ID: 1129857120

View in Genome Browser
Species Human (GRCh38)
Location 15:78832305-78832327
Sequence AAACTGAAGCCAGAGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 435}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129857120_1129857129 14 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857129 15:78832342-78832364 TTTGGGGATGAGATGAATCCTGG 0: 1
1: 0
2: 2
3: 18
4: 163
1129857120_1129857124 -3 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857124 15:78832325-78832347 TTTCCCCATTTGAAAAGTTTGGG 0: 1
1: 1
2: 2
3: 76
4: 555
1129857120_1129857130 15 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857130 15:78832343-78832365 TTGGGGATGAGATGAATCCTGGG 0: 1
1: 0
2: 1
3: 15
4: 158
1129857120_1129857132 27 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857132 15:78832355-78832377 TGAATCCTGGGGACTCTGCCAGG 0: 1
1: 0
2: 2
3: 29
4: 219
1129857120_1129857131 16 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857131 15:78832344-78832366 TGGGGATGAGATGAATCCTGGGG 0: 1
1: 0
2: 3
3: 16
4: 258
1129857120_1129857123 -4 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857123 15:78832324-78832346 GTTTCCCCATTTGAAAAGTTTGG 0: 2
1: 0
2: 28
3: 224
4: 1536
1129857120_1129857125 -2 Left 1129857120 15:78832305-78832327 CCCATCTCCTCTGGCTTCAGTTT 0: 1
1: 0
2: 4
3: 44
4: 435
Right 1129857125 15:78832326-78832348 TTCCCCATTTGAAAAGTTTGGGG 0: 1
1: 0
2: 1
3: 26
4: 296

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129857120 Original CRISPR AAACTGAAGCCAGAGGAGAT GGG (reversed) Intronic
900319963 1:2078167-2078189 AGACTGTAGGCAGAGGAGAGAGG - Intronic
901445414 1:9305236-9305258 AAAGTGAAGCGAGAGGGTATGGG - Intronic
901874296 1:12158190-12158212 AAACTGAGGCCAGAGTTCATAGG + Intergenic
902600810 1:17539483-17539505 AAACTGAGGCCCGCGGGGATGGG - Intergenic
902727419 1:18346532-18346554 AAGCAGAAGCCACAGGACATGGG + Intronic
902747744 1:18484499-18484521 AGCCAGAAGCCAGGGGAGATGGG + Exonic
902989568 1:20177161-20177183 AAACAGAAGCAAGAGGACGTTGG + Intronic
904148104 1:28411450-28411472 AAAATGGAGACAGAGGAGAATGG - Intronic
904292277 1:29495660-29495682 AGACTTAGGCCAGAGGAGTTGGG + Intergenic
904407962 1:30305933-30305955 AAAATGGAGTCAGAGGAGAAAGG - Intergenic
905536487 1:38726413-38726435 GAACTGAATCCAGAGGACCTTGG + Intergenic
906092575 1:43194266-43194288 CAACGGAAGCCAGAAGAGAATGG - Intronic
906813532 1:48853623-48853645 AAACTGAAAGCAGAAGAGAGAGG + Intronic
908836709 1:68235427-68235449 AAACTGAAACCTAAGGAGTTAGG - Intergenic
910982616 1:92974058-92974080 AAACTAAAGCCAGAGAAATTAGG - Intergenic
911316160 1:96359129-96359151 AACCAGAAGCCAGAGAACATGGG + Intergenic
911778288 1:101842773-101842795 AAACTGCAGAGAGAGGAGTTCGG - Intronic
911947717 1:104134167-104134189 AAAATGAAGCCAAAGGAAGTGGG - Intergenic
912037251 1:105333874-105333896 AAACTGAGGCAAGTGGAGAAAGG + Intergenic
912233369 1:107821621-107821643 AAATGGAAGACAGAGGAGGTTGG + Intronic
912877010 1:113370493-113370515 AAACAGAAGCCAGAGGGCACAGG + Intergenic
913057916 1:115179250-115179272 GAAAAGAAGCCAGAGGAGAGAGG + Intergenic
913500292 1:119466843-119466865 AAAGGGATGCCGGAGGAGATGGG + Intergenic
914343739 1:146780941-146780963 GAGCTGAAGCCAGAGCAGAGAGG - Intergenic
916568695 1:166006409-166006431 ACCCTAAAGCCAGAAGAGATTGG - Intergenic
917334876 1:173916550-173916572 CAACCGAAGGCAGTGGAGATGGG - Intronic
918041042 1:180913728-180913750 AGGCTGAAGCCAGAGGAGGCCGG - Intronic
919419106 1:197349430-197349452 TAAATAAAGCAAGAGGAGATAGG - Intronic
919568920 1:199221770-199221792 CAACTGAAGCCTGGGGAGACAGG + Intergenic
919787278 1:201267569-201267591 AAACTGAAGTTAGAGCAGTTAGG + Intergenic
920212312 1:204337108-204337130 TCACAGAAGGCAGAGGAGATTGG - Intronic
920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG + Intronic
920608035 1:207409067-207409089 AATCTGAAGCCACAGTAGAGTGG - Intergenic
920866853 1:209760247-209760269 AACCTGGAGCTAGAGGAGAAGGG + Exonic
921304364 1:213781076-213781098 AAAGAGAAGCCAGAGAAGAGTGG + Intergenic
921487427 1:215731863-215731885 CATCTGTAGTCAGAGGAGATAGG + Intronic
922241289 1:223756924-223756946 AAACTGAGGCCAGAGAGGAGAGG + Intronic
922429860 1:225540515-225540537 AAAATGAAGGCAGTGAAGATAGG + Intronic
924092408 1:240515029-240515051 AAAATGAAGCCACATTAGATAGG + Intronic
924738674 1:246781587-246781609 AACCTGAAGCCACAGGAGGAGGG + Intergenic
924847702 1:247789749-247789771 AAAATGCAGACAGAGGAGAAGGG - Intergenic
924917486 1:248587768-248587790 AAACTAAATCAAGAGGAAATAGG + Intergenic
1063444645 10:6103187-6103209 AAACTGGTGCCAGAACAGATTGG - Intronic
1064241907 10:13638378-13638400 AAACAGAAGAGATAGGAGATAGG + Intronic
1064257755 10:13758715-13758737 ACACTGAAGGGAGAGGAGAGTGG - Intronic
1064356803 10:14626251-14626273 ATATTGAAGACAGAGGAGAAGGG - Intronic
1064852494 10:19724717-19724739 AAACTTTTGCCAGAGGAAATGGG + Intronic
1067523528 10:47025471-47025493 AGACTGAAGCCAGATGGGGTGGG + Intergenic
1067524802 10:47031828-47031850 AGCCTGGAGCCAGGGGAGATGGG + Intergenic
1067900752 10:50239044-50239066 AAACTGAAGACAGAAGTGAGCGG - Intronic
1069096746 10:64268519-64268541 AAACTGAAGTCAAAGAAGTTTGG - Intergenic
1070706803 10:78645718-78645740 ACACAGAAGCCAGTGGAGAGAGG + Intergenic
1071910459 10:90226496-90226518 CAGGTTAAGCCAGAGGAGATAGG - Intergenic
1072422108 10:95297707-95297729 AAGGTGGACCCAGAGGAGATGGG - Intergenic
1073036051 10:100564938-100564960 AATCTGTAGACAGAGGACATAGG + Intergenic
1073107580 10:101041087-101041109 CCACTGAAGCCAGAGGTCATGGG - Exonic
1073980758 10:109151064-109151086 AATTTGAAGCCAGAAGAGCTTGG + Intergenic
1077328625 11:1974293-1974315 AGCCTCAACCCAGAGGAGATGGG - Intronic
1077639432 11:3868055-3868077 ATACAGCAGCCAGGGGAGATGGG + Intronic
1077942988 11:6863508-6863530 AAACTGATGCCCAAGGAGAGAGG - Intergenic
1079915658 11:26365678-26365700 AGGCTGAAGCCAGAGCAGCTGGG + Intronic
1080397384 11:31902702-31902724 CAACTGAAGCCAGAGGCACTAGG + Intronic
1081521935 11:43890275-43890297 ATGCTGAAGCTAGAGGAGACTGG - Intronic
1081536814 11:44002464-44002486 AAACATAAGCCAGAGGAAAGTGG - Intergenic
1081541675 11:44039124-44039146 AAACAAATGACAGAGGAGATGGG + Intergenic
1083040821 11:59684558-59684580 AAATTGTAGCCAGAAGAGTTTGG + Intergenic
1083266150 11:61547779-61547801 AAACTGAGGCCAGGAGAGGTAGG - Intronic
1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG + Exonic
1083615322 11:64023346-64023368 AAACTGAGGCCCCAGGAGGTGGG - Intronic
1084429007 11:69101126-69101148 AACCTGAGGCCAGTGGAGAAGGG - Intergenic
1084465572 11:69321100-69321122 AAAAGGAAGCCAGAGGGCATGGG - Intronic
1085033536 11:73286900-73286922 AAACTGAGGCCAGAGAGGTTAGG - Intronic
1085879417 11:80448278-80448300 TAACTCAAGAAAGAGGAGATGGG - Intergenic
1087693863 11:101353349-101353371 AAACTATAGCCAGAGAAGTTAGG - Intergenic
1088090585 11:106034817-106034839 CACCTGAACACAGAGGAGATAGG - Intergenic
1088236240 11:107727278-107727300 AAACGGAAGCCAGAGAACAATGG - Intergenic
1088471860 11:110195460-110195482 TAACTGAAATCAGAGAAGATGGG + Intronic
1089068059 11:115677251-115677273 AAAAGGAAGCAAGAAGAGATAGG - Intergenic
1089114220 11:116081151-116081173 AGACTGAAGACAGAGGAGACAGG - Intergenic
1089358485 11:117871127-117871149 AAGCTGAAGTCAAAGGAGAGAGG - Intronic
1089628138 11:119764713-119764735 ATACTGAGGCCAGAGCAGGTGGG + Intergenic
1089651915 11:119920173-119920195 AAACTGAGGCCCAGGGAGATGGG + Intergenic
1089742231 11:120592606-120592628 GATCTGAAGCCAGAGGAGGCAGG - Intronic
1090041478 11:123296033-123296055 AAAATGAAGGCAGGGGAGAGAGG + Intergenic
1090076179 11:123581357-123581379 AAACTAAAGCCAGAGGATGAGGG + Intronic
1090127191 11:124099317-124099339 AAGCTGAAGCCAGGAGAGAAGGG - Intergenic
1091075746 11:132614397-132614419 AGACTGAAGCCTGAGAAAATAGG + Intronic
1202811604 11_KI270721v1_random:29472-29494 AGCCTCAACCCAGAGGAGATGGG - Intergenic
1091531425 12:1360075-1360097 AAAAAGATGCCAGAGGAGAAGGG - Intronic
1091660705 12:2381129-2381151 AAACTGAGGACAGAGGAGTGAGG - Intronic
1092097135 12:5852087-5852109 AGACAGAAGAAAGAGGAGATAGG + Intronic
1092488023 12:8919639-8919661 GGACAGAAACCAGAGGAGATGGG - Intronic
1093306529 12:17527610-17527632 CAGCTGAAGCCAGAGCTGATGGG - Intergenic
1093442353 12:19213616-19213638 AAATTGAAGGAGGAGGAGATAGG + Intronic
1093573359 12:20695310-20695332 GAACAGAAGCCAGAGGAGGGCGG - Intergenic
1094497643 12:30998512-30998534 AGACTGAAGCCAGAGGGAAAAGG - Intergenic
1094751550 12:33415476-33415498 AAATTAAAGCAAGAGGATATAGG - Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1095675018 12:44906557-44906579 ACACTGAATTCAGAGTAGATAGG + Intronic
1096016634 12:48282197-48282219 AAATGGAAGCCAGAGGACAAAGG + Intergenic
1098480563 12:70954122-70954144 AAACAGAAACCAGAGAAAATAGG - Intergenic
1099362236 12:81718430-81718452 AAACTGAAGCTAGATGAAAGGGG + Intronic
1099732554 12:86524419-86524441 TAACAGTAGCCAGAGTAGATTGG - Intronic
1100023045 12:90094904-90094926 AAACTGAAGCAAGGAGAGATTGG + Intergenic
1100331217 12:93584083-93584105 AAACAGAACCCAGAGTGGATTGG + Intergenic
1100514704 12:95315964-95315986 ACACAGAAGCCAGAGGAGGAAGG + Intergenic
1101318143 12:103648767-103648789 ATACTGAACCCAGAGGAAAATGG + Exonic
1102625593 12:114233087-114233109 AACCTGAAGCCAGAGGGCAAGGG - Intergenic
1102717164 12:114984257-114984279 AAACTGAGGCCAGTGCAGAAAGG + Intergenic
1103522589 12:121546352-121546374 AAAAAAAAGACAGAGGAGATGGG - Intronic
1103878624 12:124148797-124148819 AAACAGAAGCCACAGGAAAAAGG - Intronic
1104549162 12:129740056-129740078 ATACTGAGGCCAGAAGAGAGAGG - Intronic
1105821665 13:24085978-24086000 AGACTGAAGCAAGTGGAGAGAGG + Intronic
1106371936 13:29142981-29143003 AAACAAAAACCAGAGAAGATTGG + Intronic
1106748900 13:32736811-32736833 AAACTGAAGCATGAGGAGGCTGG - Intronic
1108434698 13:50390220-50390242 AAATGGAAGCCAGAGGAAAAGGG + Intronic
1108893572 13:55294571-55294593 AAGCTGGAGCCAGAGTAGCTGGG - Intergenic
1109305771 13:60639579-60639601 CAATGGAAGCCAGAGGAGAGTGG - Intergenic
1110406158 13:75152593-75152615 AAACTGAGGGCAGGGGAGAGAGG - Intergenic
1110870777 13:80450330-80450352 AAACTGAAACCAGTGGAGATTGG - Intergenic
1111116434 13:83784104-83784126 AAACTGAAGTGAGAGTGGATAGG + Intergenic
1112248159 13:97753365-97753387 AAACAGAAGGCAAAGGAGTTGGG - Intergenic
1114467628 14:22935353-22935375 AAACTGAGGCCAGAAGGGTTAGG - Intergenic
1115296630 14:31835021-31835043 CAAGTGAAGCCAGAGGAAACTGG + Intronic
1117252952 14:53953752-53953774 CACCTGAAGCCAGAGGATTTGGG + Intronic
1118012270 14:61621999-61622021 AAACAAAAGCCAGAGGACAAGGG + Intronic
1118730532 14:68662954-68662976 CAACTGAAGCCAGAGGGCAAGGG - Intronic
1119198319 14:72733627-72733649 AAACAGAAGCGAGAGGGGAAGGG + Intronic
1119851845 14:77871865-77871887 AAACTGAGGCCAGAGATGTTAGG + Intronic
1119938753 14:78618051-78618073 AAACAGTAGACAGAGAAGATGGG - Intronic
1120418429 14:84250418-84250440 AAACTGGATCCAGAGGGAATGGG + Intergenic
1120509432 14:85395792-85395814 ACACTCAAGACAGAGGAGAAGGG + Intergenic
1120766060 14:88327061-88327083 AAACAGAAGAGGGAGGAGATGGG + Intergenic
1121262627 14:92577485-92577507 AAAGTGAAAACAGAGAAGATGGG - Intronic
1121610318 14:95274235-95274257 AAACCAAAACCAGAGGAGACGGG - Intronic
1122031764 14:98917488-98917510 ACACTGAAGCCAGAGAAGTCTGG - Intergenic
1122127893 14:99588940-99588962 AAACTGAGGCCTGGGGAGACTGG + Intronic
1122604193 14:102937623-102937645 AAACTGAGGCCAGAGCAGTGTGG + Intronic
1122852224 14:104542250-104542272 GAGATGAAGCCACAGGAGATAGG + Intronic
1122861682 14:104585298-104585320 AAACTGAGGCCAGAGGGGGCTGG - Intronic
1123132006 14:105994886-105994908 AAACTGAAATCTGAGAAGATAGG + Intergenic
1123405928 15:20019426-20019448 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1123515258 15:21026074-21026096 AGACAGAAGCCAGATGAGGTCGG - Intergenic
1124474182 15:30017654-30017676 ACCCTTAAGCCAGAAGAGATTGG - Intergenic
1126192460 15:45892224-45892246 AATCTCACGACAGAGGAGATGGG - Intergenic
1126281611 15:46958070-46958092 AATCAGAAGCCAGAGGTTATGGG + Intergenic
1126398825 15:48248134-48248156 AAGCAGAAGGCAGAGGACATTGG + Intronic
1127119626 15:55759876-55759898 AAACTGATGCCAGATGACAGTGG - Intergenic
1128248114 15:66146894-66146916 AAAACAAAGGCAGAGGAGATGGG - Intronic
1129184437 15:73897450-73897472 AAGCTGTAGCCACAGGAGAGAGG + Intergenic
1129499298 15:76020186-76020208 ATAGAGAGGCCAGAGGAGATAGG - Intronic
1129857120 15:78832305-78832327 AAACTGAAGCCAGAGGAGATGGG - Intronic
1130434118 15:83879963-83879985 AAACTGAAGTCAGAAGACAATGG - Intronic
1131055925 15:89374934-89374956 AAAAAGAGGCCAGAGCAGATGGG - Intergenic
1131399038 15:92110002-92110024 AAACTGACGAAAGAGGAGAAAGG + Intronic
1132410518 15:101574852-101574874 AAAATCAAGCCAGAGGGGCTGGG - Intergenic
1133930860 16:10231102-10231124 AAACAGAAGACAGAGGAGAAGGG + Intergenic
1134055473 16:11167231-11167253 AAATTGTAGCCAGAGGAGCAGGG + Intronic
1135400274 16:22162319-22162341 AAACTGAAGCCAGTAGGGCTGGG - Intergenic
1136183834 16:28573301-28573323 GCCCTGAAGCCAGAGGAGAAGGG + Intronic
1136912755 16:34158669-34158691 CAACTGAAACCACAGGAGCTCGG + Intergenic
1138392878 16:56682997-56683019 AAAATGAAGGGAGAGGAGATGGG + Intronic
1138723098 16:59104944-59104966 AAACAGGAGCAAGAGGAGATGGG - Intergenic
1139305773 16:65984997-65985019 AAACTGAGGCCAGAGTGGAAAGG - Intergenic
1139387907 16:66586080-66586102 AGACTGAAGTCACAGGGGATGGG + Intronic
1139476011 16:67202905-67202927 AAGCTGAAGCCAGAGCTCATGGG + Exonic
1139535611 16:67571047-67571069 AAACTGAAGACAGAAAAAATTGG - Intronic
1139990254 16:70934393-70934415 GAGCTGAAGCCAGAGCAGAGAGG + Intronic
1140288945 16:73632329-73632351 AAACTTAAGCCCAAAGAGATAGG + Intergenic
1141536379 16:84683855-84683877 ACACAGAAGCCAGGGGAGGTCGG + Intergenic
1144501538 17:15791438-15791460 CAACTGAAGTTAGAGTAGATGGG - Intergenic
1144799822 17:17918371-17918393 AAATTGTAGCCAGAGCAGTTAGG - Intronic
1145982530 17:29021744-29021766 AAACTGGACCCAGAGGAGGTGGG - Intronic
1146861195 17:36300645-36300667 AAACAGAAAGCAGAGGAAATGGG + Intronic
1147091526 17:38104749-38104771 AAACAGAAAGCAGAGGAAATGGG + Intergenic
1147105686 17:38215756-38215778 AAACAGAAAGCAGAGGAAATGGG - Intergenic
1148505227 17:48121907-48121929 AAACTGAAGCCAGCCAAGATGGG - Exonic
1148755441 17:49970640-49970662 AAGCTGGAGCCAGTGCAGATGGG - Intronic
1149178760 17:53907976-53907998 AAGCTGATGCCAGAGACGATAGG + Intergenic
1149565279 17:57636688-57636710 AAACTGAAGCAGGAGGAAAGAGG - Intronic
1149598414 17:57877483-57877505 AAACTGAGGCCATAAGAGAAAGG - Intronic
1149873663 17:60207139-60207161 AAACAGAAGCAAGATGAGAAGGG + Intronic
1150087448 17:62284395-62284417 AAACAGAAGCAAGATGAGAAGGG + Intergenic
1151114306 17:71716615-71716637 AAAAAGAAGACAGAGGAGCTGGG + Intergenic
1153899077 18:9599671-9599693 AAACTGAGGCCAGATGAGAGTGG - Intronic
1154060711 18:11056990-11057012 AGACTGAAGGGAGAGGACATTGG + Intronic
1156493789 18:37512466-37512488 AAAATGAAGCATGAGGAGAAAGG - Intronic
1156557282 18:38081897-38081919 AACCTGAAGGCATTGGAGATTGG - Intergenic
1156613862 18:38760261-38760283 AAAATGAAGACAGAGGCCATTGG + Intergenic
1156949174 18:42872397-42872419 AAATTGCTGCCAGAGGAGAAAGG + Intronic
1157625440 18:49047111-49047133 TCACTGAAGCCATAGCAGATGGG - Intronic
1158316828 18:56220487-56220509 ATTCTGAGGCCAGAGGAGTTAGG - Intergenic
1158949285 18:62476946-62476968 AAACTGATGCAAGATGAAATAGG - Intergenic
1160278368 18:77461520-77461542 AAATTTAATCCAGAGGATATGGG - Intergenic
1160865399 19:1253861-1253883 AAACTGAGGCCAGAGGGGGCGGG - Intronic
1160875067 19:1293106-1293128 AAACTGAGGCCAGAGGGCAGTGG + Intronic
1161960302 19:7519606-7519628 GCAGTGAGGCCAGAGGAGATGGG - Exonic
1161962804 19:7532031-7532053 AAACTGAGGACAGAGGGGTTAGG - Intronic
1162994173 19:14323280-14323302 TAACTGAAGCCAGAGGACAAGGG + Intergenic
1163681518 19:18684862-18684884 AAACTGAGGCCTGAGGAACTCGG - Intronic
1163753787 19:19094456-19094478 AAACAGAAACCAAAGCAGATGGG - Intronic
1164682869 19:30147281-30147303 AAACTGAAGGTAGAGGGTATGGG + Intergenic
1165002469 19:32776315-32776337 CACCTGAAGCCAGAGGAACTGGG - Intronic
1165210457 19:34231617-34231639 ACACTGAATCCAGATGTGATTGG - Intergenic
1166007368 19:39916661-39916683 AAACTGAGGCACGGGGAGATTGG - Intronic
1166998968 19:46733852-46733874 AAACTGAAGCCAGCTGGGACTGG + Intronic
1167671592 19:50856687-50856709 AGACTGAAGACAGAGAAGAGAGG - Intronic
924972782 2:144569-144591 AAACTGAACCAATAGGAGACTGG - Intergenic
925696370 2:6584215-6584237 AAACAGAAGACAGAGGATTTTGG + Intergenic
928113108 2:28526164-28526186 AAACAGAAGCCAGTGGGCATTGG + Intronic
929595539 2:43173449-43173471 ACACTGAGGCCCTAGGAGATAGG + Intergenic
930025813 2:47028527-47028549 AAACTCAAGCCAGTGAAAATTGG + Intronic
930156049 2:48108627-48108649 AAACTGAAGCTCAGGGAGATTGG + Intergenic
930504918 2:52271381-52271403 AGCCTGAAGCTAGAAGAGATTGG - Intergenic
930747582 2:54900718-54900740 AACCTGAAACCAGAGGACAAGGG + Intronic
930878737 2:56248483-56248505 AAACTGAGGCCTCCGGAGATAGG - Intronic
933416104 2:81988236-81988258 AAACAGAAGGCAGAGGTGATTGG - Intergenic
934069623 2:88372055-88372077 AAGGTGAAGGCAGAGGAGAGGGG - Intergenic
934082694 2:88483065-88483087 AAGCTGAAGACAGAAGAGGTTGG - Intergenic
935673233 2:105572913-105572935 ACACTCAAGCAAGAGGAAATTGG - Intergenic
936758134 2:115739168-115739190 AAAGGGAAGCCAGAGGACATGGG + Intronic
936826494 2:116588202-116588224 AAACTGAAGAGAGAGTAAATGGG - Intergenic
937227036 2:120375915-120375937 AAACTGAAGCCAACCGAGGTGGG - Intergenic
937618379 2:123954760-123954782 AAACTGAAGACCCAGGAGAGAGG - Intergenic
939321778 2:140632554-140632576 CCACTGAAACCAGAGGAGATAGG + Intronic
939372689 2:141322476-141322498 AAACTGAAAGCAGAGAAGATAGG + Intronic
940136804 2:150446371-150446393 AAACTGAAGCCTGTGGGGAAGGG - Intergenic
941441389 2:165541431-165541453 TAGCTGAAGACAGAGGAGAGAGG - Intronic
941974652 2:171389733-171389755 AAAGTGAAGCTAGTGGAGGTTGG + Intronic
942584122 2:177455644-177455666 AAACTGAAGTTAAAGGAGCTAGG - Intronic
942937931 2:181580950-181580972 AAACTGAACCCAGAAGACATAGG - Intronic
943602983 2:189943262-189943284 AAGCTGAAGCCAGAGTAGCTGGG - Intronic
943623115 2:190171303-190171325 AAAATGAAGCCAAAAGAGGTAGG + Intronic
943626678 2:190209160-190209182 AAAGTGAAGCCAGCACAGATGGG - Intronic
943795958 2:191994355-191994377 AAAATGAAGTCAGATGATATTGG - Intronic
944035695 2:195291824-195291846 ACCCTAAAGCCAGAAGAGATTGG + Intergenic
944241021 2:197485154-197485176 AAGCTGCAGCCAGAGGAATTGGG + Intergenic
945691632 2:213044036-213044058 AACCAGAAGCCAGAGGACAACGG - Intronic
946153141 2:217789639-217789661 AGACAGAAGGCAGATGAGATGGG + Intergenic
947815621 2:233034482-233034504 AAGCAGAAGGCAGAGGGGATCGG - Exonic
1169649224 20:7848328-7848350 AAACTGACCCTAGAGTAGATAGG + Intergenic
1170055206 20:12194583-12194605 ATACTGAATCCAGAGGACATGGG + Intergenic
1170915746 20:20623574-20623596 ATAATGCAGCCAGGGGAGATGGG + Intronic
1171355304 20:24540383-24540405 AAACTGTAGCCAGAGAAATTAGG - Intronic
1171908391 20:30920103-30920125 CAACTGAAACCACAGGAGCTCGG + Intergenic
1172205440 20:33159935-33159957 AAACTGAGGCCAGAGGGCATGGG - Intergenic
1172764573 20:37344757-37344779 AAACTGAGGCTAGAGGGGAAAGG - Intronic
1172773181 20:37393202-37393224 AAACTGAGGCCAGAGGGGGCTGG - Intronic
1172980629 20:38938915-38938937 AAACTGATGCCAGAAGAGATTGG - Intronic
1173383453 20:42566887-42566909 AAACTGAATAAAGAGTAGATGGG + Intronic
1174034649 20:47661154-47661176 CAACTGAGGCCAGTGGAGAGTGG - Intronic
1174500826 20:50982692-50982714 AAACTGAGGCCAGAGAGGAGGGG - Intergenic
1175824109 20:61927410-61927432 ATGCTGAAGCCAGAGGTCATCGG + Intronic
1176076413 20:63250378-63250400 AAACTGGGGACAGAGGGGATGGG - Intronic
1176079351 20:63264178-63264200 AAACTGAATGCAGAGGTCATTGG - Intronic
1176117669 20:63440117-63440139 GAGCTGAGGCCAGAGGAGAGGGG + Intronic
1177197398 21:17917693-17917715 CAACAGAAGCCAGAGAAGAAAGG + Intronic
1177878744 21:26667896-26667918 AACCTGAAACCAGAAGAGATTGG - Intergenic
1178347168 21:31840144-31840166 GAACTGAAGGCATGGGAGATGGG - Intergenic
1180341826 22:11626275-11626297 CAACTGAAACCACAGGAGCTCGG + Intergenic
1181413894 22:22745984-22746006 TCACTGAAGCCTGAGGGGATAGG - Intronic
1184171911 22:42764984-42765006 AAACTGAAGCTGGAGAAGATAGG - Intergenic
1184242304 22:43217615-43217637 ACAGTGAGGCCAGAGGTGATGGG - Intronic
1184575569 22:45362470-45362492 AAACTGAAACCACATGAGAATGG - Intronic
949437259 3:4042992-4043014 AACCTGAAGTCAGAGGAGACAGG - Intronic
949834621 3:8254512-8254534 GAACTGAAGTCAGAGGAGGAAGG - Intergenic
950044786 3:9942742-9942764 AAGCTGAAGCCAGAGCCGTTGGG - Intronic
950454519 3:13084671-13084693 GAACTGAGGACAGGGGAGATGGG + Intergenic
951241220 3:20288119-20288141 AGGCTGAAGCCAGAAGAGCTAGG + Intergenic
951400728 3:22229163-22229185 AAAATGGAGTCAGAGGAGAAAGG - Intronic
951426504 3:22552418-22552440 AAACTTGAGCCAGAGTAGTTGGG - Intergenic
951535110 3:23733517-23733539 AAATTGAGGCCAGAAGAAATAGG + Intergenic
951843159 3:27056877-27056899 AAACCCAAGCCAGAAGAGACTGG - Intergenic
952503594 3:33987787-33987809 AAGCCCAAGCCAGAAGAGATTGG - Intergenic
952546502 3:34425665-34425687 AAATTGAGGCCAGAGAAGTTAGG + Intergenic
953104440 3:39862153-39862175 ACTCTTAAGCCAGAAGAGATTGG + Intronic
953661809 3:44896584-44896606 AGACTGTAGGCAGGGGAGATGGG + Intronic
953791627 3:45951932-45951954 AACATGAAGGCAGGGGAGATGGG + Intronic
954419250 3:50409969-50409991 AGACTGAGGCCAGAGGAGGCAGG + Intronic
954480416 3:50795062-50795084 AAACCCAAGCCAGAAGAGATTGG - Intronic
955798579 3:62663025-62663047 AAACTGAAAACAGAGAAGTTAGG - Intronic
957843398 3:85699613-85699635 AAGCTGAAGCTAGAGCAGCTGGG + Intronic
958029673 3:88093132-88093154 AAACTGAAGCCTGAAAAGTTGGG + Intronic
959108336 3:102092031-102092053 CATCTGAAGCCAGAGGACAGAGG + Intergenic
960061954 3:113332132-113332154 ATACTCTAGCTAGAGGAGATGGG - Intronic
961532097 3:127546186-127546208 AAACTGAGGCCAGTGGGGTTCGG + Intergenic
962355090 3:134686827-134686849 AAACTGAGGCCCAAAGAGATGGG + Intronic
963846436 3:150163164-150163186 AAACTGACGCAAGAGGAAATAGG - Intergenic
964385060 3:156138432-156138454 AAACTGAGGCCAGAGCTGGTGGG - Intronic
964511786 3:157460565-157460587 AAACTGATGACAGCCGAGATGGG + Intronic
964731112 3:159865979-159866001 AAATTCAAGCCAGAAGAGACTGG + Intronic
966480822 3:180406534-180406556 ACAATGAAGCTTGAGGAGATGGG - Intergenic
966904494 3:184512310-184512332 AGGCTGAAGCCACAGGAGAGAGG + Intronic
967325791 3:188238137-188238159 AATCTGAAGCTAGCAGAGATTGG - Intronic
967966154 3:194961555-194961577 CAACTGGAGCCTGAGGAGGTAGG - Intergenic
968158928 3:196408736-196408758 CAACAGAAGCCAGAGGACATTGG - Intronic
968264326 3:197351002-197351024 AGACGGAAGGCAGAGGAGGTGGG + Intergenic
968762144 4:2448215-2448237 ACACTGAGCCCTGAGGAGATGGG - Intronic
968904705 4:3445882-3445904 AAACTGAGGGCAGAGGTGAGTGG + Intronic
968932764 4:3590734-3590756 AAACGGAAGTCAGAGCAGATGGG + Intergenic
969304506 4:6318099-6318121 AAACTGAAGCGTGAAGAGGTGGG - Intergenic
969402810 4:6968141-6968163 AAACTGAAGCTGGAGGAGCGAGG - Intronic
970209731 4:13696824-13696846 TGACTGAAGCCAGAGAAAATGGG + Intergenic
970210245 4:13702459-13702481 AAATTGAAGGGAGAGGGGATGGG - Intergenic
970354562 4:15239107-15239129 AACCAGAAGCCAGAGGTCATAGG + Intergenic
970471612 4:16384858-16384880 AAAGTGGAGGCAGAGGAGGTGGG + Intergenic
970899931 4:21147079-21147101 AACCGGAAGCCAGAGGACACAGG - Intronic
971692323 4:29852728-29852750 AAACTGTAGCCTGTGGAAATTGG - Intergenic
971911193 4:32799285-32799307 AAAATGGAGTCAGAGGAGAAAGG - Intergenic
974237113 4:59196224-59196246 AAACAAGAGCCAGAGTAGATGGG - Intergenic
974445507 4:61975873-61975895 AAACAGAAGGAAGAGCAGATTGG + Intronic
974896198 4:67942284-67942306 AAACCGATGATAGAGGAGATGGG + Intronic
976311011 4:83613573-83613595 AAACTATAGCAAGAAGAGATGGG - Intergenic
976634312 4:87272482-87272504 TACCTGAATCCAGAGGACATAGG + Intergenic
976844616 4:89473753-89473775 AAAGTGAAGCCAGGGGACATAGG - Intergenic
978984107 4:114987794-114987816 AAACTTAAGCAAGTGGAGGTGGG - Intronic
979226948 4:118297108-118297130 AAACTGAAGCCATTGGTTATTGG - Intronic
981072547 4:140559020-140559042 AAACTGCATGCAGAAGAGATAGG - Intergenic
982085470 4:151831187-151831209 AGAATGAAGCCAGAGGAGCCAGG + Intergenic
983060690 4:163155927-163155949 AAATTGAAGGTAGAGGTGATAGG + Intronic
983060715 4:163156273-163156295 AAATTGAAGGTAGAGGTGATAGG + Intronic
983346429 4:166531876-166531898 AAAGTGTACCCAAAGGAGATAGG - Intergenic
983429789 4:167634093-167634115 AAACTGAATCCATAGGAGTTTGG + Intergenic
984993916 4:185409511-185409533 AAAATTAAGTGAGAGGAGATAGG + Intronic
985961720 5:3307613-3307635 GAGCTGAAGCCAGAGGTGAGGGG + Intergenic
986386870 5:7243291-7243313 AAACTGAAGACAAAGAGGATAGG + Intergenic
986424257 5:7614669-7614691 AACCTGAAGCCAGAGGGCAAAGG - Intronic
987692724 5:21288393-21288415 AAACTGAAGACAGAGAAGTTTGG + Intergenic
988513918 5:31888960-31888982 AAACTGAAGCCGACGGAGGTTGG - Intronic
989020639 5:37002334-37002356 AAACAAAAGCCAGAGGGCATGGG + Intronic
989141585 5:38206833-38206855 AAAAAGAAGAGAGAGGAGATGGG - Intergenic
989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG + Intronic
990760047 5:59118862-59118884 AAACTTAGGCCAGAGGACTTGGG + Intronic
991747630 5:69761654-69761676 AAACTGAAGACAGAGAAGTTTGG - Intergenic
991750099 5:69793670-69793692 AAACTGAAGACAGAGAAGTTTGG + Intergenic
991799208 5:70341508-70341530 AAACTGAAGACAGAGAAGTTTGG - Intergenic
991801672 5:70373475-70373497 AAACTGAAGACAGAGAAGTTTGG + Intergenic
991826924 5:70636554-70636576 AAACTGAAGACAGAGAAGTTTGG - Intergenic
991829389 5:70668528-70668550 AAACTGAAGACAGAGAAGTTTGG + Intergenic
991891567 5:71340934-71340956 AAACTGAAGACAGAGAAGTTTGG - Intergenic
991937224 5:71814445-71814467 AAAATGAAGACAGAGAAAATAGG + Intergenic
992077108 5:73202026-73202048 AAGCTGGAGCCAGGGGAGACTGG - Intergenic
992167918 5:74073289-74073311 AAGCTGAAGCCAGAGAAATTAGG + Intergenic
992709195 5:79431979-79432001 AAAATGAAGCCAAAAGAGGTTGG - Intronic
992858471 5:80888370-80888392 AAACAGGAGCCAAAAGAGATAGG - Intergenic
993030022 5:82695033-82695055 AAACTGCAGTCAGAGGAAAGAGG - Intergenic
993180560 5:84547169-84547191 AAATTGAAGGCAGAGGAATTTGG - Intergenic
993248283 5:85480661-85480683 AAACTGAATACAGAGGAAGTTGG - Intergenic
993340684 5:86721617-86721639 AAACTGAAGACACAGAGGATAGG - Intergenic
993748529 5:91634162-91634184 AAAGTGAAGCCAGATCAAATAGG + Intergenic
994679060 5:102862789-102862811 AAACTGAAGCTAGAGAGGTTAGG + Intronic
994744936 5:103666454-103666476 ATACTAAAGCCTGAGGAGTTAGG - Intergenic
995101452 5:108311968-108311990 TAGCTGAAGCTACAGGAGATGGG - Intronic
995274094 5:110258533-110258555 CAGCTGCAGCCAGAGGAGCTTGG + Intergenic
995543370 5:113205822-113205844 TGACTGAAGCCAGAGCTGATGGG + Intronic
995645796 5:114309864-114309886 AAACTGAACCCTGAAGGGATAGG + Intergenic
995865572 5:116686619-116686641 GAACTGAAGGCGGAGGAGAAGGG + Intergenic
996164216 5:120205227-120205249 AAACTGAAGCCAAGGGAAAACGG + Intergenic
996286750 5:121803158-121803180 AAACCTAAGGCAGAGGACATGGG + Intergenic
997891967 5:137684931-137684953 AAACTGAATCCAGAGGAAGCAGG + Intronic
998880637 5:146641409-146641431 AGCCTAAAGCCAGAAGAGATGGG - Intronic
999270680 5:150294814-150294836 AAACTTGGGCCACAGGAGATGGG + Intergenic
999456181 5:151718267-151718289 AAAGTGGAGCCACAGGAGAATGG + Intergenic
999653458 5:153790146-153790168 AATCTGAAGCCACAGGAGGCAGG + Intronic
1001473412 5:172031997-172032019 CAACTGAAGCCAAAGCAGCTTGG + Intergenic
1001583355 5:172815741-172815763 AAAGGGAAGCGAGAGAAGATGGG + Intergenic
1001928864 5:175658610-175658632 AAAGGGAAGCCAGCGGAGAGCGG + Intronic
1002335729 5:178476998-178477020 AAAGTGAGGCCAGAGGAGTTGGG - Intronic
1002783989 6:387359-387381 AAACTGAAGCAAGAGGTGAAAGG - Intergenic
1002899385 6:1398261-1398283 AAACTGAAATCAGAAGACATGGG - Intergenic
1003055926 6:2820322-2820344 AAACTAAAGCCAAAGGAAACAGG + Intergenic
1003277658 6:4666155-4666177 AAACTGAGGCCAGAGCACAGTGG - Intergenic
1003319135 6:5036886-5036908 AAACTGATGCCTGAGAAGTTAGG + Intergenic
1003996615 6:11547996-11548018 AAACAGAAGAGAGAGGAGGTAGG + Intronic
1004475813 6:15970102-15970124 AAACAGAAGGCAGAGAAGAGTGG + Intergenic
1004504836 6:16239113-16239135 AAACTGGAGCTAGGGGAGAGAGG + Intronic
1006446433 6:34082293-34082315 AAACAGAGGCCAGAGAAGTTAGG + Intronic
1007379722 6:41480386-41480408 AATCTGAAGCTAGCAGAGATGGG + Intergenic
1007382144 6:41497298-41497320 ACCCTGAGGCCAGAGGAGCTGGG - Intergenic
1007690257 6:43696453-43696475 AAACTGAGGCCAGAGGAAGAAGG + Intergenic
1007754939 6:44093349-44093371 ATCCTGATGCCAGAGGAGGTGGG + Intergenic
1008803908 6:55404805-55404827 AAATGGAAGCCAGAGGACAAAGG - Intergenic
1011548874 6:88510920-88510942 AACCTGAAGAGAGAGGACATTGG - Intergenic
1011768899 6:90654005-90654027 AAACTTAAGGCAGAGGTGGTTGG - Intergenic
1011778966 6:90764978-90765000 AAACTGGGGACAGATGAGATTGG + Intergenic
1012069630 6:94597282-94597304 AAACTGAAACTAAAGTAGATAGG + Intergenic
1014145631 6:117995076-117995098 AAACTCAAGCTGGAGGATATTGG - Intronic
1014492873 6:122083249-122083271 AAACTGACATCAGAGAAGATGGG + Intergenic
1015955126 6:138590577-138590599 AAATGGAAGGCAGAGGAGCTTGG - Intronic
1016376792 6:143429822-143429844 AGACTGAAGACACAGGAGAATGG - Intronic
1017823656 6:158066173-158066195 CAACTGAAGCCAGAAGCCATGGG - Intronic
1019502525 7:1371520-1371542 GAACTGAATCCAGAGGAAAAGGG - Intergenic
1019816012 7:3201387-3201409 AAAGGGAACCCAGAGGAGAAAGG + Intergenic
1020114412 7:5467789-5467811 AAACAGCAGCCTAAGGAGATGGG + Intronic
1020354166 7:7258946-7258968 AAACTGAAGCAAGAGAAGCAAGG + Intergenic
1023585886 7:41729321-41729343 ACAGTGAAGCCAGAGGTGAAAGG + Intergenic
1023706082 7:42943111-42943133 AAACTGAGCCCCGAGGAGAGGGG + Intronic
1024450934 7:49542291-49542313 GAACTGAAGCAGAAGGAGATGGG + Intergenic
1024991374 7:55237092-55237114 TAACTGAGGCCAGAGGGGAAGGG - Intronic
1026040574 7:66865174-66865196 AAATTCAACCAAGAGGAGATTGG - Intergenic
1026876305 7:73880952-73880974 AAACTAAAGGCTCAGGAGATTGG - Intergenic
1027705765 7:81531672-81531694 AAACAGAACCAATAGGAGATGGG + Intergenic
1027800109 7:82739658-82739680 AAACAGAAGCCATAGGAGATAGG - Intergenic
1027945001 7:84733330-84733352 ACACAGAAGCCTGAGGAGAAGGG + Intergenic
1028083197 7:86602247-86602269 ATCCTAAAGCCAGAAGAGATTGG + Intergenic
1028649096 7:93130457-93130479 AAAAATAAGCCAGGGGAGATGGG + Exonic
1028732534 7:94168565-94168587 AATCAGAAGCCAGAGGCAATGGG - Intergenic
1028732651 7:94169751-94169773 AAATTGTAGCCATTGGAGATAGG - Intergenic
1028937037 7:96476952-96476974 ACAGTGAGGCCAGAGGAGAGTGG + Intergenic
1029026389 7:97421336-97421358 AAACTGGTGCCAGAAGAGAAGGG + Intergenic
1030525065 7:110642867-110642889 AAACTGAGGCCCGAGGCCATAGG - Intergenic
1032334546 7:131012848-131012870 AAGCTGAAGCCACTGGAGATAGG - Intergenic
1032989154 7:137371968-137371990 AAACTAAATTCAGATGAGATGGG + Intergenic
1034190214 7:149207954-149207976 AATCTTAAGCCTGAGGAAATCGG + Intronic
1034339933 7:150346380-150346402 AAACTGGAGGCAGTGAAGATGGG + Intergenic
1034697955 7:153071149-153071171 AACATGAAACCAGAGGCGATGGG + Intergenic
1034789268 7:153953304-153953326 AAACGGAAGCCAAAGAAGTTGGG + Intronic
1035946248 8:3966269-3966291 AAACTGAATGCAGAGGGGCTTGG + Intronic
1036469152 8:9035070-9035092 AATTTGAAGCCAGCAGAGATTGG + Intronic
1036509334 8:9386085-9386107 AGACTGAAGCCATGGGAAATTGG + Intergenic
1036657749 8:10688770-10688792 AAACTGCAGGGAGAGGAGAGAGG - Intronic
1037109009 8:15143663-15143685 AAACTGAGCCCCAAGGAGATGGG - Intronic
1037264887 8:17047641-17047663 AGACAGAAGCCAGAGGACAGTGG + Intronic
1037931146 8:22881020-22881042 AAACTAAATCCAGAGGATCTGGG - Intronic
1039048457 8:33471889-33471911 AAGGAGAAGCCAGAGGCGATTGG - Intronic
1039838187 8:41274197-41274219 AAACAGAAACAACAGGAGATGGG - Intronic
1041934061 8:63317532-63317554 GAACTGCAGCCAGTGGACATTGG + Intergenic
1042397186 8:68306359-68306381 AAGATGAAGCCAGAGGAAACTGG - Intronic
1042943920 8:74136161-74136183 AAACTGAGAGCAGAAGAGATTGG + Intergenic
1044926843 8:97216583-97216605 AAACCAAAGCCTGAGGAGCTTGG - Intergenic
1045287822 8:100807191-100807213 ACAGTGAAGCCAGAGGAGCCTGG + Intergenic
1046491905 8:114964629-114964651 AAACTCAAGCCAGAGGACAAGGG - Intergenic
1046895036 8:119463313-119463335 AAAGTCAAGCCTGGGGAGATAGG - Intergenic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1047226429 8:122958967-122958989 ACACAGAAACCAGAGGAGCTAGG + Intronic
1047535818 8:125718754-125718776 AAACAGAAGTCAGATGAGATTGG - Intergenic
1047723598 8:127665650-127665672 AAACTGAAGCAGGTGGAGTTTGG + Intergenic
1049969292 9:807533-807555 AAACTAAAGCTAGAGGACAAGGG - Intergenic
1050260505 9:3836502-3836524 AATCTGAAGGCAAAGGAGAGTGG - Intronic
1050770861 9:9197739-9197761 AAAAGGAAGCCAGAGTAGACTGG - Intronic
1050826067 9:9948045-9948067 AAAATGAAGACAGAGGAAAAAGG + Intronic
1051796780 9:20880483-20880505 AACCAGAAGCCAGAGGACATGGG + Intronic
1051893343 9:21965383-21965405 AAAAAGAAGCCAGAGGGGAAGGG - Intronic
1052086688 9:24275898-24275920 AACCAGAAGCCAGAGTACATGGG + Intergenic
1052153748 9:25155265-25155287 ATACTGAAGCCAAAGAAAATAGG - Intergenic
1052915572 9:33922488-33922510 AAACTAAACCCAGAAGAGAGGGG - Exonic
1053132571 9:35625415-35625437 AATCTGAAGCCAGCAGAGGTTGG + Intronic
1053279170 9:36806201-36806223 AAACTGAGGCCAGAGAAGGAAGG - Intergenic
1053331135 9:37208699-37208721 AAAGTGATGGCAGAGTAGATGGG - Intronic
1053671091 9:40362927-40362949 AACCTGAAGCCAGAGGATGAGGG - Intergenic
1054457363 9:65441161-65441183 AAACGGAAGTCAGAGCAGATGGG - Intergenic
1054513523 9:66013373-66013395 AACCTGAAGCCAGAGGATGAGGG + Intergenic
1055078188 9:72238617-72238639 AAACTTAAGCCAGAGGACAATGG - Intronic
1055608971 9:78001627-78001649 AATCTGAAGCCAGAGGAAATCGG - Intronic
1055646880 9:78369557-78369579 AACATGAATCCAGTGGAGATGGG - Intergenic
1056187134 9:84146538-84146560 ACACTGTAGTCAGAGGTGATGGG - Intergenic
1057287623 9:93772737-93772759 AAACAGAACCAATAGGAGATAGG - Intergenic
1057548885 9:96037807-96037829 AAGGAGGAGCCAGAGGAGATGGG + Intergenic
1058879866 9:109276996-109277018 AAACAGAGGCCAGAGGAGCAAGG + Intronic
1062190618 9:135246081-135246103 AAACTGAGGCCCGGGGAGAGAGG + Intergenic
1062322870 9:135998879-135998901 AAACTGAAGTCAGAACAGACAGG + Intergenic
1186531769 X:10303928-10303950 AAACTGATGTCACAGGAGTTTGG - Intergenic
1186662708 X:11685256-11685278 GAACTGAAGGAAGAGGAGAGAGG - Intergenic
1186765625 X:12767952-12767974 AAACTGGAGCCACAGGGGCTGGG + Intergenic
1187206468 X:17186464-17186486 AAACTGAAGCCCGAAGTTATAGG + Intergenic
1187714354 X:22087628-22087650 AAAAAGAAGCTGGAGGAGATGGG + Intronic
1188223308 X:27566441-27566463 AAACTGAATCAAGATGAAATAGG - Intergenic
1189878377 X:45461748-45461770 ACACACAAGCCAGAGAAGATTGG - Intergenic
1190013767 X:46808568-46808590 AGACTGAAAGGAGAGGAGATGGG - Intergenic
1191033828 X:56004696-56004718 AAACAAAAGCCAGAGAAGAGGGG + Intergenic
1191105132 X:56767898-56767920 AGACTGAAGCGAGACGAGAGAGG + Intergenic
1191106125 X:56773300-56773322 AGACTGAAGCGAGACGAGAGAGG + Intergenic
1191107118 X:56778702-56778724 AGACTGAAGCGAGACGAGAGAGG + Intergenic
1191794612 X:65007615-65007637 TCACTGCAGCCAGAGGAGAAGGG + Intronic
1193768354 X:85559747-85559769 ACTCTAAAGCCAGAAGAGATTGG - Intergenic
1194571718 X:95560987-95561009 AAAATGGAGTCAGAGGAGAAAGG + Intergenic
1195001526 X:100647579-100647601 GAACTGAAGCAAGGGGAGGTTGG - Intronic
1195342236 X:103917460-103917482 CAACTGAACCCATAGGACATAGG + Intergenic
1197754315 X:129983741-129983763 AAATTGAAGGAAGATGAGATCGG + Intronic
1197903227 X:131395555-131395577 AATCTGAAGTCAGAGGTGAAAGG - Intronic
1198682841 X:139201141-139201163 AAAATGTAGCCAGACAAGATAGG - Intronic
1198733240 X:139756906-139756928 AAACTCATGCCACAGGAGTTTGG - Intronic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic
1201367855 Y:13228155-13228177 GAACTGAAGCAAGAGAAGAGTGG - Intergenic