ID: 1129860637

View in Genome Browser
Species Human (GRCh38)
Location 15:78858339-78858361
Sequence GGTTCTTTTGGAGGCCGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115342
Summary {0: 1, 1: 3, 2: 128, 3: 5367, 4: 109843}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129860631_1129860637 7 Left 1129860631 15:78858309-78858331 CCAGGCACTGTGGCTCACACATG 0: 4
1: 507
2: 13888
3: 54191
4: 125623
Right 1129860637 15:78858339-78858361 GGTTCTTTTGGAGGCCGAGGCGG 0: 1
1: 3
2: 128
3: 5367
4: 109843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129860637 Original CRISPR GGTTCTTTTGGAGGCCGAGG CGG Intronic
Too many off-targets to display for this crispr