ID: 1129854158

View in Genome Browser
Species Human (GRCh38)
Location 15:78811910-78811932
Sequence GGGCAACCGCTGTCTGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854158_1129854163 -10 Left 1129854158 15:78811910-78811932 CCCTGGACAGACAGCGGTTGCCC 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854158 Original CRISPR GGGCAACCGCTGTCTGTCCA GGG (reversed) Intronic
901652138 1:10749090-10749112 GGGCTCCTGCTGTCTGTGCAGGG - Intronic
903362243 1:22783949-22783971 GGGCAAGGGCTGTCTCTCCCTGG + Intronic
904599762 1:31666918-31666940 GGGCAACTGCGCTCTGTTCATGG + Intronic
910846756 1:91611704-91611726 GGGCACCCACAGTCTCTCCAAGG + Intergenic
920052302 1:203171513-203171535 GCTCACCCGCTGGCTGTCCAGGG + Exonic
923048053 1:230369744-230369766 GGACCAGCACTGTCTGTCCATGG - Intronic
1070278706 10:75033216-75033238 GGGCACCCTCTGTCTGCACAAGG - Intergenic
1070656114 10:78272600-78272622 TGGCAACTGCTGTCTGTAAAGGG + Intergenic
1070785527 10:79160161-79160183 GGGCAAACGCTGCCTGTCTCTGG + Intronic
1072737082 10:97886362-97886384 GGGCAGCGGCTGCCTCTCCATGG - Intronic
1075027149 10:118993805-118993827 TGGAAACCTCTGACTGTCCAGGG - Intergenic
1077264752 11:1643034-1643056 GGGCAACCGCTGAGACTCCAGGG + Intergenic
1079322693 11:19464609-19464631 GGGCAACCACTGTCTAAACAAGG - Intronic
1081717364 11:45259798-45259820 GGCCACCCGCTTCCTGTCCAGGG - Intronic
1082863808 11:57880005-57880027 GTGCAACTGCTGTCTTCCCATGG + Intergenic
1083657351 11:64235897-64235919 GGGCACCAGCTGTTTGGCCACGG - Exonic
1084331856 11:68435173-68435195 GGGGAAGCTCTGTCTGTCAAGGG - Intronic
1098783706 12:74722351-74722373 GGGCAACTGCTGTATGTCCTTGG + Intergenic
1102200312 12:111053432-111053454 GGGGAAATGCTGTGTGTCCATGG - Intronic
1110681755 13:78322111-78322133 AGGTTACCACTGTCTGTCCACGG + Intergenic
1122061477 14:99139324-99139346 GGGCAAGGGCTGCCTGTCCCGGG - Intergenic
1122372988 14:101239297-101239319 GGGCCACCGCAGTGTGTGCATGG + Intergenic
1122772929 14:104105227-104105249 GGGCAACCCCTGACTGTGCCCGG + Intronic
1124400619 15:29344726-29344748 GGGGACACGCTGTCTGTCCCAGG - Intronic
1125505068 15:40263088-40263110 GGGGAACCACTGGCTGTCCAGGG + Intronic
1129373767 15:75114703-75114725 GAGGAACCGCTGTCTGTCACAGG + Intronic
1129854158 15:78811910-78811932 GGGCAACCGCTGTCTGTCCAGGG - Intronic
1130541858 15:84826301-84826323 GGGCAATGTTTGTCTGTCCATGG - Intronic
1131260808 15:90886719-90886741 AGGCTACCACTGTCAGTCCAAGG + Intronic
1135493899 16:22934689-22934711 GGGCAACTGCTGTCTCGCTATGG - Intergenic
1139422442 16:66856927-66856949 GGGCCACCACTGGCTGCCCAGGG - Intronic
1139423865 16:66866703-66866725 GGGCCCCCACTGTCTGTTCAGGG - Intronic
1141536580 16:84685337-84685359 GGGCTAACGCTGCCGGTCCAGGG + Intergenic
1150937428 17:69652086-69652108 GGTCAACTGCTGTCTAGCCAGGG - Intergenic
1151478239 17:74355557-74355579 TGGCAACAGCATTCTGTCCAGGG - Exonic
1152569876 17:81116975-81116997 GGGCAATGTCTGTCTGTCCCTGG - Exonic
1155652103 18:28154770-28154792 AGGCAACTGAAGTCTGTCCATGG - Intronic
1155928378 18:31681371-31681393 GGGCTACAGCAATCTGTCCATGG + Intronic
1161435051 19:4258171-4258193 GGGCAAACCCTGTCTGGCCTCGG - Intronic
1163920609 19:20285091-20285113 GGCCACCCGCAGTCGGTCCATGG - Intergenic
1167291205 19:48626069-48626091 GCGCAGCCGCTGTATGTGCAGGG - Exonic
1168129081 19:54305922-54305944 GGGTACCTTCTGTCTGTCCAAGG - Intergenic
925098536 2:1226994-1227016 GGGCACCTGCTTTCTGTCCAGGG - Intronic
929992577 2:46802350-46802372 GGGCAGCCGATGACTGGCCACGG - Intergenic
930324720 2:49900887-49900909 GGGTAACCGCTTTGTTTCCATGG - Intergenic
936092048 2:109507709-109507731 TGGCAGCAGCTGTTTGTCCAGGG + Intergenic
947716353 2:232340849-232340871 GGGCAATCCCTGGCTGTGCACGG - Intronic
1173177693 20:40777102-40777124 AGGCAACCGACGACTGTCCATGG + Intergenic
1176204086 20:63878754-63878776 ACGAAACCGCTGTCTGTCCAGGG + Intronic
1184138605 22:42564325-42564347 GGGCATTCACTGTCTGACCAAGG - Intronic
952827809 3:37538520-37538542 GGCCAGCCCCTGTCTGTCCCTGG - Intronic
978025796 4:103872588-103872610 AGTCAACCTCAGTCTGTCCAGGG - Intergenic
988792877 5:34624628-34624650 GGACAACCCCTGTCTGTCCAGGG - Intergenic
998173390 5:139885564-139885586 GGGCAACCGCTGGAGGGCCAGGG + Intronic
999702100 5:154237539-154237561 GGGGAACCGGGATCTGTCCAAGG - Intronic
1000686339 5:164254567-164254589 GGGCCACCTCTGTGTGTCCCTGG - Intergenic
1011988826 6:93486486-93486508 GAGCAACCTGTGTCCGTCCAGGG + Intergenic
1018213161 6:161501821-161501843 AGGAAACCCCTGTCTGTCCAAGG - Intronic
1020013943 7:4820445-4820467 GGGCAGCCCCTGCCTGTCCATGG - Intronic
1026662250 7:72312484-72312506 GGCCCAGCGCTGTCTGTCCTGGG - Intronic
1032265197 7:130365756-130365778 GGGGAACCGCTTTCTGTGCGTGG + Intronic
1035272816 7:157730490-157730512 GGGCAACCGCTGTCACCCCTGGG - Intronic
1037703813 8:21298231-21298253 GGGCCATCGCTGTATGTCCCAGG - Intergenic
1037766682 8:21776409-21776431 GGGCACCTGCTGTGTGTCCTGGG - Intronic
1041182832 8:55266283-55266305 GAGCAACCCCTGTGTTTCCATGG + Intronic
1042751101 8:72158519-72158541 GGGAAACAGCAGTGTGTCCAGGG - Intergenic
1049735507 8:144202765-144202787 GAGCACCCGCTGTCTGTGGAGGG + Intronic
1049735530 8:144202829-144202851 GGGCACCCGCTCTCTGTGGAGGG + Intronic
1052861754 9:33441980-33442002 GAGCATCCACTGACTGTCCAAGG - Exonic
1055414472 9:76065556-76065578 CGGCAAACTCTGTCTGACCAGGG - Intronic
1056247998 9:84717521-84717543 GGCCCACATCTGTCTGTCCAGGG - Intronic
1056575256 9:87851503-87851525 GGTCAGCAGCTGTCTGTCCTGGG + Intergenic
1061746673 9:132745298-132745320 GGGGAACCGCGGGCTGCCCAGGG + Intronic
1061883055 9:133577612-133577634 GGGCAGCCCCTCTCTGCCCAGGG - Intergenic
1190202122 X:48371338-48371360 GGGCCACCGCAGTCTGGCCTGGG - Intergenic
1190208416 X:48424075-48424097 GGGCCACCGCAGTCTGGCCTGGG + Intergenic