ID: 1129868287

View in Genome Browser
Species Human (GRCh38)
Location 15:78925253-78925275
Sequence CACACCCCACTCGTGGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 80}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129868287_1129868296 15 Left 1129868287 15:78925253-78925275 CCAAGTCCCACGAGTGGGGTGTG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1129868296 15:78925291-78925313 CCCCTCCCCACTGTCCCTCCTGG 0: 1
1: 6
2: 16
3: 89
4: 764
1129868287_1129868303 23 Left 1129868287 15:78925253-78925275 CCAAGTCCCACGAGTGGGGTGTG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1129868303 15:78925299-78925321 CACTGTCCCTCCTGGCTCCTGGG 0: 1
1: 0
2: 7
3: 52
4: 707
1129868287_1129868302 22 Left 1129868287 15:78925253-78925275 CCAAGTCCCACGAGTGGGGTGTG 0: 1
1: 0
2: 1
3: 10
4: 80
Right 1129868302 15:78925298-78925320 CCACTGTCCCTCCTGGCTCCTGG 0: 1
1: 1
2: 6
3: 55
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129868287 Original CRISPR CACACCCCACTCGTGGGACT TGG (reversed) Intronic
900299826 1:1971535-1971557 CACATCCCAAGCGTGGGGCTGGG + Intronic
901234066 1:7658077-7658099 TACACCCCACTTGAGGGTCTTGG - Intronic
907310599 1:53536913-53536935 CACACCCCACATGTGGGAATTGG - Intronic
908739857 1:67316406-67316428 CACACACTACTCTGGGGACTAGG - Intronic
913657802 1:120977817-120977839 CACACCCCACTCTTGCAAATTGG + Intergenic
917611156 1:176690325-176690347 CACAGCTCACTCTTGGGAGTGGG - Exonic
918956248 1:191211631-191211653 CACACACCAGAGGTGGGACTGGG + Intergenic
920169666 1:204063686-204063708 AACACCCCACTCTTGGGAATGGG + Intergenic
922762759 1:228142734-228142756 CACCCCCCATTCCTGGGAGTTGG + Intronic
923322759 1:232852045-232852067 CACATCCCACTCTTGGCCCTAGG - Intergenic
924642523 1:245848013-245848035 CACACTCCACTCCTGGGACTAGG - Intronic
1064377672 10:14811393-14811415 CACAGCCCACTGGTGGGAGTTGG + Intergenic
1065987579 10:30970975-30970997 GACACCCGACTCTGGGGACTTGG + Intronic
1069659076 10:70111718-70111740 AAAACCCCACTCTTGGGACTCGG - Exonic
1077224398 11:1433815-1433837 CACCCCCCACCCCTGGCACTGGG + Intronic
1080750716 11:35147685-35147707 CACACACCAATCGTGGAACTAGG + Intronic
1083633805 11:64109418-64109440 CTCTCCCCACTCGTGACACTGGG + Intronic
1083742428 11:64717947-64717969 TAAAGCCCACTCCTGGGACTGGG + Intronic
1083796103 11:65017652-65017674 CTCACCCCTCTCCTGGGCCTAGG + Intronic
1089291008 11:117437890-117437912 CTCACCCCGCCCGTGGGTCTTGG + Exonic
1090567760 11:128014390-128014412 CACACCTCAAGCATGGGACTTGG + Intergenic
1091369640 11:135047443-135047465 CACCCCCCCCATGTGGGACTTGG - Intergenic
1091744574 12:2982811-2982833 AAAACCCCACTCGTGGGGCAGGG + Intronic
1092280674 12:7095723-7095745 CACACACCAGCTGTGGGACTTGG + Exonic
1093687793 12:22076689-22076711 CACACCCCACTTGTGAAACCTGG - Intronic
1096493865 12:52027794-52027816 CACACACCCCTCCAGGGACTAGG + Intronic
1104866697 12:131960223-131960245 CACACCCCATTTGAAGGACTAGG - Intronic
1105770587 13:23608065-23608087 CACACACCACTGGTGGGTCAAGG - Intronic
1108583211 13:51845212-51845234 CTCTCCCCACACGTGGGAGTGGG - Intergenic
1122544491 14:102514667-102514689 CACCCACCAGTGGTGGGACTGGG + Intergenic
1122620838 14:103056994-103057016 CTTACCCCACTCGAGGAACTCGG + Exonic
1124362249 15:29046326-29046348 CACACCCCACTTTTGTGTCTTGG + Intronic
1129188727 15:73925779-73925801 TACACCCCACTCTTCAGACTGGG + Intergenic
1129856747 15:78830453-78830475 CAGGCCCCACTGGTCGGACTTGG + Intronic
1129868287 15:78925253-78925275 CACACCCCACTCGTGGGACTTGG - Intronic
1133930023 16:10224422-10224444 CACAACCCACAGGTGGGGCTGGG + Intergenic
1134237569 16:12479348-12479370 CATAACCCACTCCTGGCACTTGG + Intronic
1146647600 17:34585394-34585416 CAGACCCCAGTGGTGGGAGTTGG - Intronic
1147403180 17:40193014-40193036 AGCCCCCCACTTGTGGGACTAGG - Intronic
1148052057 17:44774351-44774373 CACACCCCCGCCGTGGGACAGGG - Exonic
1148286769 17:46400266-46400288 CATACCCAACGCGTGGGACCTGG + Intergenic
1148308936 17:46617856-46617878 CATACCCAACGCGTGGGACCTGG + Intronic
1149426227 17:56557423-56557445 CACTTCCCAATCATGGGACTCGG - Intergenic
1151314113 17:73311501-73311523 CACACCCCATTCCTGGGAAGGGG + Intronic
1151698514 17:75730514-75730536 CACCTCCCACCCGTGGGACCTGG - Intronic
1157606934 18:48931872-48931894 CCCAGCCCCCTCCTGGGACTAGG + Intronic
1158106259 18:53888336-53888358 CACACCACCCTCCTGGAACTGGG + Intergenic
1162783289 19:13018402-13018424 CACACCCCAGTGCTGGGTCTAGG - Intronic
1165160936 19:33815837-33815859 CACTCCCCACACTTGGGACCTGG + Intergenic
1166294311 19:41881462-41881484 CACTCCCCACACCTGGGACCAGG + Intergenic
1166381531 19:42357573-42357595 CACCCCCCACAGGTGGGGCTGGG + Exonic
1167312376 19:48744559-48744581 AACACCTCACACGTGGGATTGGG - Intronic
927073589 2:19554503-19554525 CCCACCTCATTCGTGGGACAAGG - Intergenic
927173255 2:20387957-20387979 CTCACCCCACTTGTGGGACCTGG + Intergenic
928023500 2:27721759-27721781 CACACCCCACTGGAGGTTCTGGG - Intergenic
931701181 2:64910369-64910391 CACACCCCACCCATGGAACCAGG + Intergenic
932128224 2:69164281-69164303 CACAGCCCACTCTTGGCAGTTGG + Intronic
944556151 2:200889540-200889562 CACAGCGCACTAGTGGGACAGGG + Exonic
946884133 2:224206186-224206208 CACAAACCACTCATGGGACAGGG + Intergenic
1169405367 20:5317135-5317157 CACACCGCACTCGTCGGAGCCGG - Intergenic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1174080381 20:47967217-47967239 CACAGCCCACTGCTGGGGCTGGG + Intergenic
1174137212 20:48388056-48388078 CACAGCCCACTGCTGGGGCTGGG - Intergenic
1179979227 21:44887800-44887822 CACAACCCACATGTGGGCCTGGG - Intronic
1180051686 21:45334610-45334632 CACACTGCACCTGTGGGACTCGG - Intergenic
1180920361 22:19518506-19518528 CACAACCCACTCTGGGGACGGGG + Intronic
1183363709 22:37396307-37396329 CACACCCCAAGGGTGGGACGAGG + Intronic
961537449 3:127578765-127578787 CACAGCCCACTCCTCTGACTGGG + Intronic
964471615 3:157063061-157063083 CCCACCCCATTCCTGGGACCAGG - Intergenic
976021460 4:80633386-80633408 GACACTCCACTCGTGACACTCGG - Intronic
977418261 4:96763707-96763729 CACACACCACTTGGGGGCCTGGG - Intergenic
982351924 4:154425304-154425326 CACACGCTACTTGAGGGACTGGG - Intronic
984858878 4:184219423-184219445 CACTCCCCTCTCAGGGGACTTGG + Intronic
985566436 5:620701-620723 CACACCCCACCACTGGGACAGGG + Intronic
996343574 5:122465457-122465479 CACAGCCCACTTTTGGGATTTGG + Intergenic
1004982560 6:21042425-21042447 AACACCTCTCTCGTGGCACTGGG + Intronic
1005353614 6:24960906-24960928 CACCCCTCACTCGTATGACTGGG - Intronic
1018738932 6:166712700-166712722 CACAGCCCACCTGTGGGCCTCGG - Intronic
1019417599 7:934560-934582 CCAGCCCCACTCGTGGGACTTGG - Intronic
1032502074 7:132407235-132407257 GACACCCCACCCCTGGGACTCGG + Intronic
1034336863 7:150329540-150329562 CACAGCCCACTCTTGGGACAGGG - Intronic
1034889881 7:154830348-154830370 CAGAAGCCACTCGGGGGACTGGG + Intronic
1040025205 8:42775424-42775446 CTCACCACACTCCTGGGACATGG - Intronic
1040781729 8:51117423-51117445 CCCACCCCATGCTTGGGACTGGG + Intergenic
1041990101 8:63977190-63977212 CACACTGCAATGGTGGGACTGGG + Intergenic
1049651835 8:143773383-143773405 CCCACCCCACTCCTGGGCCTGGG - Intergenic
1049709824 8:144058453-144058475 CACTGCCCACTCCTGGGCCTGGG - Intronic
1051250881 9:15157558-15157580 CACATCACCCTTGTGGGACTTGG + Intergenic
1060039342 9:120286293-120286315 CAGAACCCACTTGGGGGACTAGG + Intergenic
1061088281 9:128411953-128411975 CGCACCCCACTCCTGGTTCTGGG - Intronic
1186106497 X:6213037-6213059 CCCACCCCACTTTAGGGACTTGG + Intronic
1193112433 X:77743272-77743294 CACAACTCACTCCTGGGACCAGG + Intronic