ID: 1129854162

View in Genome Browser
Species Human (GRCh38)
Location 15:78811922-78811944
Sequence AGCGGTTGCCCGCGCGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854149_1129854162 28 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854156_1129854162 -7 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854147_1129854162 29 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854157_1129854162 -8 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26
1129854154_1129854162 -1 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG 0: 1
1: 0
2: 0
3: 0
4: 26

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854162 Original CRISPR AGCGGTTGCCCGCGCGAGGT GGG Intronic
904178447 1:28648303-28648325 AGCGGCTGCGCGAGCGAGGGAGG - Intergenic
912682741 1:111739404-111739426 AGCGGCTAGCCGCGCGCGGTCGG + Exonic
1069581862 10:69572164-69572186 TGCTGCTGCCCGCGCGAAGTGGG - Exonic
1072915826 10:99536895-99536917 AGCTGTTGGCCGCGCGAAGGCGG + Intergenic
1081652237 11:44832186-44832208 AGTGGCTGCCCGTGCTAGGTGGG + Intronic
1083246056 11:61429431-61429453 AGCGGTGGGCGGCGCGAGGCCGG - Intronic
1119483612 14:74974722-74974744 AGCTGTTGGCTGCGGGAGGTGGG + Intergenic
1121074935 14:91060253-91060275 CGCGGGTGCCCGCGCGGGGCTGG - Intronic
1129854162 15:78811922-78811944 AGCGGTTGCCCGCGCGAGGTGGG + Intronic
1139853782 16:69965443-69965465 TGCGCATGCCCGCGGGAGGTGGG + Intergenic
1139882760 16:70188356-70188378 TGCGCATGCCCGCGGGAGGTGGG + Intergenic
1140369750 16:74407163-74407185 TGCGCGTGCCCGCGGGAGGTGGG - Intergenic
1148161360 17:45451965-45451987 TGCGGTTGGCCCCGCGAGGATGG - Intronic
1162798089 19:13096786-13096808 GGCGCCTGCCCGGGCGAGGTCGG + Intronic
925342712 2:3148142-3148164 ATCCGTTGCCTGCCCGAGGTGGG - Intergenic
931355774 2:61537257-61537279 AGCGGGGCCCCGCGCGGGGTGGG - Intronic
932661548 2:73657534-73657556 AGTGGTTGCCAGGGCGAGGCGGG - Intergenic
1171488005 20:25497767-25497789 GGCGCTTGCCAGCGCCAGGTGGG - Intronic
1179714794 21:43281077-43281099 AGCGGTTGCCTGTGGCAGGTAGG + Intergenic
1180089252 21:45525373-45525395 AGCAGAGGCCCGCGAGAGGTGGG + Intronic
1181676448 22:24456906-24456928 AGTGGTTGCCTGGGCCAGGTTGG + Intergenic
1006829896 6:36962219-36962241 CGGGGGGGCCCGCGCGAGGTGGG + Intronic
1018062636 6:160102675-160102697 AGCGGGTGGCAGGGCGAGGTGGG + Intronic
1022481238 7:30744370-30744392 AGGAGTTGCCAGAGCGAGGTGGG - Intronic
1029055053 7:97732851-97732873 AGCGGTTGCGTGCGAGAGGATGG + Intronic
1034526964 7:151670883-151670905 TGCTGTTGGCCGCGCGTGGTTGG + Intronic
1049766553 8:144357952-144357974 AGCGGTGGCCCGGGCGGGGGCGG - Intronic