ID: 1129878584

View in Genome Browser
Species Human (GRCh38)
Location 15:78992849-78992871
Sequence TCCTCCACAGACGGGCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 243}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129878572_1129878584 30 Left 1129878572 15:78992796-78992818 CCAAGGGAAGTGGGGCCATCCCT 0: 1
1: 0
2: 0
3: 26
4: 170
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878576_1129878584 7 Left 1129878576 15:78992819-78992841 CCTAGACTAAGTGTCTCCCTTCC 0: 1
1: 0
2: 0
3: 16
4: 167
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878578_1129878584 -10 Left 1129878578 15:78992836-78992858 CCTTCCTCCCATTTCCTCCACAG 0: 1
1: 0
2: 5
3: 82
4: 632
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878577_1129878584 -9 Left 1129878577 15:78992835-78992857 CCCTTCCTCCCATTTCCTCCACA 0: 1
1: 0
2: 6
3: 87
4: 839
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878575_1129878584 10 Left 1129878575 15:78992816-78992838 CCTCCTAGACTAAGTGTCTCCCT 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878573_1129878584 15 Left 1129878573 15:78992811-78992833 CCATCCCTCCTAGACTAAGTGTC 0: 1
1: 0
2: 1
3: 8
4: 116
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243
1129878574_1129878584 11 Left 1129878574 15:78992815-78992837 CCCTCCTAGACTAAGTGTCTCCC 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1129878584 15:78992849-78992871 TCCTCCACAGACGGGCACTGAGG 0: 1
1: 1
2: 2
3: 15
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129878584 Original CRISPR TCCTCCACAGACGGGCACTG AGG Intronic