ID: 1129865832

View in Genome Browser
Species Human (GRCh38)
Location 15:78907901-78907923
Sequence AGAACAGCAAGCCACCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129865832_1129865834 3 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865834 15:78907927-78907949 AGCTGCCTGACAGCAGCTGTTGG No data
1129865832_1129865835 4 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865835 15:78907928-78907950 GCTGCCTGACAGCAGCTGTTGGG No data
1129865832_1129865839 23 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865839 15:78907947-78907969 TGGGTCCAGTCTCTATTTTGGGG No data
1129865832_1129865840 24 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865840 15:78907948-78907970 GGGTCCAGTCTCTATTTTGGGGG No data
1129865832_1129865838 22 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865838 15:78907946-78907968 TTGGGTCCAGTCTCTATTTTGGG No data
1129865832_1129865837 21 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865837 15:78907945-78907967 GTTGGGTCCAGTCTCTATTTTGG No data
1129865832_1129865842 30 Left 1129865832 15:78907901-78907923 CCTTCCTGGTGGCTTGCTGTTCT No data
Right 1129865842 15:78907954-78907976 AGTCTCTATTTTGGGGGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129865832 Original CRISPR AGAACAGCAAGCCACCAGGA AGG (reversed) Intergenic