ID: 1129854156

View in Genome Browser
Species Human (GRCh38)
Location 15:78811906-78811928
Sequence AACCGCTGTCTGTCCAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854156_1129854163 -6 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854156_1129854162 -7 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854156_1129854161 -8 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854156 Original CRISPR AACCGCTGTCTGTCCAGGGA GGG (reversed) Intronic
902330370 1:15728365-15728387 ACCCGCTGTCTGCCCGGGGGCGG - Intronic
902673864 1:17994686-17994708 AATCCCTATGTGTCCAGGGAGGG + Intergenic
902938725 1:19784163-19784185 AACAGCTTTCTGATCAGGGAAGG + Intronic
907586734 1:55624837-55624859 AACAGCTGTCTGTCCAGACTTGG + Intergenic
910795512 1:91093695-91093717 AACATCTGTCTGTCCATGAAAGG - Intergenic
911277358 1:95878786-95878808 AATCCCTGTGTGTCAAGGGAGGG - Intergenic
916900148 1:169213748-169213770 AACTGCTGTCTGACCAGGATGGG - Intronic
918010486 1:180582081-180582103 AACTGCTGTCATTCCAAGGATGG - Intergenic
918650077 1:186951816-186951838 AAGCGTTGGCTGCCCAGGGAAGG - Intronic
919808355 1:201394292-201394314 CCCAGCTGTCTGCCCAGGGAAGG + Intronic
921709350 1:218357714-218357736 AACAGCTGCCTGTGGAGGGATGG - Intronic
922911720 1:229223655-229223677 AGCCGCTGTCTGTCCCCTGAAGG + Intergenic
923551652 1:234968996-234969018 AAGCGATGGCTGTCCTGGGATGG - Intergenic
924002552 1:239570104-239570126 AATCCCTGTATGTCGAGGGAGGG + Intronic
1063866614 10:10372303-10372325 TATTGCTGTCTGTGCAGGGAAGG - Intergenic
1065115632 10:22480089-22480111 AATCCCCCTCTGTCCAGGGAGGG + Intergenic
1069829162 10:71272027-71272049 AAGAGCTTTGTGTCCAGGGAGGG + Intronic
1070656115 10:78272604-78272626 AACTGCTGTCTGTAAAGGGCTGG + Intergenic
1070666817 10:78350800-78350822 CACAGCTGGCTGTCCTGGGAAGG + Intergenic
1075724575 10:124604827-124604849 AACAGCTGCCTACCCAGGGAGGG - Intronic
1076726699 10:132417194-132417216 ACCGGCAGTGTGTCCAGGGAGGG + Exonic
1079542756 11:21594984-21595006 AATCCCTGTGTGTCAAGGGAGGG + Intergenic
1081417884 11:42837462-42837484 AATCCCTATGTGTCCAGGGAGGG - Intergenic
1082982736 11:59138068-59138090 AACCAGTGTGTGTACAGGGAAGG + Intergenic
1084266586 11:68008322-68008344 AACAGCTCCCTGGCCAGGGAGGG + Intergenic
1096104398 12:48988165-48988187 CACCGCTGACCGTCCAGGGATGG - Intergenic
1096215355 12:49795297-49795319 TACCACAGTCTGCCCAGGGAGGG + Exonic
1104738285 12:131153436-131153458 TAACGATGTCTGTCCAGGGAGGG - Intergenic
1104794430 12:131507361-131507383 TAACGATGTCTGTCCAGGGAGGG + Intergenic
1104887456 12:132119028-132119050 CACAGCTCTCAGTCCAGGGAAGG + Intronic
1106684010 13:32037728-32037750 AACAGCTGTCTGTTTAGGGTAGG - Intronic
1108233053 13:48370650-48370672 GACAGCTGTCTGGCCAGGGAGGG - Intronic
1111408793 13:87846418-87846440 AACAGTTGTCTGGCCAGGCACGG + Intergenic
1111626468 13:90794249-90794271 AAACCCTGTCTGGCCAGGCATGG - Intergenic
1113216343 13:108045127-108045149 AACAGCTGTCAGCCCAGGGAGGG + Intergenic
1113693542 13:112328824-112328846 AATCCCTATGTGTCCAGGGAGGG - Intergenic
1115608286 14:35027465-35027487 AACTGCTGGCTGACCAGGTACGG + Intronic
1121279308 14:92687832-92687854 ACCCGCTATCCATCCAGGGAGGG + Intronic
1125971002 15:43911751-43911773 AACCTCCAACTGTCCAGGGAGGG - Intronic
1126421193 15:48474284-48474306 TACCGCTGTCTGTGCAAGGAAGG - Exonic
1126933706 15:53683158-53683180 AATCTCTGTGTGTCAAGGGAAGG - Intronic
1129854156 15:78811906-78811928 AACCGCTGTCTGTCCAGGGAGGG - Intronic
1131096018 15:89654869-89654891 TACCGCTGTGTGCCCAGGGTCGG - Intronic
1131260810 15:90886723-90886745 TACCACTGTCAGTCCAAGGAGGG + Intronic
1132195139 15:99909235-99909257 GCCCGCTGTCTGTCCTGGGACGG + Intergenic
1132700293 16:1219392-1219414 AACCGCTGTCTGCCCACCGTGGG - Intronic
1134274003 16:12759597-12759619 AACCCCCGTGTGTCAAGGGAGGG + Intronic
1136632956 16:31499797-31499819 AGCCTCTGTCTGTCCTTGGAGGG + Intronic
1139422439 16:66856923-66856945 CACCACTGGCTGCCCAGGGAGGG - Intronic
1139716288 16:68815925-68815947 AACGGCTGTCTGTGAAGGGAAGG - Intronic
1141209105 16:81959548-81959570 AACAGCAGTCTGGCCAAGGAAGG + Exonic
1142284306 16:89165514-89165536 AACTGCTGGCTGCCCAGGGAGGG - Intergenic
1143838243 17:9710083-9710105 AGCTGCTGGCTGACCAGGGAGGG - Exonic
1146058073 17:29590956-29590978 AGCGGCTGGCTGTCGAGGGAGGG - Intronic
1147134501 17:38427499-38427521 ATCCCCTGACAGTCCAGGGAGGG - Intergenic
1147436511 17:40419861-40419883 AACCACAGTGTGTCAAGGGAGGG + Intergenic
1151478238 17:74355553-74355575 AACAGCATTCTGTCCAGGGCTGG - Exonic
1153756897 18:8293374-8293396 AGCCTCTGTGTGTCCAGAGAGGG + Intronic
1153817105 18:8800076-8800098 ACCCTCTGTCTGTCCAAGGACGG + Intronic
1157481283 18:48055506-48055528 AACGGCTGTCTGGGGAGGGAGGG + Intronic
1159697170 18:71574862-71574884 AACCCCAGTGTGTCAAGGGAGGG - Intergenic
1161067850 19:2247371-2247393 AAACGGTGACTGCCCAGGGAGGG + Intronic
1161682113 19:5685285-5685307 AACCACTTTCTGGCCAGGCACGG + Intronic
1164861384 19:31564818-31564840 AACCACTGTCCTTCCAGGAATGG + Intergenic
1165374776 19:35434055-35434077 AAACGCTTCCTGTCCAGGGAGGG + Intergenic
1166722386 19:45004206-45004228 AACCACTGTCTGGCCAGGCGAGG - Intronic
1166722433 19:45004512-45004534 AACCACTGTCTGGCCAGGCACGG - Intronic
1167264426 19:48476583-48476605 AACTGCTGTCAGGCCAGGCACGG + Intronic
1167527781 19:49995698-49995720 AACAGCTGGCTATCCAGGGAAGG + Intronic
925161336 2:1686131-1686153 AAGGGCTGTATGTCCAGGGAGGG - Intronic
926088790 2:10036736-10036758 AACCGCCGACTGGCCTGGGAGGG - Intergenic
927708083 2:25309295-25309317 AGGAGCTGTATGTCCAGGGAGGG + Intronic
933265156 2:80173715-80173737 ACCTGCTGCCTGTCAAGGGAAGG + Intronic
937111392 2:119369199-119369221 AAACTCTGTCCTTCCAGGGAGGG + Intronic
938939924 2:136161243-136161265 GACTGCTGTGTGTCCGGGGATGG + Intergenic
942776719 2:179590650-179590672 AATCCCTGTGTGTCAAGGGAGGG + Intronic
945440310 2:209870806-209870828 CAGCTCTGCCTGTCCAGGGAAGG + Intronic
1171983441 20:31643158-31643180 AACAGTTGGCTGGCCAGGGAAGG - Intronic
1175286400 20:57839733-57839755 AACGGCTTTCAGGCCAGGGAGGG - Intergenic
1175893775 20:62327139-62327161 GAGCGGGGTCTGTCCAGGGAGGG - Intronic
1178169377 21:30021591-30021613 GACAGCTGTCTATCCAGAGAGGG + Intergenic
1181416138 22:22760285-22760307 AACAGGTGTCAGGCCAGGGATGG + Intronic
1183438996 22:37812658-37812680 AACCAAAGTCTGCCCAGGGAGGG + Intronic
1183505785 22:38208151-38208173 AATTGCTGTCTGTCCAGGAGGGG - Intronic
952474879 3:33698118-33698140 AACCGCTGCCTGTGCAGGAAAGG + Intronic
954021353 3:47744975-47744997 AACTGCTATCTGGCCAGGCACGG + Intronic
956167928 3:66410316-66410338 ATTTGCTGTCTGTCCAGTGAAGG - Intronic
957066298 3:75525136-75525158 AACTGTGGTCTGTCCAGGCATGG + Intergenic
968916500 4:3499178-3499200 AACACCTGCCTGTCCAGGGGAGG - Intronic
969194402 4:5549004-5549026 AATCACTGTCTATTCAGGGAGGG - Intronic
971768102 4:30860242-30860264 GACCTCTCTCTCTCCAGGGAGGG + Intronic
972495450 4:39629915-39629937 AACTGCTTTCTGGCCAGGTATGG - Intronic
972633114 4:40858767-40858789 AACAGTTGTCTTTCTAGGGAGGG + Intronic
973339760 4:48992277-48992299 ACCCTCTGTCTGTACAGGCAAGG - Intronic
974016903 4:56656202-56656224 AACAGCGCTCAGTCCAGGGAGGG - Intronic
982383008 4:154770196-154770218 AATCCCTGTGAGTCCAGGGAGGG - Intergenic
995893255 5:116981391-116981413 AATCGCCATATGTCCAGGGAAGG + Intergenic
996045161 5:118863903-118863925 AACCCATGTCTGTCCAGCCAAGG + Intronic
996459432 5:123724810-123724832 AGCCACTGTCTGTGCATGGAGGG + Intergenic
996570547 5:124928780-124928802 AACCGCTGTCACTCCATGTATGG - Intergenic
998194426 5:140055403-140055425 CACCCCTGTATGTCGAGGGAAGG - Intergenic
999189937 5:149739731-149739753 AAATGCAGTCTGTCCAGGGGTGG - Intronic
1001107936 5:168871379-168871401 AACCGCTGCCTGCCTAGGGTAGG - Intronic
1001788260 5:174432364-174432386 AATTGCTGGGTGTCCAGGGAGGG + Intergenic
1004891464 6:20104964-20104986 AACAGCTGTTTAACCAGGGAAGG + Intronic
1013974532 6:116061603-116061625 AACCACTGCCTGTCTAGAGATGG - Intergenic
1015981955 6:138848140-138848162 AATCCCTGTGTGTCGAGGGAGGG - Intronic
1018643961 6:165930656-165930678 AAACGCTGGCTGTGCATGGAAGG + Intronic
1019751098 7:2730357-2730379 CACCGCTGTGTGTGCACGGACGG + Exonic
1022488263 7:30797137-30797159 AACAACTGGCTCTCCAGGGATGG - Intronic
1025210923 7:57019278-57019300 GACAGCTGCCTGCCCAGGGATGG + Intergenic
1025611742 7:63080673-63080695 AACCTGCTTCTGTCCAGGGAGGG - Intergenic
1025661032 7:63557569-63557591 GACAGCTGCCTGCCCAGGGATGG - Intergenic
1026816936 7:73521159-73521181 AACCTGTGTCTGCCCAGGGAAGG + Intronic
1026863565 7:73809493-73809515 GGCCTCTGTCTGTCCGGGGATGG + Intronic
1027294744 7:76757533-76757555 AATCTCTGTCTGTCCAGTAATGG - Intergenic
1029254349 7:99259280-99259302 AACCATTTTCTTTCCAGGGATGG - Intergenic
1029381715 7:100219638-100219660 CACCCCTTGCTGTCCAGGGAAGG + Intronic
1029443800 7:100602151-100602173 AACCCCACTCTGTCCAGTGAGGG - Intergenic
1031406403 7:121392494-121392516 AATCCCTGTGTGTCGAGGGAGGG - Intronic
1035653376 8:1286073-1286095 AATCGCTGTGTGTCAAGGGCAGG + Intergenic
1035696613 8:1602673-1602695 AACTGCTGTCACTCCTGGGAAGG - Intronic
1035793123 8:2325925-2325947 TGCCGCTGTCTGTCCATGGTGGG + Intergenic
1035799681 8:2395780-2395802 TGCCGCTGTCTGTCCATGGTGGG - Intergenic
1035845120 8:2855088-2855110 AACCCCTGTGTGTTGAGGGAGGG + Intergenic
1036182039 8:6594075-6594097 GACAGCTGGCTGTCCAGGCAAGG + Intronic
1036201679 8:6775724-6775746 CACCCCTGTTTCTCCAGGGAGGG - Intergenic
1037533923 8:19807565-19807587 AATCCCTGTGTGTCAAGGGAGGG - Intergenic
1038962206 8:32534161-32534183 AAATGCTGTCTGCCCTGGGAAGG + Intronic
1039102081 8:33951593-33951615 AGCCGCTGCCTGGCCAAGGAGGG - Intergenic
1039880187 8:41620876-41620898 AGCCTTTGTCTCTCCAGGGATGG + Exonic
1039895320 8:41713032-41713054 GACACGTGTCTGTCCAGGGAGGG + Intronic
1041727204 8:61029491-61029513 AACCCCTTTCTGCCCAGGGATGG + Intergenic
1045398661 8:101787980-101788002 AACCCCTGTCTAACCAGGTAAGG + Intronic
1046203960 8:110964772-110964794 AACAGCTGGCTTTCCAGGAATGG - Intergenic
1047410957 8:124624313-124624335 ACCCGCTTTCTGAGCAGGGAAGG + Intronic
1049213613 8:141397873-141397895 GCCCGCTCTCTGTCCAGGGTCGG + Intronic
1056515211 9:87343425-87343447 AACCTGTGTCAGTCCAGAGACGG - Intergenic
1057130911 9:92654098-92654120 CACCGCTGTCTGCCCATGCATGG + Intronic
1057294647 9:93828056-93828078 AACCGCTGGCGGCCCAGGGCGGG + Intergenic
1059283316 9:113152536-113152558 AACTGCTCTCTGGCCAGGGCAGG + Intronic
1061746674 9:132745302-132745324 AACCGCGGGCTGCCCAGGGCCGG + Intronic
1061862476 9:133475170-133475192 AACCCCTGGCGGTCCAGGGCAGG - Intronic
1061867464 9:133500278-133500300 AATCCCTGTGTGTCCAGGGAGGG + Intergenic
1061883054 9:133577608-133577630 AGCCCCTCTCTGCCCAGGGAAGG - Intergenic
1200311828 X:155086128-155086150 CACAGCTGTCTGTCCAGTGCTGG + Intronic