ID: 1129876450

View in Genome Browser
Species Human (GRCh38)
Location 15:78978789-78978811
Sequence CAGGGCACACAGAGGAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 860
Summary {0: 1, 1: 1, 2: 6, 3: 84, 4: 768}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129876450_1129876458 5 Left 1129876450 15:78978789-78978811 CCCTCCCTCCTCTGTGTGCCCTG 0: 1
1: 1
2: 6
3: 84
4: 768
Right 1129876458 15:78978817-78978839 GTCTCTGCAAGTCCAGAACCTGG 0: 1
1: 0
2: 0
3: 15
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129876450 Original CRISPR CAGGGCACACAGAGGAGGGA GGG (reversed) Intronic
900206140 1:1432679-1432701 CCCAGCACACAGACGAGGGATGG + Intergenic
900313086 1:2043815-2043837 GAGGGCACCCAGGGGAGGCAGGG - Intergenic
900532623 1:3162187-3162209 CTGGGCACAGAGAGGGGTGATGG - Intronic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
901017295 1:6239171-6239193 CAGGGTTCACAGAGCAGTGATGG + Intergenic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901365756 1:8746825-8746847 GAGGGCAGGCAGGGGAGGGAGGG + Intronic
901490008 1:9591848-9591870 CAGGGCAGACGGCAGAGGGAGGG - Intronic
901670339 1:10852254-10852276 CAGGGCTCCCAGAGGAGGTGGGG + Intergenic
901935299 1:12622424-12622446 CAGGCCTCACCGAGGAGGAAAGG - Intergenic
902653914 1:17854444-17854466 CTGGACACACAGAGGAGGCGGGG + Intergenic
902763226 1:18597942-18597964 CAGGGCAGACAGTGGAGGTGGGG + Intergenic
902814494 1:18908421-18908443 CAGGGCCTCCAGAGAAGGGAGGG + Exonic
903194196 1:21672680-21672702 CAGGGCACACGCATCAGGGAAGG + Intergenic
903449170 1:23441326-23441348 CAAGGCCCACCGTGGAGGGAGGG - Intronic
903501685 1:23803811-23803833 CAGGGCCCTCAGTGGCGGGACGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903705691 1:25284104-25284126 CAGGACACACAGAAAAGAGAGGG - Intronic
903721550 1:25409316-25409338 CAGGACACACAGAAAAGAGAGGG + Intronic
904457411 1:30655973-30655995 CAGGGGTGACAGAGGAGAGAGGG - Intergenic
904616510 1:31752970-31752992 CAGTGCCCACAGGGGAGGTAGGG + Intronic
904783922 1:32971385-32971407 CTGGGGACACAAAGGATGGAGGG - Intergenic
905124529 1:35707790-35707812 GAGGGCGCACAAAGCAGGGAGGG - Intergenic
905287212 1:36889347-36889369 CATGGCACCCTGAGGAGGGCAGG + Intronic
905499659 1:38426606-38426628 CTGGGCACAGAGACTAGGGAGGG - Intergenic
905937864 1:41839172-41839194 CAGGGTCCACAGAGGAGGGAAGG + Intronic
906528182 1:46508604-46508626 CAGAGCACAGAGAGGAGTCAGGG + Intronic
906744646 1:48213197-48213219 CTGGGCACAGAGACTAGGGAGGG + Intergenic
907208930 1:52801208-52801230 CAGGGAAGGCTGAGGAGGGAGGG + Intronic
907248027 1:53120465-53120487 CAGGGGACGCAGGGCAGGGAAGG - Intronic
907338457 1:53716109-53716131 CAGCTCCCACAGAGGAGGGGAGG + Intronic
907476713 1:54710680-54710702 CATGGCACCCAGAGGAGGGCTGG - Intronic
909223762 1:72991954-72991976 CTGGGCACAGAGAGTAGGAAGGG + Intergenic
909339880 1:74519896-74519918 CAGGGCATCCAGAGCAGAGAAGG - Intronic
909340024 1:74521017-74521039 CAGGGCAACCAGAGCAGAGAAGG - Intronic
909659064 1:78062372-78062394 CAGAGAACACAGAAGAAGGAAGG - Intronic
910324875 1:85995567-85995589 CATGGTACCCTGAGGAGGGAGGG + Intronic
910483348 1:87682824-87682846 CAGGGCACACTGTGGAGCGCAGG - Intergenic
910591710 1:88933379-88933401 AAGGGAAAAGAGAGGAGGGAGGG + Intergenic
911334739 1:96568985-96569007 CAAGGTACACTGAGGAGAGAGGG - Intergenic
912296362 1:108474494-108474516 CCGGGCACAGAGACTAGGGAGGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915932261 1:160068078-160068100 TGGGGCACACGGAGGAGGTAGGG + Intronic
916127167 1:161581641-161581663 CAGGACACCCAGGGGAGGGAAGG + Intronic
916137087 1:161663445-161663467 CAGGACACCCAGGGGAGGGAAGG + Intronic
916166538 1:161971218-161971240 CAGGGCACACTGAGAACCGAGGG - Intergenic
916482958 1:165232122-165232144 CAAGGTCCACAGAGCAGGGAAGG + Intronic
916512138 1:165481863-165481885 GAGGGGAGACAGGGGAGGGAGGG + Intergenic
918302565 1:183217174-183217196 TAGGGCAGGCAGAGGAGGAACGG + Intronic
918361164 1:183759422-183759444 CAGGCCAAACAGAGGAGATAAGG + Intronic
919350584 1:196448525-196448547 CAGGCCACACAGTAGAGGGCAGG - Intronic
919476282 1:198036321-198036343 CTGGGCACAGAGACTAGGGAGGG - Intergenic
919610925 1:199744818-199744840 CAGGGCACAATGAGCAGGCATGG + Intergenic
919770740 1:201156706-201156728 CAGGGCACATGGAGGATGTATGG - Intronic
920089184 1:203440342-203440364 CAGGGCCCAGAGAGGATGGGTGG - Intergenic
920678205 1:208053229-208053251 CAGGACACACAGCGGATGAATGG - Intronic
921270965 1:213469502-213469524 CAGGGTACACATGGAAGGGAGGG + Intergenic
921367430 1:214386929-214386951 CAGAGAACACAGAGGAGGTGGGG + Intronic
922591966 1:226784219-226784241 CAGGGCACATAGAGGAGAGAAGG - Intergenic
922718974 1:227890705-227890727 CAGGGCAGAAAGAAGAGGGTGGG + Intergenic
922888117 1:229036242-229036264 CAGGGGAATCAGAGGAGGGAAGG - Intergenic
922996274 1:229964272-229964294 CAGGGCACACAGGGAAGGAGAGG + Intergenic
923032643 1:230262424-230262446 CACGGCACACAGCAGAGGGTGGG - Intronic
923149209 1:231218843-231218865 AAGGGCGCAAAGAGGAGGGTGGG - Intronic
923211659 1:231808922-231808944 GAGGGCACAGAGAGTCGGGAGGG + Intronic
923296971 1:232603573-232603595 CAGGACCCACAGAGCCGGGAGGG + Intergenic
923621971 1:235587074-235587096 CAGGGCAAAGGGAGGAGGGGAGG + Intronic
923759560 1:236828675-236828697 CAGCACACACACAGTAGGGAGGG - Intronic
923962669 1:239102869-239102891 CTGGGCACAGAGACTAGGGAGGG - Intergenic
924301256 1:242640434-242640456 CAGGGCTCACCGAAGATGGAGGG - Intergenic
924432311 1:244007643-244007665 AAGGACACTCAAAGGAGGGACGG - Intergenic
924449670 1:244166157-244166179 CAGGGGTCAAAGAGCAGGGAGGG + Intergenic
924670626 1:246120757-246120779 CTGGAAACACACAGGAGGGATGG - Intronic
1062910702 10:1209822-1209844 AAGCCCACACAGAGGACGGAGGG + Intronic
1062995202 10:1859065-1859087 CAGGGCACAGAGGGGCGGGCTGG + Intergenic
1063016765 10:2085990-2086012 CATGGCACACAGATGATGCAAGG - Intergenic
1063018753 10:2104925-2104947 CAGGGCAGCCGGAGGCGGGAGGG + Intergenic
1063366935 10:5496663-5496685 CAGCCCAGGCAGAGGAGGGAAGG + Intergenic
1063937025 10:11088753-11088775 CAGGGCACAGAGATGGTGGATGG + Intronic
1064025112 10:11842529-11842551 CAGCACACACATGGGAGGGAGGG - Intronic
1064158175 10:12920940-12920962 AGGGGCTCACAGAGGAGGGCAGG + Intronic
1064252409 10:13716974-13716996 TGGGGCACTCTGAGGAGGGAAGG - Intronic
1064272591 10:13878909-13878931 CAGGACAGACAGATGAGGCAGGG + Intronic
1064580360 10:16787329-16787351 CAGGGCAGAGTGAGGAGGAAGGG - Intronic
1065437516 10:25717933-25717955 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1065784957 10:29204361-29204383 CATGGGACAAAGAGCAGGGATGG - Intergenic
1065827425 10:29584745-29584767 CAGGGCATTCTGAGGTGGGAAGG + Intronic
1065948087 10:30625574-30625596 CCAGCCACCCAGAGGAGGGAAGG + Intronic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1067059058 10:43068463-43068485 CGGGGCACAGCTAGGAGGGAAGG + Intergenic
1067528836 10:47055736-47055758 CAGGGAAGAAGGAGGAGGGAGGG + Intergenic
1067666806 10:48286071-48286093 CAGGGGACACCAAGGAGGGAGGG - Intergenic
1067766478 10:49091136-49091158 CAGGTCTCACAGTGGAGGGAGGG + Intronic
1069135005 10:64752887-64752909 CAGGACAGACAGAGGATTGAGGG + Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069855853 10:71440650-71440672 CAGAGCCCACGGAGGAGGGTAGG + Intronic
1070397644 10:76025349-76025371 CAGGACAAGCATAGGAGGGATGG + Intronic
1070481002 10:76882688-76882710 CAAGGGCCACAGAGGAGGGCTGG - Intronic
1070626395 10:78054147-78054169 CTGGGCAGGCAGAGGAGGGCTGG + Intronic
1070678518 10:78432803-78432825 CAGGGCACACAGTGGAGGTCTGG + Intergenic
1070923506 10:80203786-80203808 TAGGCCAGACAGGGGAGGGAGGG + Intronic
1072317068 10:94213507-94213529 CAGGGCTCTCTGAGGAGGTAGGG - Intronic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1072732056 10:97852829-97852851 TAAGGAACTCAGAGGAGGGATGG + Intronic
1073190375 10:101646599-101646621 CAGGGGACGCAGAGCTGGGAGGG + Intronic
1073977419 10:109117225-109117247 CATGGCAGACAGTGGAGGAAGGG - Intergenic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074764107 10:116687822-116687844 CAGGGGCCCCAGTGGAGGGAGGG - Intronic
1074790886 10:116886953-116886975 CCAGGGACACACAGGAGGGAAGG - Intronic
1075222984 10:120600689-120600711 CAGGAAACAGAGAGGATGGAAGG + Intergenic
1075249204 10:120850659-120850681 CACTGAACACAAAGGAGGGAAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075345914 10:121681880-121681902 AAAGGCACACAGAGGCAGGATGG - Intergenic
1075401434 10:122163910-122163932 CAGGGCACAGCGAGGATGGGAGG + Intronic
1075414173 10:122250172-122250194 CAGTGCTCACAGTGGATGGAGGG - Intronic
1075443952 10:122500985-122501007 CAGGGCACACAGAGGTCAGCGGG - Intronic
1075655276 10:124156942-124156964 CCGGGCACACAGAATGGGGAAGG + Intergenic
1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG + Intergenic
1075923334 10:126231550-126231572 CAGGGCAAGGAGAGGATGGAAGG - Intronic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076783035 10:132734972-132734994 AAGGCCACACAGAGGCGGGCAGG + Intronic
1077172855 11:1176137-1176159 CAGCACACACTGGGGAGGGAGGG - Intronic
1077467363 11:2739796-2739818 CAGGGGACAGAGAGAGGGGAGGG + Intronic
1077470066 11:2753481-2753503 GAGGGGACACAGAGCAGGTAGGG - Intronic
1077491778 11:2864316-2864338 GAGGACACTCAGAGGAGGAATGG - Intergenic
1078563025 11:12389646-12389668 CAGGGCAACAAGAGAAGGGATGG + Intronic
1078577232 11:12512849-12512871 GAGGGCACAGAGAAGAGGGCTGG - Intronic
1078911149 11:15733370-15733392 CAGGTAAGACAGAGAAGGGAAGG + Intergenic
1079108304 11:17588393-17588415 CACGGAACACAGAGCTGGGAAGG - Intronic
1079109492 11:17596477-17596499 CAGTGCACACAGAGGAGGCTGGG + Intronic
1079601377 11:22316158-22316180 CAGGGGAGACAGAGGCAGGAGGG - Intergenic
1079727192 11:23891372-23891394 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1079998439 11:27320926-27320948 GGGAGCACACAGGGGAGGGATGG - Intergenic
1080559830 11:33452778-33452800 CAGGGGACACACAGGGGCGAGGG - Intergenic
1080594583 11:33759415-33759437 CAGGGTCCACAAAGGAGAGAGGG + Intronic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1080855312 11:36106807-36106829 CAGGTCACACAGCAGAGGGAGGG - Intronic
1081592880 11:44437238-44437260 CTGAGCACACAGAGGAGGTGGGG - Intergenic
1081620729 11:44617908-44617930 CAGGGCACAAGGAGAATGGACGG - Intronic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082718673 11:56646561-56646583 CAGGGGAGACAGAAGAAGGATGG - Intergenic
1083445502 11:62705788-62705810 GAGGGAACACAGTGGAGGAAAGG - Intronic
1083829330 11:65221274-65221296 CAGGGGACACAAAGGATGGCAGG + Intergenic
1083927041 11:65813962-65813984 CAGCGCAGACCAAGGAGGGAAGG - Intergenic
1084047047 11:66575118-66575140 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1084176203 11:67423681-67423703 CAGGGCACAGCATGGAGGGAGGG - Exonic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1084440395 11:69169462-69169484 CAGGGCAGAAAGAGGAGAAAGGG + Intergenic
1084440643 11:69170907-69170929 CAGGGCAGAAAGAGGAGAAAGGG - Intergenic
1084657069 11:70525861-70525883 CAGGAGTCACAGAGCAGGGAGGG - Intronic
1084871767 11:72103247-72103269 CAGGCCGCGCCGAGGAGGGACGG + Exonic
1085473451 11:76773036-76773058 GAGGACAGACAGAGCAGGGAGGG + Intergenic
1085567147 11:77524550-77524572 CAGAGAACACAGAAGAGGGCAGG - Intronic
1086719323 11:90100882-90100904 CAGGGGACAGAAAGGAAGGATGG + Intergenic
1088182905 11:107132285-107132307 CAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1088764736 11:112963513-112963535 CAGGGCCCGGAGAGGAGGGGTGG + Intronic
1088818263 11:113435770-113435792 CAGAGCCCAGAGAGGAGGAAGGG + Intronic
1089002179 11:115060979-115061001 CAGCCCACAAAGTGGAGGGAGGG - Intergenic
1089556025 11:119316436-119316458 TAGGGGACAGAGATGAGGGATGG - Intronic
1089637868 11:119827852-119827874 GAGAGCACAAAGAGGAGGTAGGG + Intergenic
1089965892 11:122655098-122655120 CAGGGCAGAAAGAAGAGGGAAGG - Intergenic
1089987321 11:122826148-122826170 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1090228570 11:125085921-125085943 CAAGGCACAGAGGGAAGGGAGGG - Intronic
1090667866 11:128926874-128926896 CAGAGGACACAGAAGCGGGATGG - Intergenic
1090902713 11:131046900-131046922 CACGGCCCCCAGCGGAGGGACGG + Intergenic
1091331844 11:134736782-134736804 GAGTCCACACAGGGGAGGGAGGG - Intergenic
1091649982 12:2302637-2302659 CAGGGCACATACAGGAGCAAAGG - Intronic
1091810072 12:3389684-3389706 CTGGGGACACAGAAAAGGGAAGG + Intronic
1092137303 12:6158937-6158959 CATGGCGTTCAGAGGAGGGATGG - Intergenic
1092474376 12:8806463-8806485 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1092626861 12:10337112-10337134 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1092704770 12:11270236-11270258 CTGGGCACACAGATGACAGAAGG + Intergenic
1093193181 12:16098802-16098824 CAGGGAACACAGATGAGGTCTGG + Intergenic
1094474818 12:30833052-30833074 CAGGGTGCACAGAGGAGGTGGGG - Intergenic
1096042053 12:48526175-48526197 CAGGACAGAGGGAGGAGGGATGG - Exonic
1096148214 12:49293581-49293603 CAGGACGCACAAAGGGGGGAGGG + Intronic
1096559533 12:52425610-52425632 CAAGGAACACCGAGGATGGATGG + Intronic
1096737306 12:53665736-53665758 CAGGGCCCAAATAGGATGGAAGG + Intronic
1096868211 12:54577658-54577680 CAGGGCACACAGCTCAGTGAGGG + Intronic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097229200 12:57498884-57498906 CAGGACACAGAGAGGAAGGGAGG - Intronic
1097282643 12:57854200-57854222 CAGGGAAAACAGAGGAGGAGGGG + Intergenic
1097690696 12:62731971-62731993 CAAGGCTCAGATAGGAGGGAAGG - Intronic
1099528085 12:83740826-83740848 GAGGGCAAACAGAAGAGGGTGGG + Intergenic
1099685023 12:85874174-85874196 CAGGGCAAAGAGGGGAGGGATGG + Intergenic
1100068424 12:90680277-90680299 TTGGGCACAGAGAGGAGTGAGGG - Intergenic
1100102574 12:91126706-91126728 CTGGGCAAACAGAAGAGGGAGGG + Intergenic
1100304578 12:93338592-93338614 CAGGGCGCATCCAGGAGGGATGG - Intergenic
1101038659 12:100731652-100731674 CAGGGGTCAGAGTGGAGGGAAGG - Intronic
1101331139 12:103758766-103758788 CACGGCACACAGAGGATTGGCGG + Intronic
1101828178 12:108236953-108236975 GAGGGGAGACAGAAGAGGGAAGG + Intronic
1101957270 12:109222661-109222683 TAGGGGACACATAGGAGGGTGGG - Intronic
1102030287 12:109736408-109736430 TAAGGCTCAGAGAGGAGGGAGGG + Intronic
1102058720 12:109915939-109915961 GAGGACACCCACAGGAGGGAGGG - Intronic
1102495161 12:113314595-113314617 CAGGTCACATAAACGAGGGAAGG + Intronic
1102650988 12:114442321-114442343 CAGCACACAAAGAGGAGGAAAGG - Intergenic
1102925395 12:116822156-116822178 AAGGGGACAGAGAGGAGGGCTGG - Intronic
1103597101 12:122030589-122030611 CAGATCACACAGATGAGGGTTGG - Intronic
1103743813 12:123108828-123108850 GAGGGCACCCGGAGAAGGGAAGG + Intronic
1103911772 12:124355921-124355943 GAGGGCACACAGCACAGGGAGGG - Intronic
1104038770 12:125115988-125116010 CTGGTCACAGAGAGCAGGGAGGG - Intronic
1104092761 12:125529522-125529544 CAGGACACACAGAGGTGGGAAGG - Intronic
1104094890 12:125548070-125548092 CTGGGGCCACAGAGAAGGGAAGG + Intronic
1104218747 12:126761270-126761292 CATGGCAGAAAGAAGAGGGAAGG - Intergenic
1104255302 12:127130994-127131016 CATGGCCCACACAAGAGGGAGGG - Intergenic
1104386274 12:128354274-128354296 CCGGCCACTCAGTGGAGGGAGGG + Intronic
1104549918 12:129746978-129747000 CAAGGCACCCAGATGAGAGACGG - Intronic
1104586330 12:130050993-130051015 CAGGGGACAGAGAGGAGAGGTGG - Intergenic
1104645845 12:130496745-130496767 CAGGCCACCCAGAGGAGCCAAGG + Intronic
1104775959 12:131390229-131390251 GAGGGCACAGACAGGAGGCAGGG - Intergenic
1104781462 12:131423075-131423097 CAGGTCAGGCAGTGGAGGGAGGG + Intergenic
1105353828 13:19639691-19639713 CAGGGGTAAGAGAGGAGGGAAGG + Intronic
1106477102 13:30108341-30108363 TAGGGCGCAGTGAGGAGGGAGGG - Intergenic
1106728865 13:32517848-32517870 CAGGGGAGACAGAGGTGGGGAGG - Exonic
1106827340 13:33538391-33538413 CAGGGCCCACGAAAGAGGGAAGG + Intergenic
1107410112 13:40150672-40150694 TGGGGGAAACAGAGGAGGGAGGG - Intergenic
1107711347 13:43153300-43153322 GAGGGCACACAGAGATAGGAAGG - Intergenic
1108432763 13:50371031-50371053 CAGAGCACACAGAGGGGAGGAGG + Intronic
1109499178 13:63214651-63214673 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1109738379 13:66518172-66518194 CAGGAAAAACAGAGGAGGGGAGG + Intronic
1110260823 13:73483338-73483360 CAGGTCACAGAGAGGATGGAAGG - Intergenic
1111362239 13:87190659-87190681 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1112140062 13:96631269-96631291 CAAGGCACAAAGGGGAGGAAGGG - Intronic
1113438242 13:110309043-110309065 CAGTGCGCGCTGAGGAGGGAGGG - Intronic
1113765820 13:112880573-112880595 CAGGCCGCACAGAGCAGCGATGG + Intronic
1114650891 14:24284047-24284069 CAGGACACACTGAGGGGGCAAGG + Intergenic
1114651949 14:24290893-24290915 TTGGGCACACGGAGGAAGGAGGG + Exonic
1116534893 14:46016587-46016609 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1117267116 14:54100849-54100871 CAGAGCACCCAGAGAGGGGATGG - Intergenic
1117275440 14:54188623-54188645 CATGGCACACAAGGGAAGGAGGG - Intergenic
1117288302 14:54308574-54308596 CAGCCCACACATAAGAGGGAGGG + Intergenic
1117562503 14:56955577-56955599 CAGTGCATACAGGGGAGTGATGG + Intergenic
1118327691 14:64792678-64792700 CAGGTCACACAGAGGAAAAATGG - Intronic
1118440408 14:65806658-65806680 CCGGGGACAGAGAGAAGGGAAGG - Intergenic
1118704893 14:68471528-68471550 CAGTGAACAAAGGGGAGGGAAGG - Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1119180216 14:72600332-72600354 CTGGGGACAGAGAGGAGGGAGGG - Intergenic
1119727234 14:76928867-76928889 GAGGGGAGACACAGGAGGGAAGG + Intergenic
1119969135 14:78949697-78949719 CAGGGAAGGCTGAGGAGGGATGG + Intronic
1120781573 14:88490458-88490480 CAGGGCAGGAAGAGGTGGGAGGG - Intronic
1121002796 14:90464357-90464379 CCAGGAGCACAGAGGAGGGAGGG - Intergenic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121205112 14:92158188-92158210 CAGGACAGACAGAGTAGGAAAGG + Intronic
1121441730 14:93953917-93953939 CAGGGCTCAGAGAGGAGGCACGG + Intronic
1121746103 14:96294487-96294509 CAGTGCCCACTGAGCAGGGAGGG + Intronic
1122122584 14:99562294-99562316 CAGGGGTGCCAGAGGAGGGAGGG - Intronic
1122246152 14:100404853-100404875 CATGTCACTCACAGGAGGGATGG - Intronic
1122293875 14:100694201-100694223 CAGGGCACACAGAGCGGGGGCGG + Intergenic
1122371904 14:101233611-101233633 AAGGCCACACAGCGGAGGGTCGG + Intergenic
1122374239 14:101247796-101247818 AAGGACACACACTGGAGGGAGGG - Intergenic
1122593655 14:102873351-102873373 CAAGGCACAGAGTGGAGGGGAGG - Intronic
1122622327 14:103066533-103066555 AAGGTCACACACAGGAAGGAAGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122935390 14:104953612-104953634 CAGAAGACACAGAGCAGGGAAGG - Exonic
1202904299 14_GL000194v1_random:59620-59642 CTGGGCACAGTGGGGAGGGAGGG + Intergenic
1202863456 14_GL000225v1_random:100150-100172 AAGGGCACAGAGAGGCGAGAGGG + Intergenic
1123450708 15:20357609-20357631 CAGGCCTCACAGTGGAGTGAGGG + Intergenic
1123504361 15:20924799-20924821 CAGGGGACACTGGGAAGGGATGG - Intergenic
1123561607 15:21498498-21498520 CAGGGGACACTGGGAAGGGATGG - Intergenic
1123578479 15:21695573-21695595 CGGGGCACTCAGAAGAGGGAGGG + Intergenic
1123597851 15:21935779-21935801 CAGGGGACACTGGGAAGGGATGG - Intergenic
1123615104 15:22138055-22138077 CGGGGCACTCAGAAGAGGGAGGG + Intergenic
1124380652 15:29162217-29162239 GAGGGCAGCCAGAGGAGCGAGGG + Intronic
1125341838 15:38683124-38683146 CAGCACAGACAGATGAGGGATGG - Intergenic
1126462149 15:48925827-48925849 CAGCCCACACTGAAGAGGGATGG + Intronic
1127350310 15:58145176-58145198 AAGGGCACACAGAGGAGAAAAGG - Intronic
1127399871 15:58574926-58574948 CAGGGCCAAGAGATGAGGGAGGG - Intergenic
1127453141 15:59135810-59135832 TATGGCACCCAGAGGAGGAAAGG + Exonic
1127861524 15:62997880-62997902 GAGGGCACACAGAGATGAGAAGG + Intergenic
1127982219 15:64043794-64043816 CAAGTCACAAAGAGGAGGGAAGG - Intronic
1128380336 15:67107578-67107600 CAAGGCTCAGAGAGGCGGGAAGG - Intronic
1128447186 15:67774435-67774457 CAGGGCTCAGTGAGGAGGCAGGG + Intronic
1128496219 15:68200087-68200109 CAGGGCCCACAGGGGAGAGCAGG + Intronic
1128511092 15:68314251-68314273 CTGTGCCCACGGAGGAGGGATGG + Intronic
1128739665 15:70074735-70074757 CAGGGCACAAGTAGGGGGGAGGG + Intronic
1129236046 15:74224296-74224318 CAACGCACCCAGAGGAGGAAGGG - Intergenic
1129699578 15:77759955-77759977 CAGGGCCCACCCCGGAGGGAGGG + Intronic
1129704497 15:77786577-77786599 TAGGCCATGCAGAGGAGGGAGGG + Intronic
1129876450 15:78978789-78978811 CAGGGCACACAGAGGAGGGAGGG - Intronic
1130038244 15:80380928-80380950 CAGAGCACAAGGAGGAGAGAAGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130212946 15:81942954-81942976 CAAGGCACAGTGAGGAGGGAGGG + Intergenic
1130224571 15:82047053-82047075 CGGGGCACGGAGGGGAGGGATGG - Intergenic
1130731440 15:86497560-86497582 CATGGAACACAGCTGAGGGAAGG - Intronic
1130826696 15:87555415-87555437 CAGTGCACAAAGAAGAGGGAAGG - Intergenic
1131264965 15:90910395-90910417 CAGGGCAGGTAGAGGAGGGGTGG + Intronic
1131351471 15:91704648-91704670 CAGGGCTCACTGAACAGGGAAGG + Intergenic
1131455698 15:92580813-92580835 CAGAGCACACAGACCTGGGAGGG + Intergenic
1131684062 15:94752269-94752291 CTGGGCACAGAGACTAGGGAAGG - Intergenic
1132340955 15:101078462-101078484 CAGGGTGCAGAGAGGAAGGAAGG - Intergenic
1132341499 15:101081079-101081101 CAGGGCCCAGGGCGGAGGGAAGG - Intergenic
1132348038 15:101120534-101120556 CAGAGCTCACAGAGGAGTGTGGG - Intergenic
1202969952 15_KI270727v1_random:225623-225645 CAGGGGACACTGGGAAGGGATGG - Intergenic
1202987349 15_KI270727v1_random:429818-429840 CGGGGCACTCAGAAGAGGGAGGG + Intergenic
1132561983 16:599468-599490 CAGCGCACACGGAGGAGGCACGG - Intronic
1132626650 16:894562-894584 CAAGGCGCAGAGAGGAAGGACGG + Intronic
1132632910 16:928550-928572 GGGGGCATACAGAGGAGTGAGGG - Intronic
1133015193 16:2936542-2936564 CAGGGGCCACAGAGGTGGGGAGG - Intronic
1133025321 16:2986726-2986748 CTGGGCACTCATAGGATGGATGG + Intergenic
1133594611 16:7279607-7279629 CTGGGAATAGAGAGGAGGGATGG + Intronic
1133695000 16:8254605-8254627 AAGGTCACACAGCGGAGCGAAGG - Intergenic
1133792222 16:9017816-9017838 AAGGGCACACACAGCAGGGCAGG - Intergenic
1134798914 16:17066598-17066620 CTGGGCACACAGAGAACTGATGG + Intergenic
1134816278 16:17208284-17208306 CAGGGAACTCAAAGAAGGGATGG - Intronic
1135258207 16:20958663-20958685 CATGGAATACAGAGAAGGGATGG - Intronic
1136173509 16:28502509-28502531 CTGGGCACATGGAGGAAGGATGG - Intronic
1136355938 16:29744860-29744882 CAGGGCCCACAGGGCAGTGAGGG + Exonic
1136776938 16:32877027-32877049 CAGGGCTCAAAGAGGAGTTAAGG - Intergenic
1136893679 16:33984486-33984508 CAGGGCTCAAAGAGGAGTTAAGG + Intergenic
1137036828 16:35575239-35575261 CAGGGCCCCCAGAGGAAGCAGGG + Intergenic
1137456351 16:48620905-48620927 CAGGACACACACAGTGGGGAGGG + Intergenic
1138473351 16:57256182-57256204 CATGGGACGCAAAGGAGGGAGGG - Exonic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138539544 16:57679970-57679992 CAGGGAGCAAAGAGGAGGGGAGG - Intronic
1141139579 16:81488607-81488629 AGGGGCACACAGAGAGGGGATGG - Intronic
1141148255 16:81547069-81547091 GTGGGCACACAGATGTGGGATGG + Intronic
1141159216 16:81617916-81617938 CAGTGGACACAGAAGAGGGAGGG + Intronic
1141497515 16:84420165-84420187 CAGGGTGTACAGAGCAGGGAGGG - Intronic
1141742867 16:85905646-85905668 CAGGCCTCTCAGAGGATGGATGG - Intronic
1141805465 16:86338697-86338719 AGGGGGACTCAGAGGAGGGAGGG - Intergenic
1141900415 16:86987107-86987129 CACGGCACACACAGGAGACAGGG - Intergenic
1142277981 16:89132917-89132939 CAGGGCCCACAGAGGACGGCGGG + Intronic
1142309026 16:89301459-89301481 CAGGGCAGGCAGAGCAGGGCAGG + Intronic
1203079354 16_KI270728v1_random:1139136-1139158 CAGGGCTCAAAGAGGAGTTAAGG - Intergenic
1142854607 17:2722838-2722860 CAGGACCCACACAGGAGGGATGG + Intergenic
1143448793 17:7023590-7023612 AAAGGCAAACAGAGGAGGGAAGG + Intronic
1143484201 17:7244053-7244075 CAGGGCAGAGAGGGGTGGGAGGG + Exonic
1143646207 17:8231955-8231977 GGGGGCACCCAGAGGAAGGAGGG - Exonic
1143784649 17:9247393-9247415 CAGGCCACACAGGGTGGGGACGG - Intergenic
1143875886 17:9990471-9990493 CAGGGACCACCCAGGAGGGAAGG + Intronic
1144031621 17:11328257-11328279 CAAAGCCCACAGAGGTGGGAGGG - Intronic
1144297144 17:13886895-13886917 CAGGGCACACACAGGTGGTTAGG - Intergenic
1144584268 17:16478523-16478545 ATGGGCACACGGAGCAGGGAGGG - Intronic
1144726292 17:17504269-17504291 CAGGGCACATGGTGGAGGCAGGG - Intergenic
1145077398 17:19867429-19867451 CGGGGCACACAGCGGACGGGCGG + Exonic
1145229430 17:21161877-21161899 CAGCAAACACAGAGGAGGAAGGG - Intronic
1145399149 17:22517179-22517201 TAGGGCAAAAAGAGAAGGGAAGG + Intergenic
1145879904 17:28345352-28345374 CAGAGTGCACCGAGGAGGGAAGG + Exonic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146464323 17:33074327-33074349 CAGGGCCAACACAGAAGGGAGGG - Intronic
1146530344 17:33603077-33603099 CATGGCACACAGAGGAAGATGGG - Intronic
1146686635 17:34845597-34845619 CAGGGAAGACAGAGAAGCGACGG + Intergenic
1146745350 17:35323883-35323905 CAGGTCACACAGATGAAGGATGG + Intergenic
1146951865 17:36912556-36912578 AAGGCCACACAGATGAAGGAGGG - Intergenic
1147255191 17:39177173-39177195 CAGGGAACATGGAGGAGGAAGGG - Intronic
1147842404 17:43381328-43381350 AAGGGCAGCCAGAGGAGGAATGG - Intergenic
1148240230 17:45995572-45995594 AAGGACACCCAGAGGAGGGAGGG + Intronic
1148588221 17:48796195-48796217 GAGGGCACAGAGAGGAAGCAGGG - Intronic
1148610530 17:48961698-48961720 CAGGGCGCAGAGGGAAGGGAGGG - Intronic
1148696946 17:49566296-49566318 CAGAGGCCACAGTGGAGGGAGGG + Intergenic
1148742133 17:49898822-49898844 CTGTGCACACAGAAGAGGGATGG - Intergenic
1148768411 17:50052885-50052907 TAGGGCACAGAGAAGAGGGAAGG + Intergenic
1148778695 17:50109913-50109935 CAAGGCACAGGGAGGTGGGAGGG + Intronic
1148860535 17:50602210-50602232 GTGAGCACAGAGAGGAGGGAAGG - Intronic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150331481 17:64297826-64297848 GAAAGCACATAGAGGAGGGAGGG - Intergenic
1150487438 17:65553709-65553731 CAGGGCAGAGAAAGGAGGCAGGG + Intronic
1150571608 17:66391812-66391834 GTGTGCACACAGGGGAGGGAGGG - Intronic
1151375894 17:73688848-73688870 CGAGGAACACAGAGGAGGGGAGG + Intergenic
1151756186 17:76076495-76076517 CACCGCACACAGAGGAGGTGGGG - Intronic
1151930515 17:77229012-77229034 CCGGTCACACAGAGGTAGGAAGG - Intergenic
1152008901 17:77698640-77698662 CTGGGCACACAGAGGAGGAGAGG - Intergenic
1152020783 17:77779277-77779299 CAGGGCACTGAAAGGAGGCAGGG - Intergenic
1152022468 17:77787737-77787759 AAGGGCACACAGAAGAGAGAGGG + Intergenic
1152337728 17:79707727-79707749 CAGGCCTCACAGTGGAGTGAGGG - Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152592959 17:81222715-81222737 CAGGGCGCACGGAGGTTGGAGGG - Intronic
1152709493 17:81863895-81863917 CAAGGCACACAGACCAGGCAAGG + Intergenic
1153011706 18:545590-545612 CAGGACACACAGACCAGTGAGGG - Intergenic
1154008814 18:10558631-10558653 CAAGGCACATGGAGGAGGTAAGG - Intergenic
1154428766 18:14292268-14292290 CAAGACAGACAGAGGAGAGAGGG - Intergenic
1154503074 18:15005989-15006011 CAGGGGTCACAGAGGATGGTGGG + Intergenic
1155227391 18:23740870-23740892 CTGCTCACCCAGAGGAGGGAAGG - Intronic
1155294346 18:24371632-24371654 CAGGGAGCACAGAGTAGGGAGGG - Intronic
1155901539 18:31396891-31396913 CAGGGCACACACAGCTGGGAAGG - Intronic
1155941428 18:31805305-31805327 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1156337619 18:36185261-36185283 AATGGCACTCTGAGGAGGGAGGG - Intergenic
1156454106 18:37283201-37283223 CAGGGTAGAAGGAGGAGGGATGG - Intronic
1156768547 18:40689628-40689650 CAGGGCAGAAAGAGGAGGAAAGG - Intergenic
1156906339 18:42357015-42357037 CAGGGAATGCAGAGTAGGGAAGG + Intergenic
1157280977 18:46346120-46346142 CTGGGCAGAGAGAGAAGGGATGG + Intronic
1157310166 18:46546796-46546818 CAGAGCCCACAGGGGAGGGAAGG + Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157397675 18:47356187-47356209 CAGAGCTCACCGAGGAGCGAGGG - Intergenic
1157439195 18:47697130-47697152 CAGGGCACAGAGAAGAGGGTGGG - Intergenic
1157489073 18:48109690-48109712 CAGGGCCTGCAGAGGAGGGAGGG + Intronic
1157500918 18:48190095-48190117 CAAGGCAGAGAGAAGAGGGACGG - Intronic
1157682820 18:49620211-49620233 CAGGGCACAGTTAGCAGGGAAGG - Intergenic
1157866900 18:51196076-51196098 CAGAGCTCACTGGGGAGGGAAGG - Intronic
1157978508 18:52353430-52353452 CTTGGGACACAGAGGAGGGAGGG - Intronic
1158391892 18:57051188-57051210 CAGGGGATAGAGAGGAGGGAGGG - Intergenic
1158394760 18:57070809-57070831 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1158734024 18:60059147-60059169 AGAGGGACACAGAGGAGGGAGGG - Intergenic
1160748778 19:723939-723961 GAGGGCCCACAGACCAGGGAGGG + Intronic
1161105540 19:2441976-2441998 CAGGGCACACCCAGAAGGCAGGG + Intronic
1161286004 19:3468561-3468583 CAGGGCATACAGTGGGGGGTGGG + Intronic
1161532965 19:4801114-4801136 CAAGGCACAGGGTGGAGGGAGGG - Exonic
1161661606 19:5550016-5550038 CTGGGCACAGAGAGTAGGAAGGG - Intergenic
1161950221 19:7463678-7463700 CACGGCACACAGAAGGGGGCAGG + Intronic
1162185149 19:8898881-8898903 CAGGGCAGAGTGAGGAGGGCAGG + Intronic
1162186338 19:8907730-8907752 CTGGGCAGAGTGAGGAGGGAAGG + Intronic
1162562384 19:11424125-11424147 CAGGGCTCAAACTGGAGGGAAGG + Intronic
1162582793 19:11540703-11540725 CAGGGGGCACAGAGGGGGCAGGG + Intronic
1162802692 19:13119723-13119745 CAGGGCACAGAGAAGAGTTAAGG + Intronic
1162959926 19:14119620-14119642 CAGGGCACAGAGAGGGGGAGCGG + Exonic
1163487164 19:17594924-17594946 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1163776999 19:19224694-19224716 GGGGGCTCACAGAGGAGGAAGGG - Intronic
1163926760 19:20353257-20353279 AAGAGCACACAGAGGGGGGAGGG - Intergenic
1164005176 19:21142072-21142094 CAGAGGACACAGAGCAGCGAAGG - Exonic
1164721230 19:30433080-30433102 CAGGGGACAGAGAGGAGATAGGG - Intronic
1165357227 19:35311733-35311755 CAGGGGCCACAGAGGTGGGAAGG + Intronic
1165459993 19:35938751-35938773 CAGTGGACAAAGAGAAGGGAGGG - Intronic
1165471712 19:36008161-36008183 CAGGGGACAGAGAGGAGGTGGGG + Intronic
1165610428 19:37146744-37146766 CAGGTCACATAGAGGGGGAAAGG - Intronic
1165935581 19:39386652-39386674 CAGGGCACCCATGGCAGGGAGGG - Intronic
1165992722 19:39825656-39825678 CAGGGCCCCCAGATGGGGGAGGG + Exonic
1166151232 19:40877131-40877153 CTGGGGACACAGAGAAGGGCTGG + Intronic
1166184110 19:41128229-41128251 CGGGGCACAGATTGGAGGGATGG - Exonic
1166297740 19:41897145-41897167 CAGGGCACAGAGCAGAGGGGTGG - Intronic
1166366772 19:42281792-42281814 CAGTGCCCACGGAGGAGAGATGG - Intronic
1166416208 19:42596292-42596314 CAGGACACACGGAGCAGGGGCGG + Intronic
1166736001 19:45085251-45085273 CAGGTCACAAAGAGGGAGGAAGG - Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166802986 19:45469455-45469477 CCGGGGACAGAGAGGGGGGAAGG - Intronic
1166945901 19:46396096-46396118 CTGGGCCCACAGAGGAGGTCTGG - Intergenic
1167003177 19:46757651-46757673 CAGGGCTCTCCCAGGAGGGAAGG - Exonic
1167072475 19:47228703-47228725 CAGGGCTCACACAGGACGGATGG + Intronic
1167252698 19:48409113-48409135 AAGGGCAAAGAGAGGAGTGAGGG + Intronic
1167326934 19:48832459-48832481 CTGGGGACACACAGGAGGGATGG + Intronic
1167736448 19:51297262-51297284 CAGGGCACACAGAGAGTGCATGG - Intergenic
925283744 2:2702724-2702746 CAGGGCTCAGAGAGCAGAGAGGG - Intergenic
925842614 2:8006714-8006736 CAGGGGGCAGAGAGGAGGCAGGG - Intergenic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
926107402 2:10160850-10160872 CAGGGCAGACAGAGGTGGCCAGG - Intronic
926241919 2:11094936-11094958 CTGGCCACAAAGAGAAGGGATGG + Intergenic
927514759 2:23665709-23665731 GAGGGCAGACAGAAGAGAGAGGG + Intronic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
927927422 2:27023688-27023710 CAGGGTCCAGAGAGGAGGAAGGG - Intronic
928087696 2:28356157-28356179 CAGGCCCCACAGAGCAGCGAAGG + Intergenic
928088430 2:28359844-28359866 GCCTGCACACAGAGGAGGGAGGG + Intergenic
928914574 2:36457433-36457455 CACTGTACACAGGGGAGGGATGG + Intronic
929010923 2:37443380-37443402 CAGGTCACAGAGATGAGGGGTGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
930118720 2:47742268-47742290 CAGGGGAGACAGTGGTGGGAGGG - Intronic
930152148 2:48069935-48069957 CAGGGAACAGAGGGGAGGGGAGG + Intergenic
930332435 2:50002677-50002699 CAGGGCAGAAAAATGAGGGAAGG - Intronic
931213013 2:60215366-60215388 CTCGGCACACAAAGGAGGGCCGG + Intergenic
931609047 2:64079383-64079405 CTGGGCACAGAGACTAGGGAGGG + Intergenic
931771802 2:65503788-65503810 CATCGCCCACAGAGAAGGGAAGG - Intergenic
931812900 2:65872382-65872404 AAGGGGACAAAGAGGAAGGAGGG + Intergenic
932607849 2:73176441-73176463 CAGGGCCCCCAGAGGTCGGAAGG + Intergenic
932702443 2:74001127-74001149 CTGGGAACACAGGGCAGGGAGGG - Intronic
934053562 2:88232302-88232324 CAGAGAACTTAGAGGAGGGATGG - Intergenic
934951186 2:98576721-98576743 CAGGCCACACAGGGGATGGCAGG + Intronic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
935802032 2:106707449-106707471 CAAGTCACAGAGGGGAGGGATGG - Intergenic
936236112 2:110744050-110744072 CAGGGCACAACTAGGAGGCAGGG - Intronic
936499860 2:113058684-113058706 CAGGAAAGACAGAGGAAGGAAGG + Intronic
937247273 2:120501819-120501841 CCAGGCCCACAGCGGAGGGAGGG + Intergenic
937626800 2:124053009-124053031 ATGGGCCCACAGAGCAGGGACGG - Intronic
937651664 2:124326131-124326153 AAGTGGAGACAGAGGAGGGAAGG + Intronic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938422429 2:131155554-131155576 CAGCGGACACCGATGAGGGAAGG - Intronic
938463104 2:131510557-131510579 CATGACACGCAGAGCAGGGAGGG - Intergenic
938502240 2:131836159-131836181 CAGGGGGCACAGAGGATGGTGGG + Intergenic
939083260 2:137687151-137687173 CTGGGCACAGAGACTAGGGAGGG + Intergenic
939237091 2:139508733-139508755 CAAGGCATACAGAGGAGGGAGGG + Intergenic
939983763 2:148811122-148811144 CAGGGAACCCAGAGGATGGCAGG - Intergenic
940660857 2:156543585-156543607 CTGGAAACACAGAAGAGGGAAGG + Intronic
941073246 2:160978461-160978483 CATGAGACACACAGGAGGGAAGG - Intergenic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
943794321 2:191972535-191972557 AAGGGGACACAGAGGAAGCAGGG + Intronic
944136564 2:196406082-196406104 CAGTGTACACAGAGAAAGGAAGG - Intronic
944318979 2:198313594-198313616 AAGGGGAAACAGAGGAGAGAAGG - Intronic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
945049207 2:205807246-205807268 TAAGGCACACAGGGGAGGGGAGG - Intergenic
945448147 2:209962314-209962336 GAGGCCACAGAGAGGAGGGCAGG + Intronic
945566591 2:211408372-211408394 AAGGACACAAAGAGGTGGGAGGG - Intronic
945901058 2:215538094-215538116 AAAGACAGACAGAGGAGGGAGGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945965751 2:216184881-216184903 CAGGGCATACAGAAGAAGGGAGG - Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
946886378 2:224226817-224226839 CTGGGCACAGAGACTAGGGAGGG - Intergenic
947344171 2:229173743-229173765 CAGGGCACACCGAAGTGGGGAGG - Intronic
947569862 2:231224836-231224858 TGAGGCAAACAGAGGAGGGATGG + Intronic
947734293 2:232446734-232446756 CAGGGGACACAGAAGAGGGCAGG - Intergenic
947859546 2:233348894-233348916 CAGGGCACGCAGACAAGGGATGG + Intergenic
947873568 2:233453353-233453375 CAGGACAAAGAGATGAGGGAAGG - Intronic
948057470 2:235019247-235019269 CAGGGCACTCAGGTGAGTGATGG + Intronic
948305416 2:236943799-236943821 CAGGGTAGACTGAGGATGGATGG + Intergenic
948329506 2:237154016-237154038 AAGGTCACACAGCAGAGGGAAGG - Intergenic
948384897 2:237575212-237575234 CAGGGTAAACACAGGAGGGGCGG - Intronic
948447287 2:238042807-238042829 CAGGCCACACAGAGCAGGAAGGG + Intronic
948623125 2:239249220-239249242 CGGGGCAGACAGAGGAGACACGG + Intronic
948694257 2:239725271-239725293 CAGGGGAGCCTGAGGAGGGAAGG + Intergenic
1170604191 20:17863644-17863666 CAGGGAGCACACAGCAGGGACGG - Intergenic
1170605975 20:17875394-17875416 CAGGGAACACAAAGAAGAGAGGG + Intergenic
1171249818 20:23638590-23638612 AAGGGAAGACAGAGGAGGGGCGG - Intergenic
1171953374 20:31440949-31440971 CTGGGCAGGAAGAGGAGGGATGG - Intronic
1172202093 20:33133624-33133646 CAGGGCTCTGAGAGCAGGGAGGG - Intergenic
1172599420 20:36173626-36173648 CAGGGCAAAGGGAGGAGGAAGGG - Intronic
1172837981 20:37885199-37885221 CAGGTCACACACAGGAAGGCTGG - Intergenic
1173167747 20:40697866-40697888 CTGATCACACAGAGCAGGGAGGG + Intergenic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173541639 20:43857156-43857178 CAGGGAAGGCAGAGGAGGAAGGG + Intergenic
1173951721 20:46998600-46998622 CAAGGCTCCCAGAGGAGGGAAGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174197813 20:48785936-48785958 CAGGGCAGAAAGAGCCGGGATGG + Intronic
1174338827 20:49883400-49883422 CACAACACACAGATGAGGGATGG - Intronic
1174447567 20:50601079-50601101 GAGGGAACACAGAGCAGGAAGGG + Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174837915 20:53875748-53875770 CTAGGCGCAGAGAGGAGGGAGGG + Intergenic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1174873673 20:54206176-54206198 CAGAGCACAGAGGGGAGGGGTGG - Intergenic
1175183820 20:57166575-57166597 AAAGGCACACAGTGGAGCGATGG + Intergenic
1175295038 20:57902602-57902624 AAGGGCACAGAAAGGAGAGAAGG + Intergenic
1175408438 20:58750600-58750622 CAGGGCTCACAGGTCAGGGAAGG + Intergenic
1175829032 20:61952007-61952029 CAGGGCAGACAAAAGAGGCATGG + Intergenic
1176053881 20:63134656-63134678 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176053947 20:63134798-63134820 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176054059 20:63135045-63135067 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176054116 20:63135186-63135208 CAGGGCCCAGAGAGGAGGCAGGG + Intergenic
1176054144 20:63135257-63135279 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176054185 20:63135345-63135367 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176054274 20:63135540-63135562 CAGGGCCCAGAGAGGAGGCGGGG + Intergenic
1176168130 20:63685220-63685242 AGGGGCACAGAGAGGAGGGCTGG + Intronic
1176239173 20:64067995-64068017 AAGGGGAGGCAGAGGAGGGAGGG - Intronic
1176426809 21:6553226-6553248 CAGGGCACAGGCAGGAGTGACGG + Intergenic
1176525259 21:7861534-7861556 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1176623672 21:9074387-9074409 CTGGGCACAGCGGGGAGGGAGGG + Intergenic
1176848735 21:13896699-13896721 CAAGACACACACAGGAGAGAGGG + Intergenic
1176948065 21:15008271-15008293 AAGGTCACACAAAGGAGAGAAGG + Intronic
1177086658 21:16713278-16713300 CATGGCACACCGCGGAGGAAGGG + Intergenic
1177955768 21:27596897-27596919 CATGGCACACAGTGAAGAGAAGG - Intergenic
1178516174 21:33249387-33249409 CAAGGAACACACAGGAGAGAGGG + Intronic
1178659279 21:34491547-34491569 CAGGAAATACAGAGGAGAGAAGG - Intergenic
1179547722 21:42123963-42123985 CTGTGCACACAGAGGTGCGAAGG - Intronic
1179702300 21:43161548-43161570 CAGGGCACAGGCAGGAGTGACGG + Intronic
1180194599 21:46185035-46185057 CAGGGCAGAGAGAGAAGCGAGGG + Intergenic
1180214109 21:46313943-46313965 CCAGGCACCCAGAGGTGGGATGG - Intronic
1180917323 22:19498403-19498425 CAGCGGACTCAGAGGAGGGATGG - Intronic
1181395485 22:22618387-22618409 CAAGGGACACAGAGAGGGGAGGG - Intergenic
1181618593 22:24071960-24071982 AATGGCTCACAGAGGAGGGGTGG - Intronic
1181633125 22:24161807-24161829 CACGGCCCACACAGGAGGAAGGG - Intronic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181863395 22:25836570-25836592 AAGGTCACCCAGAGGAGAGAAGG + Intronic
1182468377 22:30532108-30532130 CATGGCACAGAGATGGGGGAGGG + Intronic
1183103397 22:35597985-35598007 CAGGGCACCCACAGGATGGAAGG + Intergenic
1183172535 22:36198762-36198784 CAGGTCACACAGAGGGGACATGG + Intronic
1183346506 22:37311213-37311235 ACGGGTACACAGAGGAGGGCCGG + Intronic
1183348257 22:37319684-37319706 TCGGGCAGACAGGGGAGGGAGGG - Intergenic
1183742499 22:39676669-39676691 CTGGCCATAGAGAGGAGGGAAGG - Intronic
1184425572 22:44407260-44407282 GAGGTCACACAGTGCAGGGAGGG - Intergenic
1184431658 22:44444644-44444666 CAGGGCCCACAGACCAGGGAGGG + Intergenic
1184437607 22:44488927-44488949 CAGGGGAGAAAGGGGAGGGAGGG + Intergenic
1184478306 22:44733476-44733498 CAGGGCAACCAGAGCAAGGAAGG + Intronic
1184504081 22:44890715-44890737 CACGGCTGGCAGAGGAGGGAGGG + Intronic
1184846896 22:47093529-47093551 TAGGGCTCACAGATGAGGAATGG - Intronic
1184988633 22:48153053-48153075 CGTGGCACACAGAGGATGGGAGG + Intergenic
1185082477 22:48717705-48717727 CAGGGACCACAGAGCAGGCATGG + Intronic
1185133740 22:49056589-49056611 CAGGGCTCACAGAGGTTGCAGGG + Intergenic
949603316 3:5625707-5625729 CAGGGGCTACAGGGGAGGGAAGG - Intergenic
950075028 3:10181026-10181048 GGGGGCACACAGAGGAGTCAGGG - Intronic
950183039 3:10928362-10928384 CAGGGCGCAGAGGAGAGGGATGG + Intronic
950542583 3:13621123-13621145 CAGGGCTTCCAGAGGAGGGAGGG - Intronic
950715911 3:14847875-14847897 CAAGGCTCAGAGAGGAGGGGAGG - Intronic
951579125 3:24143582-24143604 CAGAGCCCACAGACGAGGAATGG - Exonic
952635047 3:35519028-35519050 CAGGGTATAGAGGGGAGGGAAGG - Intergenic
952663574 3:35878534-35878556 CTGGGCACAGAGACTAGGGAGGG + Intergenic
952904881 3:38133167-38133189 TAGGGCAGAAAGAGGAGGTAGGG + Intronic
953077251 3:39581980-39582002 CTGGGCACAGAGACTAGGGAGGG + Intergenic
953687749 3:45091439-45091461 CAGGACACAGAGGTGAGGGATGG + Exonic
953927395 3:46989401-46989423 AAGGGAACCCAGAGGAGGGTGGG + Intronic
954151144 3:48657711-48657733 CAGGACACAGAGAGGAGCTAGGG + Intronic
954625020 3:52017724-52017746 CAGAGCCCACAGCAGAGGGAAGG - Intergenic
955007883 3:54986765-54986787 CAGAGCACCCAGAGTAGAGATGG + Intronic
955570131 3:60295830-60295852 CTGGGCATACATAGGAAGGAGGG + Intronic
955673276 3:61424652-61424674 CAGGCCTCAGAGAGGATGGAGGG + Intergenic
955989861 3:64615027-64615049 TAGGGCTCAAAGAGGAGGGAAGG + Intronic
956904782 3:73754571-73754593 CAGCCCACACTCAGGAGGGAAGG - Intergenic
958632302 3:96699952-96699974 CAGGGCACTCAGAGGAGAGCTGG + Intergenic
959472837 3:106773730-106773752 CAGGGCAAGCAGAGGAGGTGGGG + Intergenic
959556074 3:107719950-107719972 CAGAGTACAAAGAGGAGGGGAGG + Intronic
959702831 3:109314676-109314698 GAGGGCAAAAAGAGGAGGAAAGG - Intronic
959972435 3:112422153-112422175 CAGGGCACAGAAATAAGGGATGG + Intergenic
960115245 3:113886149-113886171 CAGGGCAGAGAGGGGTGGGAGGG - Intronic
960942471 3:122943668-122943690 AGGGGCACACAGAGGTGGGCAGG - Intronic
961253697 3:125527602-125527624 CAGGGCCCAGAGAGTAAGGAAGG - Intergenic
961403596 3:126663909-126663931 CAGGGCACCGAGAGGACTGAAGG - Intergenic
961421837 3:126812269-126812291 CAGGCCACAGAGAGAAGGGGAGG - Intronic
961590407 3:127975356-127975378 CAGGGATCACAGAGGAGATATGG + Intronic
962359489 3:134725870-134725892 CAGGGGGCTCAGAGGAGCGAGGG + Intronic
962661919 3:137610500-137610522 CAGGGCACAGTGATGAGGAATGG - Intergenic
963425097 3:145114475-145114497 CTGGGCACAGAGACTAGGGAGGG - Intergenic
963456784 3:145555355-145555377 CCGGGCACAGAGACTAGGGAGGG + Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964611143 3:158616740-158616762 AAGGGCACACAAAAGAGTGAAGG - Intergenic
965105345 3:164346335-164346357 CTGGGCACAGAGACTAGGGAGGG + Intergenic
965798936 3:172471247-172471269 CAGGGATCACAGATGAAGGACGG + Intergenic
966568641 3:181413423-181413445 AAGGGCAAGCAGAGGAAGGAAGG + Intergenic
966863275 3:184242243-184242265 CAGGGAGCTCAGAGGATGGAGGG - Exonic
966892529 3:184417677-184417699 GAGGCCACACAGAGGACTGAGGG - Intronic
966999732 3:185322489-185322511 CATGGAAAACAGAGTAGGGATGG - Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967658229 3:192075264-192075286 CTGGGCACAGAGACTAGGGAGGG + Intergenic
968489832 4:883981-884003 CTGGGCACACAGGGAAGGGCCGG + Intronic
968799460 4:2732718-2732740 CCTGGCACACAGAGGATGGTGGG - Intergenic
968912972 4:3485202-3485224 CAGGGCATGGGGAGGAGGGAGGG - Intronic
968954905 4:3713257-3713279 AGGGGCACACAGAGGACTGAGGG - Intergenic
969067810 4:4502676-4502698 CAGTCCACACAACGGAGGGATGG + Intronic
969110608 4:4841793-4841815 CCAGGCACAGAAAGGAGGGAGGG + Intergenic
969155385 4:5205458-5205480 CAGGGCACACAGAGACAGGGAGG + Intronic
969246896 4:5940618-5940640 ATGTGCACACAGAGGTGGGAGGG - Intronic
969264848 4:6057674-6057696 GGGTGCACACAGAGGTGGGAGGG - Intronic
969344170 4:6560931-6560953 CAAGGCACAAAGAGGAGGAAGGG - Intronic
969423166 4:7108906-7108928 CAGGGGGCAGAGAGGAGGGGTGG - Intergenic
969458235 4:7313328-7313350 CTGGGGACACACAGCAGGGAAGG + Intronic
969471668 4:7392726-7392748 CAGGCATCACAGAGGGGGGAGGG + Intronic
969498624 4:7540120-7540142 CAGGGCCCTCATAGCAGGGAGGG - Intronic
969590761 4:8120636-8120658 CAGAGCACACAGATGGGGGCTGG - Intronic
969608027 4:8211951-8211973 CAGGGGACAGACAGGAGGGAGGG + Intronic
969820473 4:9716369-9716391 GAGGGAACAAAGATGAGGGAGGG - Intergenic
970041975 4:11807790-11807812 CTGGGCACAGAGACTAGGGAGGG - Intergenic
970270161 4:14338031-14338053 CATGGCACAGGGAGGAGGGGTGG + Intergenic
970347520 4:15167877-15167899 CAGGGCAGAGAGAGAAGAGAGGG - Intergenic
970897878 4:21124508-21124530 GAGGGCAGACAGAGCAAGGAAGG - Intronic
970979549 4:22080486-22080508 CAGGGCACCCAGCTCAGGGAAGG + Intergenic
971230653 4:24798446-24798468 TGGTGCACACAGAGGAGGCATGG - Intronic
971262621 4:25070742-25070764 GTGGGGACACAGAGTAGGGAAGG - Intergenic
971500584 4:27314023-27314045 CAGAGCAATCAGAGAAGGGATGG + Intergenic
972274596 4:37545315-37545337 GAGGACACACAGTGGAGGGCAGG - Intronic
972698173 4:41468287-41468309 CAGGGCAGGCAGGGCAGGGAAGG - Intronic
973805066 4:54517876-54517898 CAGGACCCACTGAGGAGGCAGGG + Intergenic
974103258 4:57440475-57440497 CTGGGGACACACAGGAGGGGAGG - Intergenic
974305509 4:60133502-60133524 CAGGGCACACAGTCATGGGATGG - Intergenic
975489593 4:74974136-74974158 GAGCACACACAGAGGAAGGAGGG - Intronic
975609070 4:76186145-76186167 GTGGGCATACAGAGGAGGGAGGG + Intronic
977178274 4:93840921-93840943 CAGGGAACACAGCAGAGGCAGGG + Intergenic
977733146 4:100379551-100379573 GAGGGCAGCCAGAGGAGTGAGGG + Intergenic
978999867 4:115203143-115203165 GAGGGCAAAGAGAAGAGGGAAGG - Intergenic
979987585 4:127333983-127334005 CAGTGCAAACAGAGGAAGGGAGG - Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
980991296 4:139740784-139740806 CAGGGCATGCTGTGGAGGGAAGG + Intronic
981663557 4:147195643-147195665 TAGGTGACACAGAAGAGGGAGGG + Intergenic
981943372 4:150311540-150311562 CTGGGGACACAGAGGACTGATGG + Intronic
982497226 4:156107650-156107672 CTGGGCACAGAGACTAGGGAGGG + Intergenic
983585627 4:169351337-169351359 AAAGGCTCACAGAAGAGGGAGGG - Intergenic
984149701 4:176111475-176111497 CAGGGCACACAGGTAAGGGTTGG + Intronic
984791162 4:183616372-183616394 CAGAGGTCAGAGAGGAGGGAAGG - Intergenic
985282406 4:188300453-188300475 CAGGGAAGAAGGAGGAGGGATGG - Intergenic
985875490 5:2591128-2591150 CAGGGAGCACAGGCGAGGGAGGG + Intergenic
986193422 5:5517098-5517120 CTGGGCACAGAGATGAGGAAGGG - Intergenic
986782993 5:11084368-11084390 CAGGGCACAAGGAGTAGGGGAGG - Intronic
987015608 5:13815678-13815700 AAGGGCAAAAAGAGGAGGAAGGG + Intronic
987281921 5:16421534-16421556 CTGGGCACAGAGACTAGGGAGGG - Intergenic
987487390 5:18539849-18539871 CTGGGCACAGAGACTAGGGAGGG - Intergenic
992325468 5:75655398-75655420 CAGGGCACACTGAGGAGTCGGGG + Intronic
993524965 5:88954073-88954095 CAGACAGCACAGAGGAGGGAGGG - Intergenic
993631744 5:90294084-90294106 CAAGGCAAACAGAGTAGGGTGGG + Intergenic
995899487 5:117050550-117050572 CTGGGCACAGAGACTAGGGAGGG + Intergenic
996154386 5:120080006-120080028 AAAGGCACAATGAGGAGGGAGGG + Intergenic
996509788 5:124305301-124305323 CTGGGCACAGAGACTAGGGAGGG - Intergenic
996942965 5:129031900-129031922 CAGGGGAGATGGAGGAGGGAAGG + Intronic
998418263 5:141960820-141960842 AAGGGAACAGAGAAGAGGGAGGG + Intronic
999154802 5:149450559-149450581 CTGGGCACAGAGAGGAGAGAAGG + Intergenic
999992713 5:157063969-157063991 CAGGGATCACAGAGGAGTGAGGG + Intergenic
1000343285 5:160294204-160294226 CGGGGCAGAGAGAGGAAGGAGGG - Intronic
1000922058 5:167149931-167149953 CATGGCACAAAGTGAAGGGAAGG + Intergenic
1001153606 5:169253951-169253973 CAGGGGCTACGGAGGAGGGATGG + Intronic
1001221240 5:169902774-169902796 CAGAGCCCACAGAGTAGTGAGGG + Intronic
1001267405 5:170283866-170283888 CAGGGCAGACAAGGGAGGAAGGG - Intronic
1001331569 5:170766201-170766223 CTGGGCACAGAGACTAGGGAGGG + Intronic
1001408695 5:171495263-171495285 CATGCCCCACAGAGGAAGGAAGG + Intergenic
1001412880 5:171523355-171523377 CTGGGCACACAAAGGAAGTAGGG - Intergenic
1001575203 5:172758699-172758721 CAGGACCCACCCAGGAGGGAAGG + Intergenic
1002057643 5:176607805-176607827 AAGGGCACACAACTGAGGGAAGG + Intronic
1002184645 5:177448329-177448351 CAGGTCTCACAGAGCAGGAAGGG - Intronic
1002345714 5:178546465-178546487 CTGGGAGCAGAGAGGAGGGAGGG - Intronic
1002419079 5:179136158-179136180 CAGGGCAGACAGAGAGGGAAAGG + Intronic
1004768698 6:18758249-18758271 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1005290946 6:24378273-24378295 CATGGCACACAGAAGCGGGAGGG - Intergenic
1005422968 6:25672133-25672155 CTGGGCTCACCGTGGAGGGAAGG - Intronic
1006385531 6:33728749-33728771 CAGAGGGCACGGAGGAGGGATGG - Intronic
1006385564 6:33728887-33728909 AAGGGCAGACAGACGGGGGAGGG - Intronic
1006591294 6:35159935-35159957 TAGGCCTCACAGAGGAAGGAAGG - Intergenic
1007116936 6:39349489-39349511 CAGAGCTGACAGTGGAGGGAGGG + Intronic
1007312165 6:40955159-40955181 CTGGGCACACATGGGAGGGTAGG + Intergenic
1007570254 6:42884903-42884925 CATGGGACACAGGGTAGGGAGGG + Intronic
1007615310 6:43176337-43176359 CAGGGCAGGAGGAGGAGGGATGG + Intronic
1007745868 6:44042661-44042683 GAGAGCAACCAGAGGAGGGAGGG + Intergenic
1007833862 6:44659296-44659318 CTGGGCACACAGTGGCGGCAAGG + Intergenic
1008167025 6:48151185-48151207 CAGAGCACAGAGAGGAAGCATGG + Intergenic
1009343491 6:62587469-62587491 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1011118251 6:83920479-83920501 AATGGAACACAGAGGATGGATGG + Intronic
1013073756 6:106752375-106752397 CAGGAGACACAGCAGAGGGATGG - Intergenic
1013561438 6:111309363-111309385 CAGGGCAGTCAGAGAAGAGACGG - Intronic
1013686824 6:112594801-112594823 CAGGCCACACAAAGTAGGAAGGG - Intergenic
1014717960 6:124887750-124887772 CAGGGCAGTCAGAGGAGAGCTGG + Intergenic
1014777119 6:125523995-125524017 AAGGGCAGAGAGATGAGGGAGGG - Intergenic
1015245129 6:131066185-131066207 TAGGCCACATAGAGGATGGAGGG - Intergenic
1015918335 6:138241290-138241312 CTGGGTAGACAGAGGAGTGATGG - Intronic
1016062475 6:139645059-139645081 CAGGGAACACAAGGAAGGGAGGG + Intergenic
1017103142 6:150865886-150865908 CAGGGCACACGGAGGCGGCGCGG - Exonic
1017224971 6:152010465-152010487 GAGGGCAAAGAGAGAAGGGAAGG + Intronic
1017630719 6:156393905-156393927 CAGGCCACATGGAGGAGTGAAGG + Intergenic
1018495522 6:164342924-164342946 CTGGGCACACAGACTAGGGAGGG + Intergenic
1018664329 6:166120795-166120817 CAGGGCATAGATAGGAGGGGAGG + Intergenic
1019329453 7:455463-455485 CCTGGCACAGGGAGGAGGGAAGG - Intergenic
1019330334 7:457771-457793 TGGGGCCCACAGAGGAGGGGTGG + Intergenic
1019406570 7:887162-887184 CAGAGCACAGCGAGGAAGGAAGG - Intronic
1019530918 7:1502983-1503005 CAGGGCACTCAGAGGGGGTGTGG + Exonic
1019560455 7:1653533-1653555 CAGGGCACACAGACAGGGGCAGG - Intergenic
1019614830 7:1954486-1954508 CAGGGCACACTCAGGAGGTGGGG + Intronic
1019621254 7:1993275-1993297 CAGGACCCACAGTGCAGGGAGGG + Intronic
1019917941 7:4145243-4145265 CAGGGAAGACAAAGGAGGGAAGG + Intronic
1020090273 7:5334896-5334918 CTTGGCACACACAGCAGGGAAGG + Intronic
1021116003 7:16747387-16747409 AAGGGGAGAGAGAGGAGGGAAGG - Intergenic
1021657021 7:22882711-22882733 CAGGGTTCACAAAGGAGGAAGGG - Intergenic
1023042056 7:36180756-36180778 CAGCGGGCACAGAGCAGGGAAGG - Intronic
1023100398 7:36711940-36711962 CAACCCTCACAGAGGAGGGAAGG + Intronic
1023113167 7:36834601-36834623 TAAGGCACACAAAGGAGAGAAGG - Intergenic
1023588142 7:41752176-41752198 CAGGGCACACAGCTGGGGGTGGG - Intergenic
1023905286 7:44517367-44517389 CATGGCACACAGAAGATGGAAGG + Intronic
1023927110 7:44677504-44677526 TTGGGGACACAGAGCAGGGAGGG + Intronic
1024084624 7:45883118-45883140 CAGAGCACCAAGAGCAGGGAGGG - Intergenic
1026158465 7:67848342-67848364 TAGGGCACAGAGAGGATGAAAGG + Intergenic
1026454012 7:70555136-70555158 CAGTGGAGACAGAGAAGGGATGG + Intronic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1027232351 7:76280367-76280389 CACGGCACACAGATGGGGGAGGG - Intronic
1027681893 7:81232596-81232618 CAGGGCAAGCAGGGGTGGGAGGG + Intergenic
1028690059 7:93641390-93641412 CTGGGCACAGAGACTAGGGAGGG - Intronic
1029126240 7:98296943-98296965 AAGGGAACAGAGAGGAGGGCAGG - Intronic
1029131554 7:98335235-98335257 AAGGGAACAGAGAGAAGGGATGG - Intronic
1029258473 7:99285360-99285382 CCTAGCAGACAGAGGAGGGAGGG - Intergenic
1029435502 7:100562029-100562051 CAGGGGACACGGAGAAGGGCTGG + Intronic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1031068940 7:117140906-117140928 CACCACAAACAGAGGAGGGAAGG + Intronic
1031364864 7:120889828-120889850 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1031422578 7:121568199-121568221 CTGGGCACAGAGACTAGGGAGGG + Intergenic
1031776156 7:125911101-125911123 CAGGGCACAGAAATAAGGGATGG - Intergenic
1032911774 7:136440513-136440535 CAGGAGACAGAGAAGAGGGAGGG - Intergenic
1033767948 7:144515199-144515221 CTGGGCACACAGAGAAAGAAAGG + Intronic
1034855212 7:154539184-154539206 CAGGGCCCACAGTGGGGAGAAGG - Intronic
1034953460 7:155317115-155317137 CATGGCCCACAGGGGAGGGCCGG - Intergenic
1035247432 7:157572915-157572937 CGGGGCACACAGTGGTGCGAAGG + Intronic
1035585060 8:766387-766409 CAGCTCACATAGAGGAAGGATGG - Intergenic
1035618519 8:1020761-1020783 CAGGGCACAGAGGGGAGAGCTGG + Intergenic
1035768771 8:2129955-2129977 AAGGACAGACAGAGCAGGGACGG + Intronic
1035924563 8:3713441-3713463 CAGGGGCTACAGAGGAGGGCAGG - Intronic
1036210995 8:6841399-6841421 CACAGCAGACAGAAGAGGGATGG - Intergenic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1037602122 8:20406095-20406117 CCAGGCAGATAGAGGAGGGAAGG - Intergenic
1037906566 8:22719065-22719087 CAGGGGTCAGAGAGGAGAGACGG - Intronic
1038350232 8:26769969-26769991 TAGGGCACAGGGAAGAGGGAGGG - Intronic
1038415078 8:27389243-27389265 GAAGGCAGAGAGAGGAGGGAAGG + Intronic
1038992066 8:32878779-32878801 GAGGGCACCCAGAGGGGAGATGG - Intergenic
1039438844 8:37580623-37580645 CATATCACACAGAGGTGGGAGGG - Intergenic
1039470408 8:37809870-37809892 CAGGGCAGCCTGGGGAGGGATGG + Intronic
1039977737 8:42381604-42381626 CAGGGCAGACAGGGGAGAGGAGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1042943013 8:74126470-74126492 CAGGGAACACACAGGAGGGTGGG - Intergenic
1045436088 8:102166207-102166229 TTGGGCACACAGTGGAGGTAAGG - Intergenic
1045949995 8:107840726-107840748 GTGGGCACATAGTGGAGGGAGGG - Intergenic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047501539 8:125445631-125445653 CAGGGGAGACAAAGGAGAGAGGG - Intergenic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048370152 8:133770131-133770153 CAGGGTACAGAGAGAATGGATGG - Intergenic
1048971398 8:139646991-139647013 CAGTGCACACAAAGGTGGGCTGG + Intronic
1048979665 8:139696619-139696641 CTGAGTACACAGAGGAGGGAGGG + Intronic
1049273170 8:141706894-141706916 CCAGGCTCACTGAGGAGGGAGGG + Intergenic
1049294141 8:141821257-141821279 CAGTGCACAAGGAGGAGGGGGGG + Intergenic
1049632518 8:143666333-143666355 GTGTGCACACGGAGGAGGGAGGG - Intergenic
1049632541 8:143666431-143666453 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632560 8:143666529-143666551 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632571 8:143666578-143666600 GTGTGCACACGGAGGAGGGAGGG - Intergenic
1049632582 8:143666627-143666649 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1049632614 8:143666773-143666795 GTGTGCACACAGAGGAGGGAGGG - Intergenic
1051487073 9:17620562-17620584 AAGGGCAGACAGAAGAGGGTTGG + Intronic
1051617120 9:19016941-19016963 CAGGCCTCACAGAGGAAGGTGGG - Intronic
1052807602 9:33026034-33026056 CTGGGCACACAGTGGTGGGGGGG - Intronic
1052829332 9:33202356-33202378 CAGGGCAGACAGAGCAAGGGTGG + Intergenic
1052859859 9:33430967-33430989 CAATGCACACAGTGCAGGGAGGG - Intergenic
1053313249 9:37032663-37032685 GAGGGCACAGAGATGGGGGAAGG + Intronic
1053431538 9:38044912-38044934 ATGTGTACACAGAGGAGGGAGGG + Intronic
1055030931 9:71770569-71770591 TAGCACACACAGAGGAGGGCTGG + Intronic
1055729830 9:79268982-79269004 CAGGGAACACAGAGCATGGCAGG - Intergenic
1055857634 9:80710060-80710082 CAGGGGACACAGAGGAGAGGAGG - Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056949664 9:91032027-91032049 CAGGGCAAATAGAGAAGGAAAGG - Intergenic
1057111805 9:92479137-92479159 GAAGGCACACAGGGCAGGGAAGG + Intronic
1057147907 9:92770769-92770791 CAGGGAACAGTGAGGAAGGAGGG - Intergenic
1057208704 9:93187923-93187945 CAGGTCTCACTGAGCAGGGAAGG + Intronic
1057349700 9:94285447-94285469 AAGGGGAAACAAAGGAGGGAAGG + Intronic
1057459727 9:95250200-95250222 CAGGAATCGCAGAGGAGGGAAGG + Intronic
1057565238 9:96160987-96161009 CAGCGCACAGAGACCAGGGAAGG - Intergenic
1057634262 9:96748350-96748372 CAGGCAAGACAGAGGAGGTATGG + Intergenic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058434887 9:104953328-104953350 CAGGATACACAAAGAAGGGATGG + Intergenic
1058845382 9:108952720-108952742 CAGAGGCCACAGAGCAGGGAAGG - Intronic
1059250898 9:112887167-112887189 CAGGGCACAGAGAGTGGAGACGG - Intronic
1059339771 9:113591189-113591211 CGCGGCACACAGGTGAGGGAGGG - Intronic
1059657393 9:116368933-116368955 CGGGGCGCACAGAGGAGTGGAGG - Intronic
1059663066 9:116420477-116420499 CAGGGCCCACAGAGGGTGAACGG + Intergenic
1059740593 9:117145935-117145957 GAAGGCACACAGAGAAGGAAGGG + Intronic
1059815435 9:117907727-117907749 CAGGGAACACTGAGGAGGAGAGG + Intergenic
1060110778 9:120904912-120904934 CAGGGCACAAAGATGGGTGAAGG - Exonic
1060197993 9:121635607-121635629 CAGGGCAACCACAGGAAGGAGGG + Intronic
1060495297 9:124113744-124113766 CAGGGCAGGCAGAGAGGGGAGGG + Intergenic
1060591221 9:124818126-124818148 CAGAGCTCACAGAGGGGAGATGG - Intergenic
1060664892 9:125427044-125427066 CAGGGCACACAGCTAAGGCACGG - Intergenic
1060816809 9:126639342-126639364 CAGGCCAGACAGATGATGGAGGG - Intronic
1060932206 9:127496258-127496280 CAGGGCACACACAGGCGGCTGGG - Intronic
1060948889 9:127588081-127588103 CAGTGAACAAAGGGGAGGGAGGG - Intergenic
1061080491 9:128366805-128366827 CAGGGGACACTGAGGTGGGTTGG + Intergenic
1061390603 9:130315311-130315333 GAGGGCAGAGGGAGGAGGGAGGG - Intronic
1061584937 9:131559454-131559476 CATTGCAGACAGAGGAGGAAGGG + Intergenic
1061920510 9:133779955-133779977 CAGAACACAGAGATGAGGGAAGG + Intronic
1062107872 9:134765613-134765635 TAGGGGACAGAGAGGAGGGCTGG + Intronic
1062168787 9:135122679-135122701 AAGGGCACACAGGGCAGGCAGGG - Intergenic
1062376625 9:136264644-136264666 CAGGGCATCCAGGGCAGGGATGG + Intergenic
1062497201 9:136837520-136837542 CAGGGGGCACAGAGGATGGTGGG - Exonic
1062511352 9:136907905-136907927 CAGGGCTCCCACAGGTGGGAGGG - Intronic
1203740875 Un_GL000216v2:175862-175884 AAGGGCACAGAGAGGCGAGAGGG - Intergenic
1203746856 Un_GL000218v1:44815-44837 CTGGGCACAGCGGGGAGGGAGGG + Intergenic
1203563252 Un_KI270744v1:74665-74687 CTGGGCACAGTGGGGAGGGAGGG - Intergenic
1203654155 Un_KI270752v1:7479-7501 CAGGGAAAACAAGGGAGGGAAGG + Intergenic
1185861161 X:3580957-3580979 CAGCAGAGACAGAGGAGGGAAGG + Intergenic
1187119534 X:16390989-16391011 CAGGGCATACGGTTGAGGGAGGG + Intergenic
1187447643 X:19373051-19373073 CAGGAGACAGGGAGGAGGGAGGG + Intronic
1188473748 X:30568428-30568450 CATTGCAGACAGAGGAGAGAAGG + Intronic
1189480620 X:41389702-41389724 CAGGACAGAGAGAGGAGGGCGGG + Intergenic
1189870738 X:45380789-45380811 CAGGGGACGCAAAGGAGGGAGGG - Intergenic
1190515891 X:51223270-51223292 GAGGGAAGAAAGAGGAGGGAAGG - Intergenic
1190874680 X:54451234-54451256 CAGGGCAGACAGAAGAGTCAGGG - Intronic
1191671298 X:63751145-63751167 AAGGGGCCAGAGAGGAGGGAAGG + Intronic
1191791284 X:64975213-64975235 CCTGGCACACAGGGGCGGGAAGG + Intronic
1192545100 X:72006548-72006570 GAGGGTGCACAGAGGTGGGAAGG - Intergenic
1193885816 X:86983332-86983354 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1194739549 X:97556604-97556626 GAGGGCACACAGAGGTAAGAAGG - Intronic
1195424204 X:104709525-104709547 CAATACACACAGAAGAGGGATGG - Intronic
1195666951 X:107440439-107440461 CTGAGCAAACAGAAGAGGGAGGG + Intergenic
1195713004 X:107790063-107790085 TTGGGCAGACAGAGGAGGAAGGG - Intronic
1195923464 X:110003628-110003650 CAGGGCACCGAGAGTAGGGGAGG - Exonic
1196247258 X:113414874-113414896 CAGGGCATATAGGGGAGGGGTGG - Intergenic
1196465623 X:115969091-115969113 CAGGAGACACAGAAGATGGAGGG - Intergenic
1198383424 X:136105262-136105284 GAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1198383429 X:136105280-136105302 GAGGGAAGAAAGAGGAGGGAGGG + Intergenic
1198598335 X:138260312-138260334 CTGGGCACAGAGACTAGGGAGGG - Intergenic
1198831223 X:140752763-140752785 AAGGACACACAGATGAGGGAAGG - Intergenic
1199094151 X:143720528-143720550 AAAGACACACAGAGAAGGGACGG - Intronic
1199214193 X:145247702-145247724 AAAGACACACAGAGAAGGGACGG + Intronic
1200102927 X:153697017-153697039 CAGGGCTCAAAGAGGAGTTAAGG + Intergenic
1201160180 Y:11159829-11159851 CTGGGCACAGTGGGGAGGGAGGG + Intergenic
1201342747 Y:12951952-12951974 CAATGGACAGAGAGGAGGGATGG - Intergenic
1201771839 Y:17623213-17623235 CATGGCACAAACAGGAGAGAGGG + Intergenic
1201829716 Y:18282773-18282795 CATGGCACAAACAGGAGAGAGGG - Intergenic