ID: 1129854160

View in Genome Browser
Species Human (GRCh38)
Location 15:78811918-78811940
Sequence AGACAGCGGTTGCCCGCGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 40}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854147_1129854160 25 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129854149_1129854160 24 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40
1129854154_1129854160 -5 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 40

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854160 Original CRISPR AGACAGCGGTTGCCCGCGCG AGG Intronic
900373972 1:2344914-2344936 AGACAGCGTCAGCCCCCGCGAGG + Intronic
903398265 1:23019482-23019504 CGACGGCGGTTGGCGGCGCGCGG + Exonic
903728351 1:25469914-25469936 AGTCAGAGGTTGGCCGGGCGCGG - Intronic
908473997 1:64470770-64470792 AGACGGCCGTGGCCCGGGCGCGG + Exonic
908599101 1:65719560-65719582 AGTCAGCGGATGCCCGCCCATGG - Intergenic
1069942279 10:71964142-71964164 AGACAGCGGCTCCCCGGGGGCGG + Intergenic
1070198007 10:74176719-74176741 AGCCAGGGGCCGCCCGCGCGCGG + Intronic
1090466300 11:126937608-126937630 AAACAGCAGTTGGCCGGGCGTGG + Intronic
1103806381 12:123576887-123576909 AGACAGTGGTTGCCAGGGCTGGG + Intergenic
1129104927 15:73300437-73300459 AGACAGCTGTTGGCCGGGCGCGG + Intronic
1129854160 15:78811918-78811940 AGACAGCGGTTGCCCGCGCGAGG + Intronic
1138190325 16:55009185-55009207 AGACAGCACTTGCCCGCGCTCGG + Intergenic
1146025010 17:29312576-29312598 AGACAGTGGTTGGCCGGGTGCGG - Intergenic
1152324033 17:79625177-79625199 AGGCAGTGGTTGCCCGGGGGTGG - Intergenic
1155249503 18:23941224-23941246 AGAGAGAGGTTGGCCGGGCGCGG - Intronic
1160439703 18:78879826-78879848 AGACAGCTGTGGCCCGAGCTGGG - Intergenic
1161646406 19:5455933-5455955 AGAGAGCGGTTGCCCAGTCGCGG - Exonic
1166824821 19:45602177-45602199 ACCCAGCGGATGCCCCCGCGGGG + Exonic
936433011 2:112481177-112481199 AGCCAGCGGTTGCCTGCAGGTGG + Intergenic
948609281 2:239156566-239156588 AGACAGCGGTGGGCCCTGCGTGG + Intronic
1170071244 20:12371433-12371455 AGACAGAGGTTGCCAGGGCTGGG + Intergenic
1174503899 20:51004577-51004599 AGGTAGCTGTTGCCCGCGCCGGG + Exonic
1174736891 20:52973227-52973249 AGACAGCGGGCCCCAGCGCGCGG + Exonic
1176293703 21:5059516-5059538 AGGCAGCGGTTGCCCTGGCCAGG + Intergenic
1179863556 21:44204132-44204154 AGGCAGCGGTTGCCCTGGCCAGG - Intergenic
954746685 3:52791477-52791499 AGACAGCGGTTACCATCTCGGGG - Intronic
961542886 3:127611987-127612009 AGTCAGCTGTTGGCCGGGCGCGG - Intronic
969413281 4:7043238-7043260 AGGCGGCGGTGGCCGGCGCGGGG + Intronic
976346077 4:84003186-84003208 AGACATCGGTTGCCCTGGGGAGG + Intergenic
979596574 4:122541514-122541536 AGACAGCGGTTCCAGGCTCGAGG - Intergenic
983682677 4:170371740-170371762 AGACAGCAGTTGCCAGAGCAGGG + Intergenic
986085571 5:4441919-4441941 AGACAGAGGTGGGCCGGGCGCGG + Intergenic
1004516505 6:16326432-16326454 AGACAGCCATAGCCCGGGCGTGG - Exonic
1007038910 6:38703158-38703180 AGTCAGCGGTCTCCCGCCCGCGG - Intergenic
1019481151 7:1267419-1267441 AGACAGCGGGTGTCCCCACGGGG + Intergenic
1020073271 7:5241296-5241318 AGACAGCGTTTGCTGGTGCGGGG - Intergenic
1023812920 7:43926413-43926435 AGCCTGCGCTTGCGCGCGCGGGG - Intergenic
1029055052 7:97732847-97732869 AGGCAGCGGTTGCGTGCGAGAGG + Intronic
1042271922 8:66963135-66963157 AAAGAGCGGTGGCCCCCGCGGGG - Intergenic
1043760698 8:84063814-84063836 ACTCAGCTGTTGCCCGCCCGAGG - Intergenic
1062160048 9:135075126-135075148 ACAGAGGGGTTGCCCGCGCTGGG - Intergenic
1196362895 X:114887729-114887751 AGCCAGCTGTTGGCCGGGCGCGG + Intronic
1198530705 X:137548098-137548120 CGCCAGCGGATGCCGGCGCGAGG - Intergenic