ID: 1129854161

View in Genome Browser
Species Human (GRCh38)
Location 15:78811921-78811943
Sequence CAGCGGTTGCCCGCGCGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 65}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854156_1129854161 -8 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854149_1129854161 27 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854154_1129854161 -2 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854157_1129854161 -9 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65
1129854147_1129854161 28 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG 0: 1
1: 0
2: 1
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854161 Original CRISPR CAGCGGTTGCCCGCGCGAGG TGG Intronic
902793796 1:18787256-18787278 CAGTGGTTGCCCTCGGAAGGAGG + Intergenic
903728350 1:25469911-25469933 CAGAGGTTGGCCGGGCGCGGTGG - Intronic
904618562 1:31762771-31762793 CCGGGGTTGCCCGCGGGAGAAGG + Intronic
911664368 1:100537357-100537379 CAGTGGTTGCCCGAGTTAGGGGG - Intergenic
914845390 1:151281193-151281215 GAGCGGCTGCGTGCGCGAGGTGG + Intronic
1066273581 10:33846745-33846767 CAGCGGGTGCCCTGGGGAGGCGG - Intergenic
1067843698 10:49701912-49701934 CAGTGGTTGGCCGGGCGTGGTGG + Intronic
1078180252 11:9004619-9004641 CAGAGGGTGCCCGGGGGAGGAGG - Intergenic
1078659925 11:13278158-13278180 CAGCGGCAGCCCCCGCGAGGAGG - Intronic
1081652236 11:44832185-44832207 CAGTGGCTGCCCGTGCTAGGTGG + Intronic
1084161706 11:67353699-67353721 CAGCTGTGGGCCGCGGGAGGAGG + Intronic
1084284257 11:68121295-68121317 CGGCGGTTGGGCGCGCGGGGCGG + Intronic
1089533987 11:119149604-119149626 CAGAGGCTGCCCGCTCTAGGAGG - Intronic
1090466301 11:126937611-126937633 CAGCAGTTGGCCGGGCGTGGTGG + Intronic
1091591732 12:1846557-1846579 CAGGGATTGCCCTCCCGAGGTGG + Intronic
1092204687 12:6607555-6607577 CAGTGGTTGCCTGAGCGACGAGG - Intergenic
1102785331 12:115599766-115599788 CAGCGGTTGTCGGAGGGAGGAGG + Intergenic
1118586733 14:67360299-67360321 CAGCGCTTGCGCATGCGAGGAGG + Exonic
1121255294 14:92526166-92526188 GAGCTATTGCCCGGGCGAGGTGG + Intronic
1124081482 15:26502028-26502050 CAGCTGTTGCCTGCCCAAGGAGG - Intergenic
1124355952 15:28994911-28994933 CAGCTGATGCCCCCGGGAGGAGG + Intronic
1129104928 15:73300440-73300462 CAGCTGTTGGCCGGGCGCGGTGG + Intronic
1129854161 15:78811921-78811943 CAGCGGTTGCCCGCGCGAGGTGG + Intronic
1132255505 15:100373247-100373269 GAGGGGTTTCCCGCGGGAGGTGG + Intergenic
1132663813 16:1072846-1072868 CAGGGGGTGCCCGCGCGGGAGGG - Intergenic
1135839703 16:25864024-25864046 CAGAGGATGCCCACGCGAAGAGG - Intronic
1137696939 16:50468075-50468097 CAGCGGCCGCCAGCGGGAGGGGG - Intergenic
1139853781 16:69965442-69965464 CTGCGCATGCCCGCGGGAGGTGG + Intergenic
1139882759 16:70188355-70188377 CTGCGCATGCCCGCGGGAGGTGG + Intergenic
1140369751 16:74407164-74407186 CTGCGCGTGCCCGCGGGAGGTGG - Intergenic
1141456431 16:84145272-84145294 CAGCGGTTGCCTGGGCGACCGGG + Intronic
1144597195 17:16580629-16580651 CAGCTGTTGGCCGGGCGCGGTGG + Intergenic
1146809958 17:35895193-35895215 CAGTGGTTGGCCGGGCGCGGTGG - Intergenic
1147110365 17:38257153-38257175 CGGCGGTCGCCCGCGCTCGGTGG - Intergenic
1148419145 17:47531278-47531300 CGGCGGTCGCCCGCGCTCGGTGG + Exonic
1149296277 17:55265037-55265059 CAGCGGCCGCCGGCGCGGGGAGG + Exonic
1150764737 17:67993931-67993953 CCGCGGCTGCCCGAGCGCGGAGG - Intergenic
1158294360 18:55978582-55978604 CAGAGGTTGTCCGGGCGTGGTGG + Intergenic
1160325858 18:77948004-77948026 CAGCGGTTGCTCCCGGGATGAGG + Intergenic
1166111805 19:40627259-40627281 CAGCGGGTGCCCGGGCCAGGTGG - Exonic
927156554 2:20224464-20224486 CCGCGGTGGCCGGGGCGAGGAGG + Intronic
932661549 2:73657535-73657557 TAGTGGTTGCCAGGGCGAGGCGG - Intergenic
948737891 2:240021680-240021702 CAGCAGCTGCCCGCTAGAGGGGG - Intronic
948975844 2:241463427-241463449 CAGAGGCTTCCTGCGCGAGGTGG + Exonic
1172656335 20:36541024-36541046 CAGCGGTCGCCCGCCAGAGCGGG - Intergenic
1180089251 21:45525372-45525394 CAGCAGAGGCCCGCGAGAGGTGG + Intronic
1180235885 21:46459140-46459162 CCGCGGGTGCCCGCTGGAGGCGG + Exonic
1180627276 22:17202410-17202432 TAGCTGTTGGCCGGGCGAGGTGG - Intronic
954240812 3:49292092-49292114 CAGGGGTTGGCCGGGCGTGGTGG - Intronic
961542885 3:127611984-127612006 CAGCTGTTGGCCGGGCGCGGTGG - Intronic
962217388 3:133534376-133534398 CAGTGGTTGCCAGCGTCAGGGGG - Intergenic
969413351 4:7043468-7043490 CGGCGGTTGCTCGTGCGCGGCGG + Exonic
976346078 4:84003189-84003211 CATCGGTTGCCCTGGGGAGGAGG + Intergenic
983822522 4:172212956-172212978 CAGTGGTTGGCCGGGCGTGGTGG - Intronic
988511483 5:31868156-31868178 CAGCTGTTGGCCGGGCGCGGTGG + Intronic
1003188311 6:3851413-3851435 CAGCAGTTGCCAGCAGGAGGGGG + Intergenic
1004216757 6:13711203-13711225 CAGCGGCTGCCCCCGCCAGCGGG - Exonic
1006257660 6:32844278-32844300 CAGCGGATGCCCGGGCCTGGAGG - Intronic
1006687153 6:35845109-35845131 CAGTGGTTGCCAGCGAGTGGGGG + Intronic
1006915390 6:37590797-37590819 CAGCGGTGGCCCAGGCCAGGTGG - Intergenic
1012062782 6:94510173-94510195 CAGCAGTTGCCTGGGAGAGGAGG + Intergenic
1013792688 6:113855134-113855156 AAGCAGATGGCCGCGCGAGGGGG - Intergenic
1033602813 7:142900732-142900754 CAGCGATGGGCCGGGCGAGGTGG + Intergenic
1035751698 8:2001393-2001415 CAGCGGTGGCCCGCGGGTGGTGG + Exonic
1043760697 8:84063811-84063833 CAGCTGTTGCCCGCCCGAGGAGG - Intergenic
1049396489 8:142403332-142403354 CTGCGGGTGCGCGCGCGAGTCGG + Intergenic
1056738925 9:89236063-89236085 AAGTGGTTGCCAGAGCGAGGAGG + Intergenic
1062349873 9:136133369-136133391 CAGCGCTCGCCAGCGCCAGGGGG + Intergenic
1192499316 X:71639071-71639093 CAGAGGTTGGCCGGGCAAGGTGG - Intergenic
1199772832 X:150984709-150984731 CAGCGGCGGCCCGGGCGGGGCGG - Intronic