ID: 1129854163

View in Genome Browser
Species Human (GRCh38)
Location 15:78811923-78811945
Sequence GCGGTTGCCCGCGCGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854147_1129854163 30 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854149_1129854163 29 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854156_1129854163 -6 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854157_1129854163 -7 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854154_1129854163 0 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854158_1129854163 -10 Left 1129854158 15:78811910-78811932 CCCTGGACAGACAGCGGTTGCCC 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854163 Original CRISPR GCGGTTGCCCGCGCGAGGTG GGG Intronic