ID: 1129854157

View in Genome Browser
Species Human (GRCh38)
Location 15:78811907-78811929
Sequence CAACCGCTGTCTGTCCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 106}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854157_1129854163 -7 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854157_1129854161 -9 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854157_1129854162 -8 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854157 Original CRISPR CAACCGCTGTCTGTCCAGGG AGG (reversed) Intronic
902303392 1:15519160-15519182 CAACCGATGGCTGGCCACGGTGG - Intronic
904557493 1:31374710-31374732 CAGCAGCAGCCTGTCCAGGGTGG + Intronic
909236745 1:73162220-73162242 CAACCCCTGTGAGTTCAGGGTGG - Intergenic
916900149 1:169213749-169213771 CAACTGCTGTCTGACCAGGATGG - Intronic
920841887 1:209562139-209562161 CACCCCCTGTGTTTCCAGGGTGG - Intergenic
921298308 1:213725218-213725240 CTACTGCAGTCTGTCCACGGTGG + Intergenic
922689988 1:227680592-227680614 CAACCACTGTGTGTTCGGGGTGG - Intergenic
1067082214 10:43218201-43218223 CAAGAGCTGTGTGTCTAGGGAGG - Intronic
1073176430 10:101560224-101560246 CAATCGCAGTGTGTCCATGGGGG - Intergenic
1074875839 10:117612715-117612737 CAATCTCTTTCTGTCCATGGGGG - Intergenic
1075192163 10:120319498-120319520 CAGCAGCTGTGTGTCCAGGATGG + Intergenic
1075724576 10:124604828-124604850 CAACAGCTGCCTACCCAGGGAGG - Intronic
1076408989 10:130232597-130232619 CAACTCCTGTCTGCCCAGGCTGG - Intergenic
1081417885 11:42837463-42837485 CAATCCCTATGTGTCCAGGGAGG - Intergenic
1081717362 11:45259795-45259817 CACCCGCTTCCTGTCCAGGGAGG - Intronic
1084266585 11:68008321-68008343 CAACAGCTCCCTGGCCAGGGAGG + Intergenic
1086823731 11:91469867-91469889 CAAGCTCTGTCTGACTAGGGTGG - Intergenic
1087542827 11:99542785-99542807 CAACCACTGACTGAGCAGGGTGG - Intronic
1092751931 12:11727196-11727218 CAACAGCTCTCAATCCAGGGTGG - Intronic
1096215354 12:49795296-49795318 CTACCACAGTCTGCCCAGGGAGG + Exonic
1101150552 12:101878757-101878779 CAACCAATGCCTGTCCAGAGGGG - Intronic
1104738286 12:131153437-131153459 CTAACGATGTCTGTCCAGGGAGG - Intergenic
1104794429 12:131507360-131507382 CTAACGATGTCTGTCCAGGGAGG + Intergenic
1106192714 13:27467635-27467657 CAACCACTGGCTGGCCAAGGTGG - Intergenic
1106554389 13:30797638-30797660 CAACCTCTGGCTGTACAGTGAGG - Intergenic
1106664897 13:31841442-31841464 CAACCACAGACTGTCCATGGTGG - Intergenic
1108233054 13:48370651-48370673 GGACAGCTGTCTGGCCAGGGAGG - Intronic
1112030025 13:95448535-95448557 CCAGCTCTTTCTGTCCAGGGGGG - Intronic
1113216342 13:108045126-108045148 TAACAGCTGTCAGCCCAGGGAGG + Intergenic
1113404759 13:110027993-110028015 CAAAGGCTGTCTGTGCAGTGAGG - Intergenic
1117664228 14:58039594-58039616 CCACTGCTGTCAGTTCAGGGAGG - Intronic
1119266791 14:73267471-73267493 CAACTGCTGTCTGTGCACAGAGG + Intronic
1120946876 14:90006318-90006340 CATCAGCTGTGTTTCCAGGGTGG - Intronic
1121279307 14:92687831-92687853 CACCCGCTATCCATCCAGGGAGG + Intronic
1127609093 15:60619886-60619908 CTACGGCTGTCTGTCCATTGAGG - Intronic
1127927603 15:63561994-63562016 CAGAGGCTGTCTGTCTAGGGTGG + Intronic
1128506276 15:68275253-68275275 CAGTGGCTTTCTGTCCAGGGAGG + Intergenic
1129854157 15:78811907-78811929 CAACCGCTGTCTGTCCAGGGAGG - Intronic
1131260809 15:90886722-90886744 CTACCACTGTCAGTCCAAGGAGG + Intronic
1131570967 15:93535602-93535624 CAAGACCTGTGTGTCCAGGGAGG + Intergenic
1132700294 16:1219393-1219415 AAACCGCTGTCTGCCCACCGTGG - Intronic
1132864314 16:2086033-2086055 CACCCGATGTCTGGCCTGGGTGG + Intronic
1136632955 16:31499796-31499818 CAGCCTCTGTCTGTCCTTGGAGG + Intronic
1138178940 16:54929783-54929805 CAACCACTGTTTGTTCAGCGAGG - Intergenic
1139422440 16:66856924-66856946 CCACCACTGGCTGCCCAGGGAGG - Intronic
1139483260 16:67242393-67242415 CCCCAGCTGTCTGTCCTGGGTGG + Intronic
1142284307 16:89165515-89165537 GAACTGCTGGCTGCCCAGGGAGG - Intergenic
1144034930 17:11356555-11356577 CCACAGCTGTCAGTCAAGGGAGG - Intronic
1146849731 17:36211899-36211921 CAACCCCTGGCTGCCCTGGGAGG + Intronic
1147134502 17:38427500-38427522 CATCCCCTGACAGTCCAGGGAGG - Intergenic
1152220448 17:79061739-79061761 TGACTGCTGACTGTCCAGGGTGG - Intergenic
1155908013 18:31475874-31475896 TAACCGCTGTCTTTAGAGGGTGG - Exonic
1161067849 19:2247370-2247392 CAAACGGTGACTGCCCAGGGAGG + Intronic
1162406147 19:10475107-10475129 CATCAGCTGGCTCTCCAGGGTGG + Intergenic
1163223624 19:15939502-15939524 CAAGGGCTCTCTGCCCAGGGAGG - Intergenic
1165029908 19:32990478-32990500 CCACCACTGACTGCCCAGGGAGG + Intronic
1165374775 19:35434054-35434076 AAAACGCTTCCTGTCCAGGGAGG + Intergenic
1166206673 19:41274373-41274395 CAACCCCTGTGTGTACAGGGCGG - Intronic
1166366183 19:42279774-42279796 CAACTCCTGCCTTTCCAGGGCGG - Intronic
1167150674 19:47707540-47707562 CAACTGCTGTGAGTCCAGGTGGG + Intergenic
925161337 2:1686132-1686154 AAAGGGCTGTATGTCCAGGGAGG - Intronic
929267750 2:39938130-39938152 CAACAGCTGTCTGCCCAGGTAGG + Intergenic
931255940 2:60572881-60572903 AAAACTCTGACTGTCCAGGGAGG + Intergenic
932175836 2:69600897-69600919 TAACTGCTGACTGACCAGGGGGG - Intronic
933155728 2:78971141-78971163 TAACCTTTGACTGTCCAGGGAGG - Intergenic
936093039 2:109512944-109512966 CAGCCTCTTTCTGTCCTGGGTGG + Intergenic
1170898181 20:20435341-20435363 TACGCGCTGTCTGCCCAGGGTGG - Intronic
1173901894 20:46596314-46596336 GAACCTCTGTCTCCCCAGGGTGG + Exonic
1174102504 20:48138281-48138303 CTCCCGCTCTCTGTCCTGGGAGG + Intergenic
1183265692 22:36823903-36823925 AAACCGCTGACTCTCCAGGAAGG + Intergenic
1183505786 22:38208152-38208174 GAATTGCTGTCTGTCCAGGAGGG - Intronic
1183579880 22:38717752-38717774 CTCCCACTGTCTGTCCAGGGAGG - Intronic
1183773171 22:39944437-39944459 CAGCTGCTGTTTGTTCAGGGTGG - Intronic
967961747 3:194931052-194931074 AAACCGCTCTCTTTCCAGGAAGG - Intergenic
968616429 4:1579555-1579577 CAGCCTCTGTGTGACCAGGGCGG + Intergenic
969194403 4:5549005-5549027 CAATCACTGTCTATTCAGGGAGG - Intronic
969636201 4:8370633-8370655 CAACCTCTGCCTGTGCAGGCGGG + Intronic
972702018 4:41503476-41503498 CAAAGGCTGTCTGTCCTGGTTGG - Intronic
974016904 4:56656203-56656225 CAACAGCGCTCAGTCCAGGGAGG - Intronic
975857837 4:78643221-78643243 CACCTGCTGTCTGGCCAGTGAGG - Intergenic
978704503 4:111690694-111690716 CACCCGCTGTGTTTCCATGGAGG + Intergenic
982299152 4:153861102-153861124 CAACCGCTGGCTGGGCATGGTGG - Intergenic
983216978 4:165010930-165010952 CAACAACTTTCTGTCCTGGGTGG - Intergenic
995244922 5:109924394-109924416 CATCCTCTGTCTTCCCAGGGTGG + Intergenic
996459431 5:123724809-123724831 CAGCCACTGTCTGTGCATGGAGG + Intergenic
998417523 5:141956583-141956605 CCACTGCTCTCTGTCCAGTGTGG + Exonic
1000323991 5:160158194-160158216 CACCCGCTCTCTGTCCTTGGTGG - Intergenic
1002058048 5:176609960-176609982 CACCCGCTGTCTTTCCGGGCGGG - Intronic
1002857912 6:1054804-1054826 CAACCGGTGTCTGGGGAGGGAGG - Intergenic
1006143673 6:31945769-31945791 CAGCCACTGTTTGTCCAGTGGGG - Exonic
1006380092 6:33692321-33692343 AACCCTCTGTCTGGCCAGGGAGG - Intronic
1007150738 6:39688280-39688302 CATCTGCTGTCTGTCCTGGTAGG - Intronic
1007836627 6:44678815-44678837 CAGCCCCTGCCTGTCCAGAGTGG + Intergenic
1010729275 6:79371364-79371386 TAACTGCTGACTGTTCAGGGAGG - Intergenic
1013001429 6:106026621-106026643 CAGCCTCTGGCTGTCCAGTGTGG + Intergenic
1022791456 7:33693376-33693398 CAGACTCTGTCTGTCCAGGGAGG - Intergenic
1025611743 7:63080674-63080696 CAACCTGCTTCTGTCCAGGGAGG - Intergenic
1029485944 7:100840504-100840526 CAACCGCTGTGTGTTGGGGGCGG - Intronic
1035564627 8:633171-633193 CAGCCTCCGTCTGTCCTGGGCGG - Intronic
1035628303 8:1090083-1090105 CCACCCCTGTCTGCCCAGGAGGG - Intergenic
1035628318 8:1090149-1090171 CCACCCCTGTCTGGCCAGGAGGG - Intergenic
1035628334 8:1090215-1090237 CCACCCCTGTCTGGCCAGGAGGG - Intergenic
1035793122 8:2325924-2325946 ATGCCGCTGTCTGTCCATGGTGG + Intergenic
1035799682 8:2395781-2395803 ATGCCGCTGTCTGTCCATGGTGG - Intergenic
1036201680 8:6775725-6775747 CCACCCCTGTTTCTCCAGGGAGG - Intergenic
1036571022 8:9979968-9979990 GAACTGGTGACTGTCCAGGGAGG + Intergenic
1037634901 8:20692823-20692845 CAAATGCTGCCTTTCCAGGGTGG + Intergenic
1041168905 8:55120378-55120400 CAACAGAGGTCTTTCCAGGGTGG - Intronic
1042877440 8:73452097-73452119 CAGGAGCTGTCTGTCTAGGGCGG - Intronic
1048896825 8:138999845-138999867 CAACCCCTGTCCTTCCAGGCAGG + Intergenic
1049735619 8:144203064-144203086 CGCCCGCTGTCTGTGGAGGGGGG + Intronic
1057294646 9:93828055-93828077 GAACCGCTGGCGGCCCAGGGCGG + Intergenic
1060277465 9:122192829-122192851 CAAGCTCTGTTTGCCCAGGGTGG + Intronic
1061867463 9:133500277-133500299 TAATCCCTGTGTGTCCAGGGAGG + Intergenic
1061939162 9:133874832-133874854 CAACTGCAGACTGTCCAGGCAGG + Intronic