ID: 1129882012

View in Genome Browser
Species Human (GRCh38)
Location 15:79013214-79013236
Sequence TTACATACAAAGCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 209}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129882000_1129882012 14 Left 1129882000 15:79013177-79013199 CCATATTCACACACAAAGCTAGG 0: 1
1: 0
2: 0
3: 10
4: 137
Right 1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG 0: 1
1: 0
2: 2
3: 21
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129882012 Original CRISPR TTACATACAAAGCTGGGGCT GGG Intronic
901019572 1:6249065-6249087 TGACATCCCAAGCTTGGGCTTGG - Exonic
901742157 1:11349233-11349255 TTACAAATAAAGCTGCTGCTGGG + Intergenic
907008302 1:50938358-50938380 TGACATACATAGCTGGTCCTAGG - Intronic
909257671 1:73445477-73445499 TTTCATACAAAAATGAGGCTTGG - Intergenic
912241538 1:107915321-107915343 TTGCATTAAAAGCTGGGGCAAGG - Intronic
912790471 1:112644486-112644508 TTGAATACAAAGCTGGGGCCAGG - Intronic
913299916 1:117359835-117359857 TTTCATCCAAAGTTGGGGGTTGG - Intergenic
919971613 1:202583933-202583955 TTACTTCCAAAGGTGTGGCTCGG - Exonic
921744915 1:218729164-218729186 TTACACACAGAGCTGGGCCTGGG - Intergenic
923577482 1:235173048-235173070 TTAAAAATAAAACTGGGGCTGGG + Intronic
923623020 1:235593295-235593317 GTAAATACAAAGTTGGGGCTGGG + Intronic
924610694 1:245571283-245571305 TTAAAAACATAGGTGGGGCTTGG - Intronic
1063774163 10:9241636-9241658 ATACATACAAAAATGGGGCAAGG - Intergenic
1066001039 10:31104211-31104233 TTACATCCACAGCTGGGGGAGGG + Intergenic
1068770347 10:60813866-60813888 TTAAAAATAAAGTTGGGGCTGGG - Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1070550246 10:77485542-77485564 TTACTTACAGAGCTTGTGCTGGG - Intronic
1071295678 10:84217592-84217614 GTAGATACAAAGCCGGTGCTAGG - Intronic
1071579135 10:86754677-86754699 TTAGAACTAAAGCTGGGGCTGGG + Intergenic
1073097937 10:100991484-100991506 TTACATACGAGGCCTGGGCTGGG + Intronic
1073113230 10:101075163-101075185 ATAAATAAATAGCTGGGGCTTGG - Intergenic
1073138158 10:101230858-101230880 TTACAAACAAAGCCAGGGCCAGG - Intergenic
1077800671 11:5532967-5532989 TGATGTAGAAAGCTGGGGCTTGG - Intronic
1078847129 11:15128524-15128546 TTACTGGCAGAGCTGGGGCTAGG + Intronic
1079384171 11:19964269-19964291 TCACATACAAATCTGGTGCATGG - Intronic
1080311960 11:30905003-30905025 TTGCATACAAAAATGGGGATGGG - Intronic
1080653272 11:34239484-34239506 ATACAAAAATAGCTGGGGCTTGG - Intronic
1080754937 11:35188220-35188242 TTACATAACAATGTGGGGCTGGG - Intronic
1084482183 11:69428410-69428432 ATACATACAAAGCTGGGGATTGG - Intergenic
1085913171 11:80852441-80852463 TTACATACAAAGATATGGTTTGG - Intergenic
1088379101 11:109173619-109173641 TTAAATACAAGGGTGGGGCCAGG - Intergenic
1089896990 11:121940693-121940715 TTAGAAACAATGATGGGGCTGGG + Intergenic
1091552481 12:1547040-1547062 TTACACACTAAGCTGTGGCATGG - Intronic
1091570145 12:1677761-1677783 TTAAATACAAAGCCAGGGCCGGG - Intergenic
1096721858 12:53528942-53528964 TTAAAAAGGAAGCTGGGGCTGGG + Intronic
1097037110 12:56131233-56131255 TCACCTACATAGCTGGGGATTGG - Exonic
1097677676 12:62620517-62620539 TTACAGACAGTGATGGGGCTAGG - Intergenic
1097913482 12:64995391-64995413 TCACCAACAAAGCTGGAGCTCGG - Intergenic
1098225755 12:68321377-68321399 ATTTATATAAAGCTGGGGCTTGG - Exonic
1101311594 12:103585676-103585698 GTAGATAAAAATCTGGGGCTTGG - Intergenic
1101432122 12:104635223-104635245 CTACATACAAAGCTTGGACATGG - Intronic
1101770594 12:107746778-107746800 TTAAATTAAAACCTGGGGCTGGG - Intronic
1104437441 12:128767094-128767116 TTAGAAAGAAAGCTGGGGGTGGG + Intergenic
1106221470 13:27749337-27749359 TTACCCTCAAAGCTGGGCCTTGG + Intergenic
1106813572 13:33383446-33383468 TGAAATACAAAGCTGTGGCTGGG + Intergenic
1109877997 13:68430565-68430587 TTACAGAAAAAGTAGGGGCTTGG + Intergenic
1111972742 13:94934067-94934089 TTCCATAAAGGGCTGGGGCTGGG - Intergenic
1112248906 13:97760388-97760410 TTAAAAATAAAACTGGGGCTGGG - Intergenic
1115099946 14:29686540-29686562 TCAGAAACAAAACTGGGGCTGGG + Intronic
1116318515 14:43429252-43429274 TTACAAACAAAATTGAGGCTTGG + Intergenic
1116988242 14:51244279-51244301 TTACATACTAGTCTGGGGCCTGG - Intronic
1118862845 14:69678505-69678527 TTAAAAACAATGCTGCGGCTGGG + Intronic
1119145675 14:72311781-72311803 TTACATACAAAATTGTGGTTTGG + Intronic
1119286493 14:73458731-73458753 TTACAACTAAAGCTTGGGCTAGG - Intronic
1119443666 14:74646662-74646684 TTACATAAAAAACTGGAGTTTGG + Intergenic
1120199793 14:81524574-81524596 TTAAAAACAAAGGAGGGGCTGGG + Intronic
1122543059 14:102508533-102508555 TTACAGATAAAGCTGAGGCTCGG - Exonic
1124422481 15:29534948-29534970 TTAAAAATAAAGCTGGGGCCAGG + Intronic
1124824377 15:33079324-33079346 TTATAAAGAAAGCTGAGGCTGGG + Intronic
1125323720 15:38515203-38515225 TTACAGTCAAAGCTGGGGCTAGG - Intronic
1125688772 15:41579643-41579665 TAAGAGACAAAGCTGGGGCCAGG - Exonic
1126744948 15:51817049-51817071 TTACAGATGAAGCTGGGGCTTGG - Intergenic
1126750309 15:51870232-51870254 TTAAAAACACAGCTGTGGCTGGG - Intronic
1128089252 15:64907883-64907905 TAAAATACAAAGAAGGGGCTGGG - Intronic
1128870750 15:71153569-71153591 TTACATACAAAACAGGAGCTGGG + Intronic
1129179895 15:73867463-73867485 AGACAGACGAAGCTGGGGCTGGG - Intergenic
1129882004 15:79013183-79013205 TCACACACAAAGCTAGGGCTGGG + Intronic
1129882012 15:79013214-79013236 TTACATACAAAGCTGGGGCTGGG + Intronic
1129882019 15:79013245-79013267 TCACACACAAAGCTAGGGCTGGG + Intronic
1131522730 15:93128401-93128423 TTAAATACAACTCTCGGGCTGGG + Intergenic
1135064382 16:19296927-19296949 TCAGATACAGAGCTGGGGGTAGG + Intronic
1136051141 16:27651032-27651054 GCACATACATATCTGGGGCTGGG - Intronic
1144097678 17:11916589-11916611 TTACTTAATAAACTGGGGCTTGG - Intronic
1146971536 17:37076636-37076658 TTAAAAACAACACTGGGGCTGGG - Intergenic
1147158267 17:38556306-38556328 ATACCTACAAAGCTGGACCTGGG + Intronic
1148887349 17:50783416-50783438 TTACACCCAAAGGTGGTGCTGGG - Intergenic
1149780213 17:59391600-59391622 TTACAAACAAAAATGGGGCCAGG + Intronic
1151151394 17:72090759-72090781 TTCCTTGCAGAGCTGGGGCTGGG - Intergenic
1151858472 17:76739761-76739783 TTACATACAAGGCTTAGGATAGG - Intronic
1152160285 17:78664522-78664544 CTCCATCCTAAGCTGGGGCTGGG - Intergenic
1152643752 17:81459610-81459632 TTGCACCCAAAGCGGGGGCTGGG + Intronic
1153555781 18:6311670-6311692 TTACATAAGAAGTTGGGGATGGG + Intronic
1157009698 18:43631994-43632016 TTACATACAAAGCCAGTGTTAGG - Intergenic
1159027255 18:63195147-63195169 TTGCTCACAAAGCTGGGGATTGG + Intronic
1160132986 18:76246195-76246217 ATAGATACAAATCTGGGACTTGG - Intergenic
1160974750 19:1787294-1787316 TTACACTCAAGGTTGGGGCTGGG + Intronic
1162299982 19:9838956-9838978 TTACAGAGAAAGCTGAGTCTAGG - Intronic
1162821469 19:13225985-13226007 TAATATACAAATCGGGGGCTGGG - Intronic
1163221067 19:15921541-15921563 CTAGATACAAAACTGGGGATAGG + Intronic
1164064354 19:21702800-21702822 AAACATAAAAAGCTGAGGCTGGG + Intergenic
1164421235 19:28094967-28094989 TTACATACAAAGAGGGAGGTGGG + Intergenic
1167428181 19:49440398-49440420 TTAGAGCCAAAGCTGGGGTTGGG + Intronic
1168685216 19:58345366-58345388 TAAAAAACTAAGCTGGGGCTGGG + Intronic
925202827 2:1982665-1982687 GGAGAGACAAAGCTGGGGCTGGG + Intronic
925795947 2:7543077-7543099 TTACATTAACAGCTGGGGCCAGG - Intergenic
929190191 2:39132759-39132781 TTCAAAACAAAGCTGGGGCCGGG + Intergenic
931145396 2:59511642-59511664 TTACCTACAAAGGTATGGCTGGG + Intergenic
931253599 2:60552821-60552843 TCACATGCAAACCTGGGGGTGGG - Intronic
932839653 2:75070198-75070220 ATACATACAATGTTGGGGGTAGG - Intronic
933406767 2:81870265-81870287 GTAAATACATAGGTGGGGCTTGG - Intergenic
936140126 2:109932233-109932255 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936176815 2:110230178-110230200 CTACTTACAAAGGTGGGGGTGGG - Intergenic
936204570 2:110439253-110439275 CTACTTACAAAGGTGGGGGTGGG + Intronic
937075645 2:119104335-119104357 GCAAATATAAAGCTGGGGCTGGG - Intergenic
937212257 2:120282181-120282203 TCAGATACAGAGCTGGGGCCGGG + Intronic
939148688 2:138447401-138447423 GAACATAGAAAGCTGGTGCTGGG + Intergenic
942368128 2:175251152-175251174 TTACATGAAAAATTGGGGCTGGG - Intergenic
942383277 2:175415799-175415821 TTAGAAATAAAGCTGGGGCTGGG - Intergenic
943636605 2:190314146-190314168 TTATATATAAAACTGGGACTTGG - Intronic
944279090 2:197873649-197873671 ATACAGCCAAAGCTGGGGGTGGG + Intronic
944654397 2:201863554-201863576 TAAAACACAGAGCTGGGGCTGGG + Intronic
947341253 2:229142130-229142152 CTACATTCAAACCTGGGGCGGGG + Intronic
1170342106 20:15340634-15340656 TTCCATAGTAAGCTGGGGATAGG - Intronic
1170616456 20:17956425-17956447 TTAAAAACAAAGCTGGGGCCCGG + Intronic
1170666614 20:18392341-18392363 TTACATACAAAGCATGTGGTGGG + Intronic
1172579217 20:36033646-36033668 TTACATAAAGAGTTTGGGCTGGG - Intergenic
1173480258 20:43393026-43393048 GTACAGACAAAGATGGGGATGGG + Intergenic
1173641452 20:44605446-44605468 TTACATACAAAACTGTGTATTGG - Intronic
1173794272 20:45848067-45848089 TTAAAAATAAGGCTGGGGCTGGG - Intronic
1174480579 20:50828482-50828504 TTAAATAAAAATCTGGGGCCAGG + Intronic
1174542297 20:51299105-51299127 TTACAGAAGAAGCTGGGGCTTGG - Intergenic
1177076622 21:16583507-16583529 TTATATACAAATCTGAGGCCAGG - Intergenic
1179408287 21:41142990-41143012 TGAAAGACTAAGCTGGGGCTGGG + Intergenic
1179486670 21:41715004-41715026 GTGCATACAAAGCGGGGGCAGGG - Intergenic
1179886374 21:44315937-44315959 GCACACACACAGCTGGGGCTGGG - Intronic
1182087931 22:27574355-27574377 TCACACATGAAGCTGGGGCTTGG - Intergenic
1182543010 22:31055414-31055436 TTTCATCCAAATTTGGGGCTTGG - Intergenic
1184961231 22:47930289-47930311 GTACATGCAAAGCTGGAGGTGGG + Intergenic
949777698 3:7650979-7651001 TTACAGTCAGAGCTGGGGTTTGG - Intronic
951495830 3:23325342-23325364 TTACATACTAATCTGAGGCTGGG + Intronic
951542837 3:23798559-23798581 TTCCTTACAATGCTGGGGGTTGG + Intergenic
953460471 3:43078029-43078051 TCTCATACACTGCTGGGGCTGGG - Intergenic
953839063 3:46374014-46374036 TTTCATACACAGCCTGGGCTGGG + Exonic
955559948 3:60178217-60178239 TGAAATAAAAAGATGGGGCTTGG - Intronic
956760110 3:72434901-72434923 TTACATATAAAGCTGTGGACAGG + Intronic
956810455 3:72859233-72859255 TTAAAAAAATAGCTGGGGCTGGG + Intronic
957053024 3:75424852-75424874 TTTTAAACAAAACTGGGGCTGGG + Intergenic
957124662 3:76143349-76143371 TGACAGACAAGGATGGGGCTAGG - Intronic
959755118 3:109888114-109888136 TTAAATAGAAAGCAGTGGCTTGG - Intergenic
959975260 3:112451935-112451957 TTACATGCCATACTGGGGCTTGG - Intergenic
962085331 3:132185584-132185606 TTACCTACAAAGCTTGGTCTAGG + Intronic
964736251 3:159921715-159921737 TGACATTTAAAGATGGGGCTAGG - Intergenic
966598776 3:181753406-181753428 TTACATCCAAAGCAGGTGCATGG + Intergenic
967762309 3:193240521-193240543 TTAAAAATAAAGCTGGGGCAGGG - Intergenic
968299106 3:197599797-197599819 TTACACAGACAGCCGGGGCTTGG - Intergenic
968321795 3:197776035-197776057 TTTCACATAAAGCTGGGGGTGGG + Intronic
970048410 4:11882647-11882669 TTACATACAAACAGAGGGCTTGG - Intergenic
970139729 4:12968827-12968849 TTAAATACAAGGCTGGGTGTAGG - Intergenic
972927956 4:44035611-44035633 TAACATACAAAGTTGGTGCTTGG + Intergenic
973895479 4:55408218-55408240 TTACATACTAAGCTGGTCCTGGG - Intronic
974514285 4:62888333-62888355 TTATATCCAAAGCTGGGCTTTGG + Intergenic
975406840 4:73999600-73999622 TCAAATACATATCTGGGGCTGGG - Intergenic
977814832 4:101403054-101403076 ATAAATACAAAGCTGCAGCTAGG + Intergenic
978906742 4:114013643-114013665 TTAAATCCAAAGCTGGGGGAGGG - Intergenic
980946213 4:139322984-139323006 TCAAATACTAAGCTGAGGCTGGG - Intronic
980998432 4:139804007-139804029 TTACAGAAAAAGCTGGGGATCGG + Intronic
982984527 4:162189169-162189191 ATACATACACTACTGGGGCTAGG - Intergenic
983751738 4:171282343-171282365 TTACAGACAAAATTGGGGATGGG + Intergenic
985128590 4:186719616-186719638 TTAGTGACAAAGCTGGAGCTAGG - Intronic
985584788 5:725048-725070 TGACACACAACGCTGGGGTTAGG - Intronic
985598291 5:809362-809384 TGACACACAACGCTGGGGTTAGG - Intronic
986694883 5:10342806-10342828 TTAAATATACAGTTGGGGCTGGG - Intergenic
986830416 5:11571378-11571400 TTATGCACAAAGCTGGAGCTAGG - Intronic
988666076 5:33329144-33329166 TTACACACAAAAGAGGGGCTGGG + Intergenic
989588784 5:43094322-43094344 TTAAAAACAAAACAGGGGCTGGG + Intronic
990403868 5:55468357-55468379 TTACTTACAAAGCCATGGCTGGG + Intronic
992549969 5:77850917-77850939 ATAAATACTGAGCTGGGGCTGGG - Intronic
995027156 5:107437390-107437412 TTGGATACAAATCTGGGACTGGG + Intronic
995381632 5:111541580-111541602 TTTCCTACAAAGTTGGGGTTTGG - Intergenic
995873272 5:116764370-116764392 TTAAAAAAAAAGCAGGGGCTGGG + Intergenic
999512790 5:152270323-152270345 TTACATTCACAGCTGGTTCTTGG - Intergenic
999673217 5:153975326-153975348 TTCCATACCTAGCTGGGTCTGGG - Intergenic
999763033 5:154717357-154717379 TTACTTACATAGCTGGGCCCTGG + Intronic
999795614 5:154987100-154987122 TTTAATACAAAGCTTGTGCTAGG - Intergenic
1000413651 5:160960532-160960554 TTAAATACAACTCTAGGGCTGGG - Intergenic
1001142385 5:169155532-169155554 GTAGATACAAGGCTGGGACTGGG + Intronic
1002486527 5:179541580-179541602 TTATAAACAAATCTGAGGCTGGG - Intergenic
1003299382 6:4863288-4863310 TAATATATAAAGCTGGGGTTTGG - Intronic
1006402117 6:33823882-33823904 TTTGATCCAAAACTGGGGCTGGG - Intergenic
1008005926 6:46408929-46408951 TTAAATAAAATGCTGGGTCTTGG + Intronic
1008311456 6:49980097-49980119 TTCCATGCAAAACTGGGGATTGG - Intergenic
1010388687 6:75311790-75311812 TTTAATAAATAGCTGGGGCTGGG - Intronic
1010864696 6:80960551-80960573 TTTCATACAAAGCTTGGAATAGG + Intergenic
1011206641 6:84906241-84906263 GTACATACAAATCTGGGCTTAGG + Intergenic
1014264378 6:119258828-119258850 ATGCATACAGAGCTGGGACTAGG + Intronic
1015732734 6:136364774-136364796 TTACATACAAGGCCGGGGGCGGG - Intronic
1020542585 7:9477715-9477737 TCACATACAGAGCTGGTTCTAGG + Intergenic
1023054282 7:36279116-36279138 TGACAAACAAAGCAGGGGCAGGG - Intronic
1024504315 7:50148844-50148866 TTACATTAAAATATGGGGCTGGG + Intronic
1024518362 7:50281435-50281457 TTACATCCAAAGCTGGTGATGGG - Intergenic
1030413938 7:109215937-109215959 TTACATAGAAAGGGGAGGCTTGG + Intergenic
1031700126 7:124914332-124914354 TTCCATACAAATTTGGGGATTGG + Intronic
1032162825 7:129523732-129523754 TTAAATACAAAGTTGGGGCCGGG - Intergenic
1034105633 7:148487158-148487180 TGAGAGACAAAGCTGGGGGTGGG + Intergenic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1034547951 7:151801329-151801351 TTAAATACCTTGCTGGGGCTGGG + Intronic
1035099140 7:156382227-156382249 TTACCTAAAAAGTCGGGGCTGGG - Intergenic
1039382299 8:37097392-37097414 TTGCATACCCAGCTGGGTCTTGG - Intergenic
1039572192 8:38595946-38595968 CTACATAATAAGCTGGGGTTAGG - Intergenic
1041340669 8:56842408-56842430 TAACTGACAAAGCTGAGGCTAGG - Intergenic
1043083086 8:75791385-75791407 TTACATAGAAAACTGAAGCTTGG - Intergenic
1044072311 8:87777937-87777959 TTAGAAAGAAAGCTCGGGCTGGG + Intergenic
1044108971 8:88248086-88248108 TGAGACACAAAGCTGAGGCTGGG + Intronic
1045502454 8:102753963-102753985 TTCCATAGAAATCTGGGCCTGGG + Intergenic
1045527315 8:102952167-102952189 TTAAAAACCAGGCTGGGGCTTGG + Intronic
1047166751 8:122447774-122447796 TTTCATACAAAGCTGTGATTTGG + Intergenic
1047364942 8:124203163-124203185 TTACAGACAGAGCCAGGGCTGGG - Intergenic
1047691756 8:127362552-127362574 TTACATACATATCTTAGGCTGGG - Intergenic
1049306018 8:141904638-141904660 TTATAAACCAAGCAGGGGCTAGG + Intergenic
1050410748 9:5362774-5362796 TTAGATGTAAAGATGGGGCTTGG + Intronic
1051274565 9:15386643-15386665 TTTCATGAAAAGCTGGGGGTGGG + Intergenic
1052972580 9:34385983-34386005 TTTCATCCAAGGCTAGGGCTTGG + Intronic
1053032324 9:34791471-34791493 TTGAATACAAAGCAGAGGCTGGG + Intergenic
1053155245 9:35773795-35773817 TTAAAAAGAAACCTGGGGCTGGG - Intergenic
1053189435 9:36049553-36049575 CCACATTCAAAGCTGGGCCTGGG + Intronic
1054746098 9:68855427-68855449 TAACATACAAGTCTGGAGCTTGG - Intronic
1055140850 9:72875437-72875459 TTACAGAGAAGGCTGTGGCTGGG - Intergenic
1055306074 9:74930247-74930269 TTACAGACATACCTGAGGCTGGG - Intergenic
1055389134 9:75800168-75800190 TTAAATAGAAAGTTTGGGCTGGG + Intergenic
1057221724 9:93261104-93261126 TTACCTGCTAGGCTGGGGCTTGG + Intronic
1057617892 9:96608292-96608314 TAACAAACACAGCTGAGGCTGGG - Intronic
1059539521 9:115116866-115116888 TGAGATAAAAAGCGGGGGCTGGG + Intronic
1060481293 9:124018030-124018052 ACACACAAAAAGCTGGGGCTGGG - Intronic
1061880309 9:133565661-133565683 TTCCATCCAGCGCTGGGGCTTGG + Intronic
1062184859 9:135212768-135212790 ATGCATAAAAAGCTGTGGCTGGG - Intergenic
1062522027 9:136961896-136961918 ATACATACAATGCGGGGACTCGG + Intergenic
1188395142 X:29673570-29673592 TTCCATAAAAAGCTTGGACTTGG - Intronic
1190076294 X:47319660-47319682 ATACAAATAAAGCTGTGGCTGGG + Intergenic
1191841450 X:65516145-65516167 TTACATAAAAAGCTGGTCCAGGG - Intronic
1193721011 X:84987721-84987743 TAACTTAAAAAGCTGGGGCTGGG + Intergenic
1197222224 X:123925100-123925122 TAACATACGAAAATGGGGCTGGG - Intergenic
1197706909 X:129640754-129640776 TTACTGACCAAGCTGGGGTTAGG + Intergenic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic