143615040 GGGCAGGCTTGGGTCCTCCCAGG - Intronic
1049687652 8:143945330-143945352 AGACTGGCCTGGCTCCACCCAGG + Intronic
1049742429 8:144247522-144247544 AGTCGGGCCCAGGCCCTCCCTGG - Intronic
1049812025 8:144579909-144579931 AGACAGGCCTGGCCACTGCAGGG - Intronic
1049835010 8:144729971-144729993 AGGCAGGGCTGAGCCCACCCAGG + Intronic
1056774382 9:89500150-89500172 AGACAGGCCTGGGGCCACCTTGG + Intergenic
1056817974 9:89815524-89815546 ACACAGGCCTGGGATCTCCATGG - Intergenic
1057024917 9:91727523-91727545 AGGCAGGGCTGGCTCCTCCCAGG + Intronic
1057263829 9:93601211-93601233 AGATTGGCCGGGGCCCACCCAGG + Intronic
1057565952 9:96166535-96166557 AGGTAAGCCTGTGCCCTCCCTGG - Intergenic
1058208750 9:102140631-102140653 AGACATACCTGGGCACTCCCAGG + Intergenic
1058975901 9:110125383-110125405 GGAGAGGCCTGGCCCCTCCCTGG - Intronic
1059687337 9:116650137-116650159 AGACAGCCCTGGGCCTCCACTGG - Intronic
1059709716 9:116856379-116856401 AGGCAGGGCTGGGCTTTCCCTGG + Intronic
1060470350 9:123943159-123943181 ACAGGGCCCTGGGCCCTCCCAGG + Intergenic
1060549640 9:124478852-124478874 ACTCAGGCCTGGGGTCTCCCAGG + Intergenic
1060931498 9:127492129-127492151 AGACAGGCCTCTGCCCCTCCAGG + Intronic
1061236793 9:129347851-129347873 AGCCAGGCCTGGGTCCTCTTGGG + Intergenic
1061257912 9:129463545-129463567 TGCCAGGCCTGGCCACTCCCTGG + Intergenic
1061822135 9:133234747-133234769 CAACAGGCCTCGGCCCTCTCTGG + Intergenic
1061832517 9:133304698-133304720 TGACAGGCCTCGGCCCTCTCTGG - Intergenic
1061879947 9:133563598-133563620 AGACAGTGCTGTGTCCTCCCTGG - Intronic
1061882901 9:133576931-133576953 AGTCAGGCCAGGGCTCTGCCCGG - Intergenic
1061911654 9:133728287-133728309 AGCCAAGCCTGGTACCTCCCCGG + Intronic
1062037426 9:134389007-134389029 ACACAGGCCTGAGGCCACCCTGG - Intronic
1062108352 9:134767942-134767964 TGCCAGGCCTGGGACCTTCCAGG + Intronic
1062232227 9:135487876-135487898 AGACAGGGCTGGGTCCGGCCTGG - Exonic
1062237158 9:135515769-135515791 TGACAGGACTCGGCCCTCTCTGG - Intergenic
1062439088 9:136561572-136561594 AGTCAAGCCGGGGCCCTCCGAGG + Intergenic
1062494438 9:136825148-136825170 AGGCAGGCCTGGGGCCTCTCAGG + Intronic
1062598366 9:137309202-137309224 AAACAGGCTGGGGCCTTCCCTGG + Intronic
1062699474 9:137891435-137891457 CCACAGGCCTGGGACCCCCCAGG - Intronic
1185873484 X:3683427-3683449 AGACATGTCTGAGCCTTCCCAGG + Intronic
1186759490 X:12708712-12708734 AGGTAGGGCTGGGTCCTCCCTGG - Intronic
1186883969 X:13894037-13894059 CGCCAGGCCTGGATCCTCCCTGG + Intronic
1188247567 X:27854011-27854033 AGCCCTGCCTGGGGCCTCCCAGG - Intergenic
1190177447 X:48162594-48162616 AGACAAGCCTGGGCCCAGGCTGG + Intergenic
1190209478 X:48433357-48433379 AGACAAGCCTGGGTCCAGCCTGG + Intergenic
1190287233 X:48969783-48969805 TGGCAGGGCTGGGCCGTCCCCGG + Exonic
1190762247 X:53446432-53446454 AGACAGGCCTGGTCCTGCCTCGG - Intergenic
1191249784 X:58254810-58254832 GGCTAGGCCTGGGTCCTCCCAGG - Intergenic
1195308409 X:103608023-103608045 GGACAGGCCTGTGCCTTCTCCGG - Intronic
1195523462 X:105857949-105857971 TGACAGGCCTGGGCAATCCAGGG - Intronic
1196765098 X:119236059-119236081 AGGCTGGGCTGGGGCCTCCCAGG + Intergenic
1199628623 X:149761480-149761502 AGTCCTGCCTGGGGCCTCCCAGG + Intergenic
1200234997 X:154463891-154463913 GGACAGGCCTGGGCCCTCCCGGG + Intronic
1200790819 Y:7297678-7297700 AGACATGTCTGAGCCTTCCCAGG - Intergenic
1200909950 Y:8523221-8523243 AGAGAGGCCTGGCCCCTCGGAGG + Intergenic