ID: 1129854163

View in Genome Browser
Species Human (GRCh38)
Location 15:78811923-78811945
Sequence GCGGTTGCCCGCGCGAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 58}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129854149_1129854163 29 Left 1129854149 15:78811871-78811893 CCTGCTTCAAAGCTATCTGCGGA 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854147_1129854163 30 Left 1129854147 15:78811870-78811892 CCCTGCTTCAAAGCTATCTGCGG 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854158_1129854163 -10 Left 1129854158 15:78811910-78811932 CCCTGGACAGACAGCGGTTGCCC 0: 1
1: 0
2: 1
3: 6
4: 68
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854154_1129854163 0 Left 1129854154 15:78811900-78811922 CCTGGGCCCTCCCTGGACAGACA 0: 1
1: 0
2: 2
3: 44
4: 334
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854156_1129854163 -6 Left 1129854156 15:78811906-78811928 CCCTCCCTGGACAGACAGCGGTT 0: 1
1: 0
2: 0
3: 18
4: 127
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58
1129854157_1129854163 -7 Left 1129854157 15:78811907-78811929 CCTCCCTGGACAGACAGCGGTTG 0: 1
1: 0
2: 0
3: 8
4: 106
Right 1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG 0: 1
1: 0
2: 0
3: 4
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129854163 Original CRISPR GCGGTTGCCCGCGCGAGGTG GGG Intronic
904618564 1:31762773-31762795 GGGGTTGCCCGCGGGAGAAGGGG + Intronic
910657535 1:89633464-89633486 GTGGTTGCCCGCCCGGCGTGTGG + Intronic
914393469 1:147242667-147242689 GCGCTTGGCCGCGCGGGGCGGGG + Exonic
1072491177 10:95907565-95907587 GCGGTCGCCCGCGCAGGGCGTGG - Intronic
1072715977 10:97752942-97752964 GCGGCAGCCCCCACGAGGTGTGG - Intronic
1077328129 11:1972415-1972437 GCGGTGCCCGGCACGAGGTGGGG - Intronic
1202811108 11_KI270721v1_random:27595-27617 GCGGTGCCCGGCACGAGGTGGGG - Intergenic
1094375325 12:29783420-29783442 GCGGCGGCTAGCGCGAGGTGAGG + Intronic
1105827316 13:24134028-24134050 GTGGTTGCTGGCGGGAGGTGGGG + Intronic
1113710560 13:112461728-112461750 GCGCCTGCCCCCGAGAGGTGAGG - Intergenic
1121074934 14:91060252-91060274 GCGGGTGCCCGCGCGGGGCTGGG - Intronic
1126348356 15:47718826-47718848 GCGGCTGCCGGCGCGAGCGGCGG - Exonic
1126823637 15:52528847-52528869 GCGGCCGCCCAGGCGAGGTGCGG - Exonic
1129854163 15:78811923-78811945 GCGGTTGCCCGCGCGAGGTGGGG + Intronic
1131160561 15:90102285-90102307 GCGGCTGCTCTTGCGAGGTGGGG + Exonic
1133212687 16:4272173-4272195 GCGGCTCCCGGCGCGGGGTGGGG - Intronic
1139584521 16:67893355-67893377 CCCGCCGCCCGCGCGAGGTGAGG + Exonic
1145764865 17:27451633-27451655 GCGGTGGCCCAGGCCAGGTGGGG - Intergenic
1146438794 17:32876449-32876471 GCGCTTCCCCGCGCCAGGTGAGG - Intronic
1148161359 17:45451964-45451986 GCGGTTGGCCCCGCGAGGATGGG - Intronic
1153565670 18:6414926-6414948 GAGGGTGCACGCGCGGGGTGGGG + Intronic
1162514278 19:11138778-11138800 GCGGCTGCCAGAGGGAGGTGGGG + Intronic
1163727655 19:18931926-18931948 ACAGTTGCCCGGGCCAGGTGGGG + Intronic
1165780830 19:38433533-38433555 GCCGTTGGCCGCCGGAGGTGGGG - Intergenic
1165851234 19:38851411-38851433 GGGGCTGCCCGCGCAGGGTGTGG + Intronic
925342711 2:3148141-3148163 TCCGTTGCCTGCCCGAGGTGGGG - Intergenic
932661547 2:73657533-73657555 GTGGTTGCCAGGGCGAGGCGGGG - Intergenic
943642851 2:190378234-190378256 GCGGTTGCCAGTGCCTGGTGGGG - Intergenic
1171488004 20:25497766-25497788 GCGCTTGCCAGCGCCAGGTGGGG - Intronic
1175720451 20:61282961-61282983 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720452 20:61282998-61283020 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720453 20:61283037-61283059 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720454 20:61283076-61283098 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720455 20:61283115-61283137 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720456 20:61283154-61283176 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720457 20:61283193-61283215 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720458 20:61283232-61283254 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720459 20:61283271-61283293 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720460 20:61283310-61283332 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1175720461 20:61283340-61283362 GCGTTTGCACGCGCGTGCTGTGG + Intronic
1181147457 22:20858913-20858935 GCGGTTGCGCGCGCCGGATGTGG + Intronic
1184060779 22:42079736-42079758 GCGGGTGCCCGGGTGAGGGGCGG + Exonic
954401352 3:50321360-50321382 GTGGCGCCCCGCGCGAGGTGAGG - Exonic
954680737 3:52344631-52344653 GCAGGTGCCTGAGCGAGGTGAGG + Exonic
955298716 3:57756953-57756975 GAGGTTCTCCGCGCGAGGCGTGG - Exonic
968835839 4:2963743-2963765 GGAGTTGCGCGCGCGAGGCGAGG + Exonic
974549120 4:63349233-63349255 GCTGCTGCCCGCGCCAGGTGAGG + Intergenic
976475251 4:85475613-85475635 GCGGCTGCCTGCGCCAGGGGAGG + Intronic
1005826053 6:29632533-29632555 GCGGAGCCCCGCGCGGGGTGGGG + Intronic
1016738552 6:147506825-147506847 GCGGCGGCCCGCGCGGGGCGGGG + Intergenic
1018062637 6:160102676-160102698 GCGGGTGGCAGGGCGAGGTGGGG + Intronic
1019198681 6:170296742-170296764 GCAGGAGCCCGCGCGGGGTGGGG + Intronic
1019689671 7:2403629-2403651 GCGGCTGCGGGCGCGAGGTGAGG + Exonic
1022481237 7:30744369-30744391 GGAGTTGCCAGAGCGAGGTGGGG - Intronic
1035199178 7:157249243-157249265 GTGGCTGCCTGCGGGAGGTGGGG - Intronic
1040032962 8:42842921-42842943 GCGCGTGTCCGCGCGAGGGGCGG - Intronic
1044591622 8:93917859-93917881 GCTGCTGCCCGCGCGGGTTGTGG + Intronic
1049229930 8:141476740-141476762 GCTCTTGCCTGAGCGAGGTGGGG - Intergenic
1049744079 8:144255758-144255780 GCGTGTGCACGCGCGTGGTGGGG + Intronic
1057432372 9:95005415-95005437 GCGGGTGGCCTCCCGAGGTGCGG + Intronic
1058176051 9:101737779-101737801 GCGGCTGGCCGCGCGGGGGGCGG + Exonic
1186107968 X:6226915-6226937 GCGGGTGCCAGCGCGGGCTGTGG + Intronic
1198482318 X:137052430-137052452 GGGGTGGCCCGCGGGCGGTGCGG + Intergenic