ID: 1129886152

View in Genome Browser
Species Human (GRCh38)
Location 15:79038807-79038829
Sequence ATGTGAGTATGTAAGCAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129886152 Original CRISPR ATGTGAGTATGTAAGCAGTT TGG (reversed) Intronic
904496057 1:30887349-30887371 ATGTGACCAGGTAACCAGTTTGG - Intronic
906870013 1:49468166-49468188 ACTTGAGTATGTAAGGATTTTGG + Intronic
908866028 1:68549269-68549291 ATGGGAGAATGAAACCAGTTTGG + Intergenic
909182879 1:72448074-72448096 TTGTGACTATGCAAGCACTTTGG - Intergenic
909468188 1:75998261-75998283 ATGTGATAATGTAAGTACTTTGG - Intergenic
910578014 1:88789132-88789154 AAGAGAGTATAGAAGCAGTTAGG + Intronic
912265587 1:108153853-108153875 ATTTCAGTATGCAAGAAGTTTGG - Intronic
912508920 1:110175174-110175196 ATCTGAGCATGGAAGCAGCTGGG - Intronic
915837962 1:159193066-159193088 ATGAGAGCATGTAAGCAACTGGG - Intronic
916758017 1:167791687-167791709 ATTTGAGTAAGGAAGCAGTTTGG - Exonic
917074328 1:171188156-171188178 ATGTGAGTATGCAAGGATTTTGG - Intronic
918923757 1:190751734-190751756 ATGGATTTATGTAAGCAGTTTGG - Intergenic
920073604 1:203321218-203321240 CTGAGAGCATGTAAACAGTTAGG + Intergenic
921064584 1:211613628-211613650 TTTTGAGTATGTAATCTGTTTGG + Intergenic
921651551 1:217684838-217684860 ATGTGAGAAAGTTAGTAGTTGGG - Intronic
923311008 1:232735357-232735379 ATGTGAGCATGTAGGCTCTTTGG + Intergenic
1063083652 10:2792715-2792737 ATGAGAGTTTATAAGCACTTTGG + Intergenic
1063386232 10:5617821-5617843 AGGTGAGCAAGTAAGCAGGTAGG + Intergenic
1063386235 10:5617845-5617867 AGGTGAGCAAGTAAGCAGGTAGG + Intergenic
1064805390 10:19124423-19124445 ATGTGTGTATATAAGCTTTTTGG + Intronic
1067920907 10:50456330-50456352 ATGTGAGTAGGTAAGGGGTGAGG - Intronic
1068203733 10:53819716-53819738 TTGTCAGGTTGTAAGCAGTTAGG + Intronic
1068362871 10:56002404-56002426 ATTTCAGTATGTAAGTAGATTGG + Intergenic
1071663793 10:87533145-87533167 ATGTTAGTATGTATACAGATTGG + Intronic
1078785404 11:14486176-14486198 ATGTGTGTATGAAAGCAGGAAGG + Intronic
1079527835 11:21412406-21412428 ATCTGAGTATTGAAGCAGATAGG - Intronic
1082261696 11:50080781-50080803 ATGTGAGTATGCATGGATTTTGG - Intergenic
1083172253 11:60929954-60929976 ATGTGGGTGTGTAAGCACTGAGG + Intronic
1083419832 11:62546529-62546551 CTGTGAGGATTCAAGCAGTTTGG - Intronic
1083676968 11:64331716-64331738 ATGTGTGTGTGTAGGGAGTTGGG + Intergenic
1090981041 11:131722563-131722585 ATGAGAGTAAGTACGCTGTTAGG + Intronic
1096028432 12:48388745-48388767 ATATGAGTATGTAAGTAGGTGGG - Intergenic
1097644396 12:62218405-62218427 ATGCTAGTATGTGATCAGTTGGG + Intronic
1099044615 12:77700341-77700363 AGGAGAGTTTGTGAGCAGTTGGG + Intergenic
1100183884 12:92116019-92116041 ATGTGAGAATGAAAGAATTTGGG - Intronic
1111819076 13:93191963-93191985 ATTTGAGTATCTGAGGAGTTTGG + Intergenic
1114255053 14:20994498-20994520 CTGTGAGTGTGTAGGAAGTTAGG - Intronic
1116285327 14:42963845-42963867 ATCTCATTATATAAGCAGTTTGG - Intergenic
1118135460 14:63021265-63021287 ATTTGATTATATAAACAGTTGGG - Intronic
1118227332 14:63914226-63914248 ATATGATTATGAAAGCAGTAGGG + Intronic
1119710454 14:76818393-76818415 AGGTGGGTCTGAAAGCAGTTAGG - Intronic
1120572126 14:86132714-86132736 TTTTGAGTATGAAAGCATTTGGG - Intergenic
1121366335 14:93315126-93315148 ATATAAATATTTAAGCAGTTAGG + Intronic
1121981001 14:98453486-98453508 AAGTGAGTGTGTAAGCAGAGAGG - Intergenic
1125375840 15:39028468-39028490 ATTTCAGTATTTAAGCAATTTGG + Intergenic
1126251592 15:46574019-46574041 ATATGAGTATGTCCGCTGTTAGG - Intergenic
1127435993 15:58958727-58958749 ACTTGAGTATGTAAGGATTTTGG + Intronic
1128866265 15:71116993-71117015 ATGTGAGGAAGCAAGCAGATGGG + Intronic
1129886152 15:79038807-79038829 ATGTGAGTATGTAAGCAGTTTGG - Intronic
1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG + Intergenic
1137506782 16:49060990-49061012 TTGTGAGGATTTAATCAGTTGGG - Intergenic
1140221891 16:73049515-73049537 ATGTAAGTATCTAACCTGTTGGG + Intronic
1141118416 16:81331693-81331715 ATGAGAGAATGCAAGGAGTTTGG - Intronic
1142060077 16:88023560-88023582 ATGAGAGTGTGTTAGCAGGTGGG + Intronic
1144296783 17:13883908-13883930 TAGTGAGTTTGTAAGCACTTGGG - Intergenic
1150905231 17:69329215-69329237 ATGGTAGTATGTAGGCAATTGGG - Intergenic
1153809818 18:8742133-8742155 GTGGGAGTATGTAGGCAGGTGGG + Intronic
1156004283 18:32421396-32421418 ATGTTAGAATGTAATCAGCTGGG - Intronic
1156593854 18:38523261-38523283 ATTTGACAATGAAAGCAGTTTGG - Intergenic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1158377778 18:56890947-56890969 ATGTGAGTATCTGAGCATTTAGG + Intronic
1159500215 18:69259126-69259148 ATGTGAGTAGGAAAGAAGCTAGG - Intergenic
1160000144 18:75010537-75010559 ATCTGATTGTGTAAGCAGCTGGG - Intronic
1164987821 19:32661715-32661737 ATTTGAGTATGTATGGACTTGGG - Intronic
925675525 2:6357611-6357633 ATGGGAATATGCAAGCATTTTGG - Intergenic
926649384 2:15324977-15324999 TGTTGAGTATGTAAGCAATTAGG - Intronic
929296854 2:40258194-40258216 ATGTCAGTCTGTAGGCAGTCAGG - Intronic
932846085 2:75137127-75137149 CAGTGAGTATGTAGGCTGTTAGG + Intronic
935725792 2:106022941-106022963 ATGTACTTATGTAACCAGTTTGG + Intergenic
936868118 2:117100503-117100525 ATGTGAATACGTTAACAGTTTGG - Intergenic
936936254 2:117840967-117840989 ATGTGATTAAGTAAATAGTTTGG + Intergenic
941541651 2:166793459-166793481 ATGTAAATTTGTAAGCACTTTGG + Intergenic
942027945 2:171929026-171929048 ATGTGAGTATAAAAGTACTTTGG - Intronic
943508709 2:188797032-188797054 ATGTGAGAAGGTAAGTAGATAGG - Intergenic
944559780 2:200924642-200924664 ATGTGAGTATGTCAGAAAATTGG - Intronic
945145080 2:206729536-206729558 ATGTGAGATTGTAAGCACTGTGG + Intergenic
945489792 2:210441722-210441744 AGGTGAGTATTTTAGCAGTTGGG + Intronic
945493301 2:210480637-210480659 ATGTGTGTTTGAAAGCAGGTGGG - Intronic
945896385 2:215487088-215487110 ATGCGGGTAAGTAAGCAGTAGGG + Intergenic
948585705 2:239018350-239018372 ATGTGTGTGTGTAAGCATGTGGG + Intergenic
1169023692 20:2349453-2349475 ATGTGAGTAAATAAGCCTTTAGG + Intergenic
1170265211 20:14459510-14459532 ATGTGTGTATGTATGTAGGTAGG + Intronic
1170326942 20:15166379-15166401 ATGTGAATATGCAAGAAGTTAGG + Intronic
1170863840 20:20135124-20135146 ATGTGATTATGGAATCAGATTGG + Intronic
1172300518 20:33846510-33846532 ATGTGTGTATGTATGTATTTTGG + Intronic
1177034081 21:16019949-16019971 ATGTGACCATGTTAGGAGTTGGG - Intergenic
1179065421 21:38020304-38020326 ATGTAAGTAAGCAAGAAGTTGGG + Intronic
1180204300 21:46248098-46248120 ATGTGGGTGTGTAAGGAGTCAGG + Intronic
1180219666 21:46350615-46350637 ATGAGAATATGGAAGTAGTTGGG + Intronic
1180499486 22:15919523-15919545 ATCTGAGTATAGAAGCAGTGAGG + Intergenic
1181950073 22:26547479-26547501 ATGTGAGTATGAAACCAGGTAGG - Intronic
1181950217 22:26548407-26548429 ATGTGAGTATGAAACCAGGTAGG + Intronic
1183609819 22:38892110-38892132 ATTTGTGGATGTAAGCAGATTGG - Intergenic
1184412805 22:44335197-44335219 ATGTGAAGGTGTAAGCAGTGTGG + Intergenic
1184517953 22:44974495-44974517 ATGTGGGTATGTCGGCTGTTTGG - Intronic
949380419 3:3439138-3439160 ATGTGAGTGTGAAGACAGTTTGG - Intergenic
950214652 3:11150778-11150800 ATGTGAACAAGGAAGCAGTTGGG + Intronic
955735514 3:62034139-62034161 ACTTGAGTATGTGAGCATTTTGG - Intronic
957787659 3:84903057-84903079 AAGTGGATAGGTAAGCAGTTAGG - Intergenic
957930031 3:86865479-86865501 ATGTGAGTGTGAAAGCTGGTAGG + Intergenic
960425349 3:117500323-117500345 AAGTGAGTATATATGCACTTTGG - Intergenic
964467621 3:157014155-157014177 ATTTGATCATGTAAGCAGTGTGG - Intronic
964855652 3:161142788-161142810 ATTTGAATATGTATGCAGCTTGG - Intronic
966258091 3:177942397-177942419 ATGGGAGTGTGTAGGCAGGTGGG + Intergenic
968502812 4:958986-959008 ATGTGAGTCTGTACCCAGGTGGG - Exonic
970877572 4:20889826-20889848 ATGTTAGTATACTAGCAGTTTGG - Intronic
971700418 4:29966466-29966488 ATGTGAGAATGGAAGCTGATTGG - Intergenic
973772592 4:54220375-54220397 ATGTGAGTAGGTCAGCAGAGAGG + Intronic
974379175 4:61116554-61116576 ATGTCAGTAGGTAGCCAGTTTGG + Intergenic
976995143 4:91422294-91422316 ATGTGAGTATGTAAAGAGAAAGG - Intronic
977144213 4:93415875-93415897 ATGTAAGGATTTAAGAAGTTAGG + Intronic
977546614 4:98389527-98389549 ATGTGAGTATATAATGAATTTGG + Intronic
978681502 4:111386819-111386841 ATGGGAGGAGGTAAGGAGTTAGG + Intergenic
980526941 4:134001561-134001583 TTGTGAGAATGAAAGAAGTTGGG + Intergenic
980751012 4:137088278-137088300 ATTTAATTATGTAAGCTGTTTGG + Intergenic
981402608 4:144331107-144331129 ATGGGATTTTGTAAGTAGTTTGG - Intergenic
982285527 4:153729809-153729831 AGGTGAGTATCTGAGGAGTTCGG + Intronic
982352683 4:154433189-154433211 ATGTGACAATGGAGGCAGTTTGG + Intronic
982378252 4:154718740-154718762 ACTTGAGTATTTAAGCAGATGGG + Intronic
982956454 4:161774198-161774220 ATGTGACTATAGAAGCAGATTGG + Intronic
987552698 5:19404540-19404562 AGGTGACTGTGTAAGGAGTTTGG + Intergenic
989788197 5:45357691-45357713 ATGTGTGTATGTTAGGAGTAGGG + Intronic
990147956 5:52784185-52784207 GTTTTAGTATGTAAGCACTTAGG - Intergenic
994588892 5:101748690-101748712 ATGTGTGTGTGTAAGTAGGTAGG - Intergenic
995124505 5:108566913-108566935 ATTTCAGTAAGTAAGAAGTTGGG + Intergenic
996133908 5:119815360-119815382 ATGTGAGGAAGTAAGTAGGTGGG - Intergenic
996730317 5:126711214-126711236 ATGTGAGTATCTAAAAATTTGGG - Intergenic
997313616 5:132912933-132912955 ATGTGATTATTTATACAGTTGGG - Intronic
998132110 5:139656434-139656456 GTGTGTGTATGTAAGCACTTAGG - Intronic
1000478388 5:161741694-161741716 ATGTAAGCAGGTAAGCAGTTTGG + Intergenic
1000997769 5:167975715-167975737 ATGTGAGTAAATATGCAGATAGG + Intronic
1004450146 6:15737918-15737940 AAGTGAGTATTTAAACATTTTGG + Intergenic
1006154011 6:32004439-32004461 TTGTGAGTAAGGAGGCAGTTTGG - Intergenic
1007498545 6:42278751-42278773 ATGTGATCATGAAAGCATTTGGG - Intronic
1010419724 6:75659007-75659029 TTGTGAGTATGTGAGTGGTTAGG + Intronic
1011898594 6:92263123-92263145 AGGAAAGTATGAAAGCAGTTTGG + Intergenic
1014089617 6:117388930-117388952 ATGTGGGTGGGTAAGCAGGTGGG - Intronic
1014318148 6:119892576-119892598 ATGTGACATAGTAAGCAGTTGGG + Intergenic
1014861958 6:126479924-126479946 AAGTGGTTGTGTAAGCAGTTAGG - Intergenic
1017239296 6:152148974-152148996 ATGTGATTATGGTAGCAATTAGG + Intronic
1017589704 6:155965697-155965719 ATCTGAGTCTGAAAGCAGCTAGG - Intergenic
1017853451 6:158326990-158327012 ATTTGAGTATGTGAGAATTTGGG + Intronic
1020031285 7:4934610-4934632 ATGTGCTCATGTAAGCAGTAAGG - Intronic
1025118957 7:56283169-56283191 ATGTGTGTATTTATGCTGTTTGG - Intergenic
1025911923 7:65835957-65835979 ATGTGAGTATGCATGGATTTTGG + Intergenic
1027203358 7:76077085-76077107 ATGTGAGTATGCATGGATTTTGG - Intergenic
1027668506 7:81069216-81069238 ATGTGAGTATTTAAGATGTAAGG + Intergenic
1028334626 7:89636598-89636620 ATGTGAGGATGTAGGGACTTTGG + Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1030010945 7:105166785-105166807 AGGTGAGTATGGAAACATTTTGG - Intronic
1036810942 8:11867570-11867592 ATGCGATTATGTCGGCAGTTTGG + Intronic
1037574319 8:20186811-20186833 TTGTGATTATGTAAGTGGTTAGG + Intergenic
1039470911 8:37813517-37813539 TTGTGTGTGTGTAAGCATTTTGG + Intronic
1042160513 8:65889621-65889643 ACGTGTGTGTGTTAGCAGTTGGG + Intergenic
1043757500 8:84020902-84020924 ATGTGAATATTAATGCAGTTTGG - Intergenic
1045662382 8:104451475-104451497 ATGTGCATTTGTAAGCACTTGGG + Intronic
1046635235 8:116668265-116668287 ATGCCAGTATGTAAACAGTGTGG + Intronic
1050354622 9:4771027-4771049 ATTTGAGTCAGTAAGCAATTTGG + Intergenic
1050430688 9:5558712-5558734 ATGTGTGTATGTATTCACTTGGG + Intronic
1051236154 9:15001371-15001393 ATTTGAGTATAAAAGCAATTAGG + Intergenic
1052159474 9:25238778-25238800 ATGTGAGTATGTCATCTCTTGGG + Intergenic
1052199199 9:25757338-25757360 ATGTGACTATGTATGAAGATAGG + Intergenic
1052524604 9:29598511-29598533 ATGTGACAATGGAAACAGTTTGG + Intergenic
1054965339 9:71019964-71019986 ATGTGAGTATCCAACCAATTTGG - Intronic
1055082316 9:72279445-72279467 AGGTGAGGATTTGAGCAGTTTGG - Intergenic
1057588034 9:96347159-96347181 ATGTGGGTAGGTAAGAAATTTGG - Intronic
1059761973 9:117346469-117346491 AGGTGAGTGTGTTAGGAGTTTGG - Intronic
1186995207 X:15114256-15114278 AGCTAAGTAGGTAAGCAGTTTGG + Intergenic
1187190098 X:17026262-17026284 ATGTGAGTATAAAATCTGTTTGG + Intronic
1187434715 X:19256836-19256858 ATATGAGTATGTTAGTGGTTGGG - Intergenic
1188203003 X:27316326-27316348 ATGCTAGTATGTTAGGAGTTGGG - Intergenic
1195570053 X:106389068-106389090 GTGTGTGTATGTAAGCATTTAGG + Intergenic
1195914027 X:109917843-109917865 ATGAGAGAATGTAAGCTCTTGGG + Intergenic
1196533784 X:116817376-116817398 ATGTGAGTATATAATCAGAGAGG + Intergenic
1197994065 X:132353211-132353233 ATGTCAGTATGATAACAGTTTGG + Intergenic
1198130053 X:133684850-133684872 GTGTGAGTATATATGCACTTTGG + Intronic
1199472673 X:148212047-148212069 ATGTGGGAATGAAAACAGTTTGG + Intergenic
1199953755 X:152726011-152726033 AGGTGTGTATGTGAGCAGGTTGG + Intergenic
1201761947 Y:17550155-17550177 AAGTGAGAATGTAAGATGTTTGG - Intergenic
1201839605 Y:18355835-18355857 AAGTGAGAATGTAAGATGTTTGG + Intergenic