ID: 1129854154

View in Genome Browser
Species Human (GRCh38)
Location 15:78811900-78811922
Sequence TGTCTGTCCAGGGAGGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854154_1129854163 0 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854154_1129854161 -2 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854154_1129854160 -5 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129854154_1129854162 -1 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854154 Original CRISPR TGTCTGTCCAGGGAGGGCCC AGG (reversed) Intronic
900001397 1:16802-16824 TGTGTGACCAGGGAGGTCCCCGG + Intergenic
900021117 1:187324-187346 TGTGTGACCAGGGAGGTCCCCGG + Intergenic
900755306 1:4430449-4430471 GGTGTTTCCAGGAAGGGCCCCGG + Intergenic
901265718 1:7909148-7909170 CGTGTGTCCTGGGAGGGACCTGG - Intergenic
901524203 1:9809188-9809210 TGTCTTCTCAGGGAGGGCTCTGG - Intronic
901532263 1:9861015-9861037 TGTGTGTCAAGGATGGGCCCTGG - Intronic
902233470 1:15043046-15043068 TGATTGTCCAGGGAAGGGCCAGG - Intronic
902442531 1:16440491-16440513 GGTCTGTCCATGGCGGGCGCAGG + Intergenic
902505720 1:16938230-16938252 GGTCTGTTCAGTGAGGGCCTCGG + Intronic
902617169 1:17630120-17630142 GGACTGTCCAGGGAGGGCCCTGG - Intronic
902714022 1:18260231-18260253 TGTCTGTCGAGGGAAGGGGCAGG + Intronic
902820178 1:18938778-18938800 TGTCTGTCCCTGGGGGGGCCAGG - Intronic
902975380 1:20084638-20084660 TGTAGGTCCACTGAGGGCCCTGG - Intronic
903833853 1:26190262-26190284 GGTCTGCCCTGGGAAGGCCCTGG + Intergenic
904059408 1:27696311-27696333 TGTGTGCCCAGGAAGGGCCTAGG - Intergenic
904811756 1:33167732-33167754 TGTCAGACCAGGGAGGGCCTTGG + Intronic
904823474 1:33259445-33259467 TGTCTGCCCAGGGAAGGGCTAGG - Intronic
905626921 1:39495393-39495415 TGACAGGCCAGGCAGGGCCCCGG - Intronic
905670015 1:39785378-39785400 TGACAGGCCAGGCAGGGCCCCGG + Intronic
905973054 1:42155478-42155500 TGCCTGGCCACAGAGGGCCCAGG + Intronic
906514180 1:46429219-46429241 TGTGAGTGCAGGGAGGTCCCTGG + Intergenic
911174288 1:94803797-94803819 TTTCTGTGAAGGGAGCGCCCAGG + Intergenic
911277355 1:95878780-95878802 TGTGTGTCAAGGGAGGGACCTGG - Intergenic
912950342 1:114116362-114116384 GATCTGTGCAGAGAGGGCCCGGG - Intronic
914428430 1:147599690-147599712 TGACGGTCCGGGGCGGGCCCTGG + Intronic
914967172 1:152270265-152270287 TGCCTGTACAGCTAGGGCCCTGG - Intergenic
914969195 1:152291852-152291874 TGCCTGTACAGCTAGGGCCCTGG + Intergenic
915907094 1:159886897-159886919 GGTCTGTGCAAGGAGGGGCCTGG + Intronic
918133295 1:181647211-181647233 ATTCTTTGCAGGGAGGGCCCTGG + Intronic
919028108 1:192203039-192203061 TATGTGTCAAGGGAGGGGCCCGG - Intergenic
919290815 1:195628041-195628063 TGCCTGCCCAGGCAGGGCCTTGG - Intergenic
920195869 1:204226685-204226707 TGGGTGTCCAGGGAGAGCCTTGG - Intronic
920548696 1:206840039-206840061 TGTCTGCCCAAGGAGAGGCCAGG + Intronic
920689105 1:208132142-208132164 TGACTGTCCATGTAGGGCCCGGG + Intronic
921914642 1:220593813-220593835 TGTCAGTCCTGGGTAGGCCCAGG + Intronic
922391380 1:225146790-225146812 TGGCTGTCCAGGGAGGGATCTGG + Intronic
922475609 1:225905245-225905267 TGTCAGACCAGGGAGACCCCTGG + Intronic
922774033 1:228206922-228206944 TGCCTTTCCATGGAGGGCCCAGG - Intronic
922784611 1:228276757-228276779 TGCCTGTCCCGAGGGGGCCCCGG + Intronic
923634183 1:235679214-235679236 TGGCTCTAAAGGGAGGGCCCAGG - Intronic
924002555 1:239570110-239570132 TGTATGTCGAGGGAGGGTCCTGG + Intronic
924073627 1:240309412-240309434 TATCTATGTAGGGAGGGCCCAGG + Intronic
1063464199 10:6232502-6232524 TGTGTGTCCTTGGAGGCCCCGGG + Intronic
1063488045 10:6438216-6438238 TGATTTTCCAGGGAGAGCCCTGG + Intronic
1063661416 10:8037030-8037052 AGTTTGCCCAGGGAGGGGCCAGG + Intergenic
1063998521 10:11643248-11643270 TGTCTATCCAGGGAGGCACCAGG - Intergenic
1064368699 10:14731238-14731260 TCTCAGTCCAGTGAGGGCGCGGG + Intronic
1064860039 10:19816594-19816616 CCTCTGTCTAGGGATGGCCCCGG - Exonic
1065179091 10:23107000-23107022 TGGCTGCACAGGGAGGGGCCAGG - Intronic
1066654714 10:37687030-37687052 CATCTGTGCATGGAGGGCCCAGG + Intergenic
1067039672 10:42942493-42942515 CATCTGTGCACGGAGGGCCCAGG + Intergenic
1069546963 10:69335507-69335529 TCTCAGTCCAGGGAGAGCCAGGG - Intronic
1069912481 10:71767910-71767932 TGCCTCCCCAGGGAGGGCCTAGG + Intronic
1069921653 10:71819238-71819260 TGTCTGGAAAGGGAGGCCCCAGG - Intronic
1070248488 10:74753438-74753460 TGTGTGGACAGGCAGGGCCCTGG - Intergenic
1070423820 10:76265466-76265488 TCTCTGTCCTGGGAGGACACAGG + Intronic
1070451070 10:76557629-76557651 AGCATGTCCAGGGAGGCCCCAGG - Intronic
1070801478 10:79246800-79246822 TGTCTGGCCAGGGAGCTCCCTGG - Intronic
1072786349 10:98285726-98285748 TCTCTGGCCAGGCAGGGCCCAGG - Intergenic
1073328419 10:102656048-102656070 AGGCAGTCCAGGGAGAGCCCGGG - Intronic
1073350019 10:102812924-102812946 TCTTTGTCCAGGAAGGCCCCCGG - Exonic
1073616525 10:105002101-105002123 TGTGTGCCCAGGTAGGCCCCAGG + Intronic
1074206287 10:111285840-111285862 TGTCTGTACAGGAGGGGCCCTGG + Intergenic
1075919433 10:126198148-126198170 GGGCTTTCCAGGGAGGGCCGTGG - Intronic
1077097268 11:804437-804459 GGCCTGTCCAGGCAGCGCCCGGG + Exonic
1077188525 11:1246110-1246132 GGTCTGTTCTGGGAGGGTCCCGG - Exonic
1077189487 11:1249881-1249903 GGTCTGTTCTGGGAGGGTCCCGG - Exonic
1077393900 11:2311914-2311936 TGTCTGGCCCTGGAGGGCCCTGG - Intronic
1077408375 11:2392585-2392607 TCCCTGTCCAGTGGGGGCCCAGG - Intronic
1079279172 11:19072616-19072638 TGTTTGGCCAGGGCGGGCCAGGG + Intergenic
1079542760 11:21594990-21595012 TGTGTGTCAAGGGAGGGGCCAGG + Intergenic
1081417881 11:42837456-42837478 TATGTGTCCAGGGAGGGACTTGG - Intergenic
1081537671 11:44007196-44007218 GATCTGCCCAGGGAGGCCCCGGG + Intergenic
1082238860 11:49851932-49851954 GGTCTGGCAAGGGAGGGCCACGG - Intergenic
1082623494 11:55454396-55454418 TTTGTGTCCTGGGAGGGACCAGG + Intergenic
1083178707 11:60970781-60970803 TGGTTGTCCAAGCAGGGCCCTGG - Intergenic
1083395698 11:62390362-62390384 TGACTGTCCAGGCAGGGGCCTGG - Intronic
1083629984 11:64090512-64090534 AGCCGGTCGAGGGAGGGCCCGGG - Intronic
1083721795 11:64607145-64607167 TGCCCCTCCTGGGAGGGCCCGGG - Exonic
1084372598 11:68753756-68753778 TCTGTGTCAAGGGAGGGGCCTGG + Intergenic
1084428748 11:69099943-69099965 TGTCAGGCCTGGGAGGGACCTGG + Intergenic
1084530956 11:69727494-69727516 TGTCTGTCCAGGCCAGGCCCAGG + Intergenic
1084547093 11:69819877-69819899 TGACGGTCCAGAGAGGGGCCTGG + Intergenic
1085295854 11:75431262-75431284 TGTCTGTCAGGGGAGTGCTCAGG - Intergenic
1085405616 11:76260081-76260103 TGTTGGTGCAGGGAGGTCCCTGG + Intergenic
1085414920 11:76313498-76313520 TGTCTGTAGAGTGAGGGGCCTGG - Intergenic
1086059411 11:82684909-82684931 TGTATGTGGAGGGAGGGACCTGG + Intergenic
1088548443 11:110985756-110985778 TTGCTGTCCAGGGTGGGGCCTGG - Intergenic
1090252688 11:125262683-125262705 TGTCTGTGCTGGGAGGGGCTCGG + Intronic
1090260870 11:125318758-125318780 TGCCTGTTGAGGGAGGGACCTGG + Intronic
1090888143 11:130897573-130897595 TGGGTGTCCAGGCAGGGCGCCGG + Intronic
1095675054 12:44906954-44906976 CGTGTGTCCTGGGAGGGACCCGG + Intronic
1096311338 12:50523956-50523978 TGCCTGTCCATAGAGGGCACTGG - Intronic
1099904942 12:88760896-88760918 TGGGTGCCCAGGGAGGGCCTAGG + Intergenic
1100620186 12:96263759-96263781 AGTCTGTTCAGGAAGGGACCAGG + Intronic
1100898918 12:99215994-99216016 CATGTGTCAAGGGAGGGCCCTGG + Intronic
1102024598 12:109707065-109707087 TGTCTGGCCAGGCATGGCCCGGG - Intergenic
1102559593 12:113752847-113752869 TGTTTGTCAAGGGAGGGCAAGGG - Intergenic
1103228600 12:119309017-119309039 TGTGTGTCCAGTGAGGGCCCTGG + Intergenic
1103715091 12:122940491-122940513 TCTCTCTGCAGGGAGGCCCCTGG + Intronic
1104787495 12:131459102-131459124 TCTCTGCACAGGGAGGTCCCAGG + Intergenic
1104912387 12:132245561-132245583 TGCCGGACCACGGAGGGCCCTGG - Intronic
1112031224 13:95458643-95458665 TGTGTGTCAAGGGAGAGACCAGG - Intronic
1113216345 13:108045133-108045155 TGTCAGCCCAGGGAGGGGCCTGG + Intergenic
1113651110 13:112034943-112034965 TGTCTCTCCAGGACAGGCCCAGG + Intergenic
1113687846 13:112293261-112293283 TGTTTGTTCAGGATGGGCCCAGG + Intergenic
1113696978 13:112354030-112354052 TGCACGTCCAGGGAGGTCCCAGG - Intergenic
1113954431 13:114089583-114089605 TGTCCGTGCAGGGCTGGCCCAGG - Intronic
1115797751 14:36958256-36958278 TGTCTGTCTTAGGAGGGCCCAGG - Intronic
1118439497 14:65799812-65799834 TGCCCGTGCAGAGAGGGCCCAGG + Intergenic
1119430686 14:74566559-74566581 TGTCTGGCCAGGCAGGCCCTTGG + Intronic
1120593668 14:86407143-86407165 TATATGTCCAGGGAGAGACCAGG + Intergenic
1121051646 14:90822762-90822784 TGGCCGCTCAGGGAGGGCCCTGG + Intergenic
1121279312 14:92687838-92687860 TATCCATCCAGGGAGGGGCCTGG + Intronic
1121663656 14:95654954-95654976 TGTGTGTCAAGGGATGGACCTGG + Intergenic
1122272884 14:100576240-100576262 GCTCTGTCCAGGGATGGCCAGGG - Intronic
1122795709 14:104205200-104205222 TGTCTGCCCTGGGAGGACACAGG + Intergenic
1122870695 14:104636970-104636992 AGTCTGTCCAGAGGGGGCCCTGG - Intergenic
1123124488 14:105936539-105936561 CATGTGTCCAGGGAGGGTCCAGG - Intergenic
1123827642 15:24099691-24099713 TGTCTGTGCAGGAAGCACCCAGG - Intergenic
1124023230 15:25942803-25942825 GGTATGTCCAGGCAGTGCCCAGG - Intergenic
1124411102 15:29438022-29438044 TGACTGTCCAGGTGGGGTCCTGG - Intronic
1124625741 15:31306622-31306644 CGCCTTTCCCGGGAGGGCCCTGG + Intergenic
1125575359 15:40751728-40751750 TGTCTGTGCGGGCTGGGCCCAGG - Intronic
1126591094 15:50340462-50340484 TGTGGGTCCAGGGTGGGCCAAGG - Intronic
1126670392 15:51110647-51110669 GGTCATCCCAGGGAGGGCCCTGG - Intergenic
1128498499 15:68211359-68211381 TGTCAGTCCAGGGAGGTGCTGGG + Intronic
1128921253 15:71612140-71612162 TGTGTGGTCAGGGAGGGGCCAGG + Intronic
1129702749 15:77777050-77777072 CGTCTCTGCAGGGTGGGCCCTGG - Intronic
1129854154 15:78811900-78811922 TGTCTGTCCAGGGAGGGCCCAGG - Intronic
1132452111 15:101974136-101974158 TGTGTGACCAGGGAGGTCCCCGG - Intergenic
1132454783 16:16485-16507 TGTGTGAGCAGGGAGGTCCCCGG + Intronic
1132587791 16:713800-713822 TGTTTGGCCTGGGAGGGCCCTGG + Intronic
1132731943 16:1367017-1367039 TCCCTGTCTGGGGAGGGCCCTGG - Intronic
1132747791 16:1444174-1444196 TGTGTCTTCAGGCAGGGCCCTGG - Intronic
1134274008 16:12759603-12759625 CGTGTGTCAAGGGAGGGACCTGG + Intronic
1135791228 16:25398095-25398117 TATGTGTCATGGGAGGGCCCTGG + Intergenic
1135813781 16:25613580-25613602 TGTATGTCGTGGGAGGGACCTGG - Intergenic
1137586340 16:49665972-49665994 TGGCTGTCCCGAGTGGGCCCCGG + Intronic
1137613564 16:49834677-49834699 TGTCTGTCCACGGAGGGGGCAGG + Intronic
1138207800 16:55137651-55137673 TGTGTGTCAAGGGAGAGCCCTGG - Intergenic
1138414750 16:56865206-56865228 TGGGTGTCCAGGGAGGGGCCAGG - Exonic
1138646633 16:58430367-58430389 TGTCTGTAAAAGGAGGGGCCGGG - Intergenic
1139139155 16:64240121-64240143 CATCTGTCAAGGGAGGGACCTGG + Intergenic
1139146742 16:64334106-64334128 CATGTGTCCAGGGAGGGACCTGG - Intergenic
1141205386 16:81929285-81929307 TGCCTGCCCAGGGAGGGTCATGG - Intronic
1141488654 16:84357063-84357085 TGGCAGTCCAGGGGGGGCACGGG + Intergenic
1141936031 16:87238408-87238430 TGTCTGTCTGGGGAGGTCACAGG - Intronic
1142899355 17:3002717-3002739 CTTCTGTCCACGGAGGGGCCGGG + Intronic
1143742469 17:8964769-8964791 TGTCAGTCCAGAGAGGACCTTGG + Intronic
1146957438 17:36943563-36943585 TGGCTGGCCCGGGAGCGCCCTGG - Exonic
1147544222 17:41387706-41387728 TCTCTCTCCAGGGAGAGCCTGGG + Intronic
1147566277 17:41538173-41538195 CGTCTGTGAAGGCAGGGCCCAGG - Intergenic
1147653001 17:42072642-42072664 TGGCTGTCCCGGGAGAGCGCGGG - Intergenic
1147905176 17:43818004-43818026 TGGCACTCCAGGGAGGGCCCGGG - Intronic
1149981846 17:61317288-61317310 TGTGTGTCCTGGGTGGGCTCTGG - Intronic
1151423519 17:74014524-74014546 TGCCTGGAGAGGGAGGGCCCAGG + Intergenic
1151834501 17:76574109-76574131 TTTCTTGCCAGGGAGGCCCCAGG + Intronic
1151843584 17:76635263-76635285 TGTCTGTTCAGGGGGAGCTCTGG - Intronic
1151960488 17:77403006-77403028 TGTGTGTCCCTGGAGGGCCTGGG + Intronic
1152365856 17:79855926-79855948 TGTGTGTCCAAGGCGGGCACCGG - Intergenic
1153407553 18:4758026-4758048 AGTCTGTGATGGGAGGGCCCAGG + Intergenic
1153799572 18:8657622-8657644 TGCGTGACCAGGGAGGGCCAGGG - Intergenic
1153821604 18:8837057-8837079 TCTCTGGCCATGGAGGTCCCTGG - Intergenic
1155028069 18:21960356-21960378 TGCGAGTGCAGGGAGGGCCCCGG + Intergenic
1156474044 18:37394631-37394653 GGGCTGTCGTGGGAGGGCCCTGG - Intronic
1156487904 18:37478239-37478261 GGTGTGTCCAGGGAGGGTCCGGG + Intronic
1157222994 18:45840413-45840435 GGTCTGTCCAGGGAAGACCTTGG - Intronic
1157311670 18:46557483-46557505 TGTCTGTCTGGGAAGGGCCAGGG + Exonic
1159535908 18:69714355-69714377 AGTCTGTCCAGGCAGCTCCCAGG - Intronic
1160622430 18:80180485-80180507 GGTTGGTCCTGGGAGGGCCCCGG - Intronic
1160800016 19:963433-963455 TGTCAGGCCAGGGAGGGGCTGGG + Intronic
1160985642 19:1837355-1837377 GGGCTGTGCATGGAGGGCCCCGG - Intronic
1161048631 19:2150711-2150733 AGTTTCTCCAGGGACGGCCCAGG + Intronic
1161370152 19:3906807-3906829 TGTGTGTGCAGGTAGGGACCAGG - Intronic
1161417005 19:4152998-4153020 TTTCTGTCCAGGGAGTGGACAGG + Intergenic
1161460163 19:4391839-4391861 TGCCTGTCCTGGGGTGGCCCAGG + Intronic
1161590129 19:5125738-5125760 TCTCTGCCCAGGGAGGGCTCAGG + Intronic
1162060037 19:8089492-8089514 TTCCTGTCCTGGGAGGGGCCTGG + Intronic
1162791897 19:13067278-13067300 TGTCAGGCCTGGGAGGGCCAGGG + Intronic
1162936841 19:13985764-13985786 CGGCTGTCCAGGCAGGGCACAGG + Intronic
1162965551 19:14154182-14154204 CGTGTGTCCAAGGAGGGGCCAGG + Intronic
1163133251 19:15289849-15289871 TGTCTATGCAGGCAGGGACCTGG - Intronic
1164592923 19:29515963-29515985 TCTCTGTCTGGGGAGAGCCCCGG - Intergenic
1165154509 19:33778984-33779006 TGTGTGTGCAGAGAGGGCGCAGG - Intergenic
1165826648 19:38709524-38709546 TTTCTGTCCAGGGCTGGCCTCGG + Intronic
1167119845 19:47510243-47510265 TGTCTGTACAGGGCCTGCCCAGG - Intronic
1167334399 19:48875652-48875674 TGTCTGGGCAGGGCCGGCCCAGG + Exonic
1167529956 19:50009005-50009027 TCTGTGTGCAGGGAGGGGCCGGG + Intronic
1168349552 19:55668331-55668353 TATCTGACCAGTGAGGGTCCTGG - Intronic
1168406362 19:56112595-56112617 TTTCTGGGCAGGGAGGGCCACGG - Intronic
925213148 2:2068399-2068421 TGTCAGGACAGGGAGGGTCCGGG - Intronic
925511702 2:4634277-4634299 CGTGTGTCAAGGGAGGGACCTGG - Intergenic
925539943 2:4956147-4956169 TGTTTGTGCAGGAAGGACCCAGG + Intergenic
925777334 2:7347970-7347992 TGTCTGCTGAGGGAGGGCCTTGG + Intergenic
926492718 2:13544493-13544515 CATGTGTCCAGGGAGGGACCGGG + Intergenic
926706793 2:15843029-15843051 TGTCTGTCCAGGGACCTGCCTGG - Intergenic
928261042 2:29766959-29766981 TGTTTTTCCAGAGAGGGGCCAGG - Intronic
930185250 2:48406913-48406935 TGTTTGGCAAGAGAGGGCCCAGG - Intergenic
930324552 2:49899109-49899131 TGTGTGTCGAGTGAGGGACCTGG - Intergenic
930678753 2:54232869-54232891 TATATGTCAAGGGAGGGGCCTGG - Intronic
931957170 2:67440355-67440377 TGTCTTTCCAAGGAGGCTCCAGG + Intergenic
933265158 2:80173721-80173743 TGCCTGTCAAGGGAAGGCCTAGG + Intronic
935209240 2:100924153-100924175 AGTGTGTCTAGGGAGGGCTCAGG - Intronic
936568327 2:113596612-113596634 TGTGTGAGCAGGGAGGTCCCCGG - Intergenic
937849494 2:126620216-126620238 TGCCTGACCAGGGACGACCCAGG + Intergenic
937866231 2:126753461-126753483 TGTGTGTGCAGGGCAGGCCCAGG - Intergenic
938377555 2:130818808-130818830 AGGGTGTCCAGGGAAGGCCCAGG + Intergenic
941600488 2:167537301-167537323 TATGTGTCAAGGGAGGGGCCAGG - Intergenic
943276654 2:185876249-185876271 TGCCAGTCCAGGGAGGGAGCGGG + Intergenic
944665139 2:201953519-201953541 TGTCTGCACACGGATGGCCCTGG - Intergenic
948862008 2:240757205-240757227 CGCCTGCCCTGGGAGGGCCCGGG + Intronic
1170813680 20:19695241-19695263 TGTCTCTCAAGGGCTGGCCCAGG + Intronic
1173463304 20:43261329-43261351 TGTCAGTCCTGGGAGGGAGCTGG - Intergenic
1173527493 20:43744226-43744248 TGACTGTCCTGGGGGGGCTCAGG + Intergenic
1173618361 20:44417625-44417647 TGTATGTTTAGGGTGGGCCCAGG - Intronic
1174729691 20:52903571-52903593 CATCTGTCAAGGGAGGGACCAGG - Intergenic
1175282652 20:57814399-57814421 TGTCTTTCCCAGGAGGGCACGGG - Intergenic
1175791643 20:61743867-61743889 TGTCTGTCCTGTGGGAGCCCTGG - Intronic
1175905847 20:62378950-62378972 TATGTGTCCAGGAAGGGGCCTGG - Intergenic
1176092448 20:63325258-63325280 TGTGTCTCCAGGGAGAGCCCGGG + Intronic
1176375038 21:6082834-6082856 TGGCTGTGCAGGGAGGGAGCGGG + Intergenic
1176865887 21:14054962-14054984 GGTCAGGCCAGGGAGGGGCCAGG - Intergenic
1178584035 21:33858156-33858178 GGTCTGTCCAGGGTCAGCCCAGG + Intronic
1178840740 21:36135723-36135745 TGACAGTTCGGGGAGGGCCCCGG - Intronic
1179630130 21:42672607-42672629 TGTCTTTGCAGGCAGGCCCCAGG - Intronic
1179717588 21:43297807-43297829 TGGCTGTCGAGGGATGGCCAGGG - Intergenic
1179748437 21:43455411-43455433 TGGCTGTGCAGGGAGGGAGCGGG - Intergenic
1180099688 21:45578842-45578864 TGTCAGGGCAGGGAGGGACCAGG - Intergenic
1180716271 22:17874452-17874474 TGGCTGAGCAGTGAGGGCCCAGG - Intronic
1180961160 22:19763006-19763028 TCTGTGTCCAGGAACGGCCCAGG + Intronic
1180970547 22:19812684-19812706 TGGCTGTCCAGCGTGGCCCCGGG + Intronic
1182144079 22:27986152-27986174 TGGATGTCGAGGGAGGGACCTGG + Intronic
1182775885 22:32830688-32830710 TGTCTGTCCCTGCAGGGCCCTGG + Intronic
1183055362 22:35301798-35301820 TGTGTGTCCGGGGAGGGCAGGGG - Intronic
1184554373 22:45225274-45225296 GCACTGTCCAGGGAGGCCCCTGG + Intronic
1185103454 22:48854029-48854051 TCTCTGGCCAGGGAGAGGCCAGG - Intergenic
1185344153 22:50304165-50304187 TGTCTGTCTGGGGAGGAGCCTGG - Intronic
949471277 3:4399630-4399652 AATCTGTCCAGGGAGAGCCCAGG + Intronic
950141796 3:10620830-10620852 TGTGTGTCCAGGGAGGTGGCTGG - Intronic
952758612 3:36894156-36894178 AGCCAGTCAAGGGAGGGCCCAGG - Intronic
952863385 3:37833465-37833487 TGTCCGCCCAGGGAGGGATCAGG + Intergenic
953355592 3:42253841-42253863 GGTCTGTCCAGTGTGGGCCTTGG + Intergenic
954849080 3:53585232-53585254 TGCCTGCCCAGAGAGGTCCCTGG + Intronic
954983571 3:54768941-54768963 TGTCAGGCCAGGAAGGGCACTGG + Intronic
961638944 3:128352711-128352733 GGTCTGCCCAGGGAGGGGGCAGG + Intronic
962083338 3:132164151-132164173 TGTCTGTGCAGGGCGGGTCAGGG + Intronic
964299209 3:155269638-155269660 CGTGTGTCAAGGGAGGGACCTGG + Intergenic
964587198 3:158319168-158319190 CGTGTGTCAAGGGAGGGACCTGG + Intronic
965068236 3:163880413-163880435 TGTGTGTCCAGGGGGGGTCGGGG - Intergenic
965757282 3:172039881-172039903 TCCCTGTCCCGGGAGCGCCCTGG + Intronic
966946918 3:184783326-184783348 TGGCTGTTCAGGGAGGCCCGGGG + Intergenic
968576239 4:1367562-1367584 GGGCCGCCCAGGGAGGGCCCAGG + Intronic
968764188 4:2459535-2459557 TGCCTGTTGAGGGAGGGCCAGGG + Intronic
968949391 4:3682790-3682812 TGTGTGTCCTGGGTGAGCCCTGG + Intergenic
968964540 4:3763395-3763417 TGCCTGTGGTGGGAGGGCCCGGG - Intergenic
969149367 4:5155588-5155610 TACCTGTCAAGGGAGGGGCCTGG + Intronic
970933324 4:21538919-21538941 TGTGTGTCAAGGGAGAGACCTGG + Intronic
973838472 4:54835945-54835967 TGTGTGTCATGGGAGGGACCTGG - Intergenic
974931572 4:68366261-68366283 TGCATGTCAAGGGAGGGACCTGG + Intergenic
976450661 4:85186917-85186939 CGTATGTCAAGGGAGGGACCTGG - Intergenic
976590503 4:86844998-86845020 CGTGTGTCTAGGGAGGGGCCTGG - Intronic
978010878 4:103682553-103682575 TATGTGTCGAGGGAGGGACCAGG - Intronic
978235079 4:106447909-106447931 TGTGTGTCAAGGGAGAGACCAGG - Intergenic
979680527 4:123454391-123454413 TGTCTTCACAGGGTGGGCCCTGG + Intergenic
979787580 4:124735349-124735371 CATGTGTCCAGGGAGGGACCTGG + Intergenic
982321265 4:154079648-154079670 TGCCTATGCAGTGAGGGCCCAGG + Intergenic
982371073 4:154634064-154634086 CGTGTGTCCAGGAAGGGACCTGG + Intronic
982383005 4:154770190-154770212 TGTGAGTCCAGGGAGGGTCCTGG - Intergenic
982507546 4:156239320-156239342 CATGTGTCCAGGGAGGGACCTGG + Intergenic
982797727 4:159665333-159665355 TATATGTCAAGGGAGGGACCTGG - Intergenic
984700103 4:182813776-182813798 TCTGTGTCCAGGGTGGGCCAGGG + Intergenic
985834432 5:2260335-2260357 TGGATGTCCAGGCAAGGCCCTGG + Intergenic
988454377 5:31374111-31374133 TAGCTGACCAGGCAGGGCCCTGG + Intergenic
988485542 5:31665516-31665538 TATGTGTCCAGGGAGGTACCTGG + Intronic
990349874 5:54905238-54905260 TGTCAGTCACGGGAGGGACCTGG - Intergenic
993187249 5:84635890-84635912 TGTCTCTGCAGGGAGGGCTCAGG - Intergenic
995231289 5:109767191-109767213 TATCCTTCCAGGAAGGGCCCTGG + Intronic
997193925 5:131965039-131965061 TGTATCTCCAGTGAGTGCCCTGG - Intronic
998476695 5:142428045-142428067 TGTCTGCCATGGGCGGGCCCTGG - Intergenic
1001961040 5:175880512-175880534 AGCCTGTCCCGGGAAGGCCCAGG + Exonic
1002433345 5:179216969-179216991 GGTCAGTCCAAGGAGGGCACTGG - Intronic
1003005721 6:2379561-2379583 TTTCTGTCCATGGAGGGAACAGG + Intergenic
1004338683 6:14787816-14787838 TGTCTGTGCTGGAAGGGACCTGG - Intergenic
1004674831 6:17831542-17831564 TGTCTCTCCTGGGAAGCCCCTGG - Intronic
1005142456 6:22649017-22649039 TGGCTGTCCAGGAATGGACCAGG + Intergenic
1005394431 6:25366748-25366770 TGTCTGTACAGGTTGGCCCCTGG + Intronic
1005418576 6:25626766-25626788 TGTCTTCCAAGAGAGGGCCCAGG + Intergenic
1005761343 6:28970514-28970536 TGTCTGTGCAGGGTGGGGGCAGG + Intergenic
1005814343 6:29538715-29538737 TGTCTTTGCAGGGTGTGCCCAGG - Intergenic
1006361720 6:33590597-33590619 TGTCTCTCCAGTGAGGCCCATGG + Intergenic
1006411904 6:33878617-33878639 TGTCTGGCCAGCAAGGGGCCAGG - Intergenic
1006583625 6:35090940-35090962 TGTCTGACGCTGGAGGGCCCAGG - Exonic
1006896523 6:37474873-37474895 TCTCTGTGCATTGAGGGCCCTGG + Intronic
1007790553 6:44305982-44306004 TGTGTGCCCAGGGAGTACCCTGG - Intronic
1009922261 6:70076551-70076573 TGCCTGGCCAGTGAGGGACCAGG + Intronic
1011837939 6:91457045-91457067 TGCATGTCGAGGGAGGGACCTGG + Intergenic
1012433680 6:99192429-99192451 TTTCTGTCCAAGAAGGGCCTAGG - Intergenic
1015954910 6:138589344-138589366 TGGTTGTCTAGGGTGGGCCCCGG - Intronic
1015981952 6:138848134-138848156 TGTGTGTCGAGGGAGGGACCTGG - Intronic
1016020907 6:139235556-139235578 TATCTGTCAAGGGTGGGACCAGG + Intergenic
1017753884 6:157513369-157513391 TGTCAGGACAGGCAGGGCCCAGG + Intronic
1018083505 6:160278889-160278911 TGCCTGTGCAGGGAGAGGCCAGG - Intergenic
1018358111 6:163039040-163039062 TGTGTGTCGAGGGAGGGACCTGG + Intronic
1019291304 7:251861-251883 CGTCTGTCCAGGCAGGGACATGG - Intronic
1019298612 7:291534-291556 CGTCTTTCCAGGGAGGGTCCGGG - Intergenic
1019453150 7:1110037-1110059 TGTCTGGGCGTGGAGGGCCCGGG - Intronic
1019540057 7:1547353-1547375 GGTCTGGCCAGGGACGGGCCCGG - Intronic
1019729927 7:2624018-2624040 TTTCTGGTCAGGGTGGGCCCAGG - Intergenic
1020169119 7:5831505-5831527 TCTCAGTCCAGGGTGGGCCCTGG + Intergenic
1020369857 7:7419942-7419964 TGTCTTTTCAGGGAGAGCCTGGG - Exonic
1020857795 7:13451240-13451262 TACCTGTCAAGGGAGGGACCTGG - Intergenic
1021750697 7:23796143-23796165 TGTGTGTCAAGGGCAGGCCCAGG + Intronic
1021754164 7:23834599-23834621 TATGTGTCAAGGGTGGGCCCAGG + Intergenic
1022517002 7:30981276-30981298 TGTCTGACCAGGAAGGTGCCAGG - Intronic
1023793641 7:43772835-43772857 TGTGTGTCAAGGGAGGAGCCAGG - Intronic
1024219301 7:47275490-47275512 TGCCTGTCCAGCGGGAGCCCTGG + Exonic
1026019925 7:66698559-66698581 TCTCTGGGCAGGGAGGGGCCAGG + Intronic
1027350856 7:77309462-77309484 TGTCTGCCAGGGGTGGGCCCAGG + Intronic
1031524404 7:122807235-122807257 TGTCTGTGTTGGGAGGGCCATGG - Intronic
1031628121 7:124014025-124014047 TATGTGTCAAGGGAGGGACCTGG + Intergenic
1032188592 7:129749221-129749243 TGTCTGTCCAGGGAGGCAGGGGG + Intronic
1033080764 7:138294957-138294979 TGCGTGTCAAGGGAGGGGCCAGG + Intergenic
1034086128 7:148324284-148324306 TGACTTTCCAGGGGGTGCCCAGG - Intronic
1034543733 7:151776550-151776572 TGTGTCCCAAGGGAGGGCCCAGG + Intronic
1035315858 7:157997359-157997381 TGCCTGTCCTGGGAAGGCCACGG + Intronic
1035745529 8:1959915-1959937 TCCCTGTCCAGGAAGAGCCCAGG - Intergenic
1035756359 8:2035940-2035962 CCTCTGACCAGGGAGGTCCCAGG - Intergenic
1036089750 8:5652768-5652790 TGCAGGTCCAGGGAGGGGCCTGG + Intergenic
1036167199 8:6447007-6447029 GGGGTGTCCAGGCAGGGCCCGGG + Intronic
1037522326 8:19692168-19692190 TGTGTGTCGAGGGAGGGACCAGG - Intronic
1037533920 8:19807559-19807581 TGTGTGTCAAGGGAGGGACCTGG - Intergenic
1038646427 8:29365914-29365936 GGTCTGCCCAGGCAGGGCCCAGG + Intergenic
1039596431 8:38794047-38794069 TGCATGTTCAGGGAAGGCCCAGG + Intronic
1041076666 8:54175632-54175654 TGCCTGGGCAGGGAGAGCCCTGG + Intergenic
1043566758 8:81557935-81557957 TTCCTGCCCAGGGAGGGCCAAGG - Intergenic
1043734996 8:83730868-83730890 TGGCTGTCCATGGACAGCCCTGG - Intergenic
1044724486 8:95181833-95181855 TTTCTGTCCAGGCAGGGAACAGG + Intergenic
1045555742 8:103213163-103213185 GCTATGTCCAGGGAGGGACCAGG + Intronic
1046484785 8:114873589-114873611 AATGTGTCCAGGGAGGGACCTGG - Intergenic
1047357647 8:124138898-124138920 TGTGTGCTCCGGGAGGGCCCCGG + Intergenic
1047454607 8:124998109-124998131 CCTCAGTCCAGGGAGGGCGCAGG + Intergenic
1047617705 8:126576643-126576665 TATGTGTCAAGGGAGGGACCTGG - Intergenic
1047928291 8:129702041-129702063 TGTGTGTGCAGGGATGACCCTGG - Intergenic
1048681803 8:136850927-136850949 TGCATGTCGAGGGAGGGACCAGG - Intergenic
1049884203 9:16913-16935 TGTGTGAGCAGGGAGGTCCCCGG + Intergenic
1051779229 9:20670625-20670647 TGTCTGTCAAGGGAGGGACTTGG - Intronic
1051963757 9:22801021-22801043 TGCCTGTCCAGGGAGCCCCAAGG + Intergenic
1053167136 9:35852973-35852995 GGTCAGTCCAGAGTGGGCCCTGG + Exonic
1054823220 9:69544870-69544892 TCTCTACCCAGGGAGGGCCTTGG + Intronic
1054944744 9:70783950-70783972 TGTCTGTCATGGGAGGGCTGTGG - Intronic
1055659675 9:78490451-78490473 TATGTGTCGAGGGAGGGACCTGG + Intergenic
1056577121 9:87864160-87864182 GGTCTTTCCATGGAAGGCCCAGG - Intergenic
1056985768 9:91362447-91362469 TTTCCGTCCAGGAAGGGCCATGG - Intergenic
1057315343 9:93964874-93964896 TCACTGACCAGGGAGTGCCCTGG + Intergenic
1057850577 9:98564164-98564186 TGCCTGTCCATGGAGGACCCAGG - Intronic
1060207516 9:121690872-121690894 TGGCTGCCCTGGGAGGCCCCTGG - Intronic
1060470353 9:123943166-123943188 TACCTCTCCTGGGAGGGCCCAGG - Intergenic
1061277420 9:129577354-129577376 GGCCTGTGCAGGGAGGGACCCGG + Intergenic
1061477578 9:130878821-130878843 TGTCTGTGAAAGCAGGGCCCAGG - Intronic
1061528150 9:131186074-131186096 TGTCTGTCCAGGTACTGCTCAGG + Intronic
1061595760 9:131628282-131628304 GGTGTGGCCAGGGAGGGCCCTGG + Intronic
1062030457 9:134359784-134359806 TGTCTGTCCTGGAAGGTCCTGGG + Intronic
1062043918 9:134416519-134416541 TGTGTGGCCAGGGTGGGGCCGGG + Intronic
1062220219 9:135411035-135411057 CGTCTGTCCATGGAGGCCACAGG - Intergenic
1062331751 9:136047968-136047990 GGGCTGTGCAGGGAGGACCCTGG + Intronic
1062576900 9:137213061-137213083 CGACTGTCCACGTAGGGCCCAGG + Intronic
1186025298 X:5304305-5304327 CATGTGTCCAGGGAGGGGCCTGG + Intergenic
1188244045 X:27820190-27820212 TCTCAGCCCAGGGAGGTCCCAGG + Intronic
1189226894 X:39420550-39420572 TGGCGGTCCTGGGAGAGCCCAGG - Intergenic
1189236941 X:39494512-39494534 AGTCTGACCAGGGAGGGCTTGGG + Intergenic
1194020872 X:88690914-88690936 TGTGTGTCATGGGAGGGACCTGG - Intergenic
1196936205 X:120733402-120733424 CCTCTGTTCAGGGAGGACCCGGG - Intergenic
1196936451 X:120735410-120735432 CCTCTGTTCAGGGAGGACCCGGG - Intergenic
1197707984 X:129647674-129647696 AGTCAGTCCAGGGAGGGGCCAGG + Exonic
1199192179 X:144982668-144982690 TATGTGTCAAGGGAGGGACCTGG + Intergenic
1199270901 X:145881703-145881725 CATGTGTCCAGGGAGGGACCAGG - Intergenic
1199387549 X:147240675-147240697 TGTCAGTCAAGGGAGAGACCAGG - Intergenic
1199823349 X:151472528-151472550 CATCTGTCGAGGGAGGGACCTGG - Intergenic
1202366388 Y:24168602-24168624 TGACTGGCCAGGGCGGGGCCCGG - Intergenic
1202504393 Y:25501521-25501543 TGACTGGCCAGGGCGGGGCCCGG + Intergenic