ID: 1129889866

View in Genome Browser
Species Human (GRCh38)
Location 15:79064929-79064951
Sequence CTCTAACCCCAGGACCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 17, 3: 18, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129889866_1129889868 -3 Left 1129889866 15:79064929-79064951 CCTTCTAGGTCCTGGGGTTAGAG 0: 1
1: 0
2: 17
3: 18
4: 200
Right 1129889868 15:79064949-79064971 GAGCGATGAGTAAACAGACACGG 0: 1
1: 0
2: 1
3: 11
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129889866 Original CRISPR CTCTAACCCCAGGACCTAGA AGG (reversed) Intronic
901348798 1:8573017-8573039 CTCTACCTACAGGACCTAGGAGG + Intronic
902720192 1:18298893-18298915 CAGTAACCCCAGGACCTACTTGG + Intronic
902794361 1:18791465-18791487 CTTTAACCCCAGCACTTGGAAGG + Intergenic
903061844 1:20674184-20674206 CTGTAATCCCAGGACTTTGAGGG - Intronic
904041338 1:27586816-27586838 GTCCAACCCCCCGACCTAGAGGG - Intronic
904354500 1:29930399-29930421 GTCTATACCCAGGACCTAGCAGG - Intergenic
905434499 1:37947231-37947253 CTCTGGCCCCATGACCTAGAGGG - Intergenic
906185089 1:43856448-43856470 CTCTGAACCATGGACCTAGAGGG + Intronic
908342442 1:63195572-63195594 CCCTAACCCAAATACCTAGAAGG + Intergenic
910309475 1:85807298-85807320 CTCTAACCACAGCCCCTGGAAGG + Intronic
910960990 1:92763006-92763028 CTGTAATCCCAGCACCTTGAAGG + Intronic
911899988 1:103491486-103491508 CTATAACCACAGGTCCTAAAAGG + Intergenic
912653566 1:111464142-111464164 TTCTCACCCCAGTAACTAGAGGG + Intergenic
915491024 1:156250152-156250174 CTCTTCCCCCAAGACCTAGAGGG + Exonic
916957246 1:169851453-169851475 CTCTAATCCCAGGACTTTGGTGG - Intronic
918488805 1:185057875-185057897 CTATAATCCCAGCACTTAGATGG + Intronic
919983913 1:202659663-202659685 CTCTCTCCCCATGACCTGGAGGG + Intronic
921700293 1:218261761-218261783 CTGTAACCCCAGCACTTTGAGGG + Intergenic
923618273 1:235555987-235556009 CTGTAACCCCAGCTACTAGAAGG - Intronic
924472231 1:244352536-244352558 TTCTAAGCCCAGGACCTGAAAGG + Intergenic
924654419 1:245960495-245960517 CTGTAATCCCAGCACTTAGAAGG + Intronic
1063164328 10:3446164-3446186 AACTAGCCACAGGACCTAGAAGG - Intergenic
1063611497 10:7566469-7566491 CTGTAATCCCAGCACTTAGAAGG + Intronic
1066041341 10:31551080-31551102 CTCAAACCCCAGGGCAGAGATGG - Intergenic
1066212234 10:33251529-33251551 CTCAAACCCCAAAAACTAGAGGG - Intronic
1066761516 10:38758486-38758508 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1066960071 10:42213937-42213959 CTGTATCCCCAGGACCTAGAAGG - Intergenic
1070441964 10:76455397-76455419 CTCTTACCTCAGGACCTTGCAGG - Intronic
1070549114 10:77476542-77476564 CTCTAACCCCAGGTCCTGAGCGG + Intronic
1070622369 10:78023201-78023223 CTATAATCCCAGCACTTAGAGGG + Intronic
1070847912 10:79538980-79539002 CTATACCCCCAGGATCTACAAGG - Intergenic
1070925869 10:80221163-80221185 CTATACCCCCAGGATCTACAAGG + Intergenic
1071094510 10:81957607-81957629 CTCTATTCCCAGCACCTAGGTGG + Intronic
1072984977 10:100131328-100131350 CTCGAACCCCAGGACTCAAATGG - Intergenic
1074396555 10:113102681-113102703 CTGTAATCCCAGTACTTAGAGGG - Intronic
1075485934 10:122822141-122822163 CTGTGTCCCCAGCACCTAGAAGG - Intergenic
1076153138 10:128179906-128179928 CTGTAATCCCAGCACCTTGAGGG - Intergenic
1076859639 10:133134582-133134604 CTCCAAGTCCAGGTCCTAGAGGG + Intergenic
1080946480 11:36980112-36980134 CTGTAACCCCAGGACTTTGGAGG - Intergenic
1081417292 11:42831291-42831313 CTGTAATCCCAGCACTTAGAAGG - Intergenic
1084588529 11:70077537-70077559 CTCTTACCCCCGGACCTAGCAGG - Intergenic
1085128206 11:74016473-74016495 CCCTAACCCAATGACCTAGGGGG + Intronic
1085152083 11:74260287-74260309 CTCTAGCCCCAGGCCCTGGAGGG + Intronic
1087707098 11:101505755-101505777 CTATAATCCCAGGACCTTGCAGG + Intronic
1094149356 12:27265551-27265573 CTGTATCCCCAGGACCTAGAAGG + Intronic
1095726175 12:45455436-45455458 CTCTAAAGCCAGGACCTCAAGGG - Intergenic
1102548254 12:113672081-113672103 CGCTAACCCCTGGGCCTAGCTGG + Intergenic
1103376874 12:120463519-120463541 CCCTGACAGCAGGACCTAGAAGG + Exonic
1104726010 12:131076199-131076221 CTGCATCCCCAGGACCTAGAGGG - Intronic
1104760336 12:131294205-131294227 CTCACACCCCAGGACACAGAAGG + Intergenic
1104819431 12:131666442-131666464 CTCACACCCCAGGACACAGAAGG - Intergenic
1105380391 13:19881725-19881747 CTGTAACCCCAGCACTTTGATGG + Intergenic
1107126878 13:36856015-36856037 CCCTAACCCCAGGGCCTAGGTGG + Intronic
1107925823 13:45260904-45260926 CTCGAACTCCAGGAACTACAGGG - Intronic
1111378063 13:87407069-87407091 GTCTCACCCAAGAACCTAGAAGG - Intergenic
1111576583 13:90162439-90162461 CTGTAACCCCAGTACTTTGAGGG + Intergenic
1113822603 13:113225711-113225733 CTCTGACTCCAGGAGCTGGACGG - Intronic
1117339064 14:54778434-54778456 CTTTAACCACAGGAACAAGAGGG - Intronic
1118535197 14:66756066-66756088 CTCTAACCCCAGGATATTGTGGG + Intronic
1119054922 14:71409364-71409386 CTCTAACCAAAGGACCCATAAGG - Intronic
1119237216 14:73029709-73029731 CTGTAATCCCAGCAACTAGAGGG + Intergenic
1119803578 14:77467139-77467161 CTCTAATCCCAGCACTTTGAGGG + Intronic
1120210516 14:81629381-81629403 CTCTCACCCCAGCACTTCGATGG + Intergenic
1122455320 14:101845753-101845775 TGCTAACCCCAGGACCAAGCTGG - Intronic
1122921067 14:104880382-104880404 CTCGAACCCCAGGCCGGAGAAGG + Exonic
1202932865 14_KI270725v1_random:54840-54862 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1124508669 15:30303716-30303738 AGCTATCCCAAGGACCTAGAAGG - Intergenic
1124734888 15:32234945-32234967 AGCTATCCCAAGGACCTAGAAGG + Intergenic
1126475372 15:49060354-49060376 CTCTAATCCCAGCACTTTGAGGG - Intergenic
1126832511 15:52622761-52622783 GTCAAATCCCAGGAACTAGAAGG + Intronic
1127065019 15:55228115-55228137 CTCTAACCCTAAAAGCTAGAAGG + Intronic
1128210123 15:65892766-65892788 CTCTTACCCAAGGATCTGGAGGG + Intergenic
1128889982 15:71322838-71322860 CTGTAATCCCAGCACCTAAAAGG + Intronic
1129889866 15:79064929-79064951 CTCTAACCCCAGGACCTAGAAGG - Intronic
1132106457 15:99066347-99066369 TCCTCACCCCAGGACCTAGGTGG + Intergenic
1132142858 15:99409377-99409399 CTCTAATCCCAGCACTTTGAGGG + Intergenic
1133902109 16:9986505-9986527 CTGTAATCCCAGCACCTTGAGGG + Intronic
1134027094 16:10962799-10962821 CTGTAACCCCAGCACTTAGGAGG + Intronic
1134508031 16:14823869-14823891 CTGTAATCCCAGTACCTAGGAGG - Intronic
1134651007 16:15908701-15908723 CTGTAATCCCAGCAACTAGAGGG + Intergenic
1134695731 16:16222634-16222656 CTGTAATCCCAGTACCTAGGAGG - Intronic
1134976095 16:18572054-18572076 CTGTAATCCCAGTACCTAGGAGG + Intergenic
1138247522 16:55478880-55478902 CTCTAACCTCAGGACGTCAAGGG + Intronic
1138349615 16:56339536-56339558 CTCTCACCCCAGGCCAGAGAGGG - Intronic
1139948223 16:70656277-70656299 CTATAACCCCAGCACTTTGAGGG + Intronic
1141177782 16:81732085-81732107 CTGTGGCCCCAGGACCTACAAGG + Intergenic
1141721581 16:85758981-85759003 CTCTAACCCCAGTACTTTGGAGG + Intergenic
1143712388 17:8743818-8743840 CTCCATCCCCAGGCCCAAGAGGG + Intronic
1144788166 17:17843230-17843252 GTCTCACCCCAGGTCCCAGATGG - Intergenic
1145237679 17:21220575-21220597 CTATAATCCCAGCACCTTGAGGG - Intergenic
1146394966 17:32457491-32457513 CTGTAATCCCAGGACTTGGAAGG - Intronic
1146459248 17:33032703-33032725 CTCTAATCCCAGCACCTGGGAGG - Intronic
1147253554 17:39167684-39167706 CACTAACCCCAGGAAACAGATGG - Intergenic
1148151882 17:45401976-45401998 CCCTGACCTCAGTACCTAGAAGG - Intronic
1150168952 17:62971657-62971679 CTCTAACCCCTGGACCATCATGG + Intergenic
1153110350 18:1579055-1579077 CTCAAACCCCAGAACATAGATGG - Intergenic
1154357097 18:13630075-13630097 CACTAACCCCAGCACCAAGCTGG + Intronic
1157439515 18:47699833-47699855 TTGTAGCCCCAGCACCTAGAAGG - Intergenic
1158290300 18:55932895-55932917 CTCTGACCCCAAGGCCCAGAGGG - Intergenic
1162696961 19:12484313-12484335 CACGAACCCCACGACCGAGACGG + Intronic
1163087758 19:14994531-14994553 CTCTAACCCCTGGAGAAAGATGG - Intronic
1163480087 19:17550132-17550154 CTCTAATCCTAGGACTTAGGGGG + Intronic
1164562713 19:29303905-29303927 TGCTAACCCCAGGACCTCGCTGG + Intergenic
1164628597 19:29746131-29746153 CTATAATCCCAGGACCTTGGGGG - Intergenic
1164704461 19:30310011-30310033 CTCGAACCCCAGGACTCTGATGG - Intronic
1164983645 19:32632326-32632348 CTGTAACCCCAGCACTTTGAGGG + Intronic
1165567565 19:36744368-36744390 CTGTAATCCCAGCACCTAGGAGG + Exonic
1166983336 19:46644947-46644969 CTCTAACCCCAGTGCCTGGCTGG + Intergenic
1167287489 19:48606785-48606807 CTCCATCCCCAGGACTTAGAGGG + Exonic
1167389652 19:49186207-49186229 CTCTAATCCCAGCACTTATAGGG - Intronic
1167491523 19:49795397-49795419 CTGTAACCCCAGGACATTGCGGG + Intronic
925093202 2:1171981-1172003 CTTTAATCCCAGGAAATAGACGG + Intronic
925310652 2:2879206-2879228 CTCTAACCCCAGGGCACAGCAGG + Intergenic
927494449 2:23543178-23543200 CTCTAACCACATGGTCTAGAGGG + Intronic
930030595 2:47056081-47056103 CTCCATCCCTGGGACCTAGAGGG - Intronic
934324828 2:92003156-92003178 CTGTATCCCCAGGACCTAGAAGG + Intergenic
934463207 2:94233862-94233884 CTGTATCCCCAGGACCTAGAAGG + Intergenic
935849891 2:107207019-107207041 CTGTAACCCCAGCACTTTGAGGG + Intergenic
935898099 2:107759477-107759499 TTCTAACCCCATGAGCTACAAGG + Intergenic
941165053 2:162075065-162075087 CTTTATCTCCAGTACCTAGAAGG - Intergenic
941858115 2:170250936-170250958 CTCAAACCCCAGGCTCCAGAAGG - Intronic
943743899 2:191441155-191441177 CTGTAATCCCAGCACCTTGAGGG - Intergenic
944065631 2:195616560-195616582 CTGTAACCCCAGCACTTTGAGGG - Intronic
944514345 2:200496748-200496770 CTGTAATCCCAGCACCTTGAAGG - Intronic
946143843 2:217713951-217713973 CTCTAAAGCCAGGATTTAGAAGG + Intronic
946146067 2:217731966-217731988 CTCAAACCCCATGGCCTGGATGG + Intronic
946929812 2:224660516-224660538 CTCTAATCCCAGCACTTTGAGGG - Intergenic
947353878 2:229272440-229272462 CTTTAACCCCCAGCCCTAGACGG - Intergenic
1171141721 20:22749383-22749405 CTCCAACCCCGGGACTCAGATGG + Intergenic
1174640062 20:52036103-52036125 CTGTAACCCCAGCACTTTGAGGG - Intergenic
1175498182 20:59429590-59429612 CTCTATCCCCATGACCAAGAAGG - Intergenic
1175812146 20:61864187-61864209 CCCCAACCCCAGGAGCTGGAAGG + Intronic
1176594252 21:8676903-8676925 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1177084584 21:16687520-16687542 CTGTAATCCCAGTACTTAGATGG + Intergenic
1177163573 21:17575436-17575458 CTGTAATCCCAGGACTTAGGAGG - Intronic
1179679531 21:43009055-43009077 CTGTAATCCCAGGACTTTGAGGG + Intronic
1179897559 21:44371121-44371143 CTCTTCCCCTAGGCCCTAGAGGG - Intronic
1179946840 21:44684276-44684298 CTCTAATCCCAGCACTTTGAAGG + Intronic
1180277105 22:10654037-10654059 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1180584330 22:16872944-16872966 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1180984145 22:19894505-19894527 CTGTAATCCCAGCACTTAGAAGG + Intronic
1181052438 22:20244231-20244253 CTCCAACCCCAGCACTTAGCCGG - Intronic
1182130746 22:27848779-27848801 CTCGAACCCCAGGACTCAAAAGG + Intergenic
1183211361 22:36453447-36453469 CTGTGACCCCAGAACCTGGAGGG + Intergenic
1183581016 22:38726791-38726813 CCCAAACCCCAGGAGATAGAAGG - Intronic
1184722357 22:46322352-46322374 CCCTTACCCCAGCACCAAGAGGG - Intronic
1184973043 22:48041090-48041112 CTGTAACCCCAGCACATTGAGGG - Intergenic
951243833 3:20317302-20317324 CTCTAACTCAGGGACCCAGAAGG - Intergenic
953154848 3:40360399-40360421 CTGTAATCCCAGCACCTTGAAGG + Intergenic
953792936 3:45962382-45962404 CTCCTCCCCCAGGACCCAGAAGG - Exonic
954124878 3:48522290-48522312 CCCCAACCCCAGGACCGAGAGGG + Intronic
954166397 3:48762160-48762182 CTATAATCCCAGCACTTAGAAGG + Intronic
954860165 3:53681522-53681544 CTGTAACCCCAGTGCCTAGCAGG - Intronic
955287032 3:57651949-57651971 CTGTAACCCCAACACCTAGGTGG + Intronic
955698694 3:61662043-61662065 CTATAAACCTAGAACCTAGAAGG - Intronic
957133618 3:76256039-76256061 CTGTAACCCCAGCACTTTGAGGG + Intronic
960158747 3:114325977-114325999 CCCCAACCCCAGGCACTAGAGGG - Intergenic
960306035 3:116061785-116061807 CTCTATCCCCAGCATCTAGGAGG + Intronic
961817464 3:129558663-129558685 CTCCAACCTCAGGCCCTTGAGGG - Intronic
963993366 3:151679174-151679196 CTCAAATCTCAGGATCTAGATGG - Intergenic
965792941 3:172409284-172409306 CTGTAATCCCAGCACTTAGAAGG + Intergenic
965923913 3:173953798-173953820 CTGTAACCCCAGCACCTGGGAGG - Intronic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
973783359 4:54311770-54311792 CTCTAATCCCAGCACTTTGAGGG - Intergenic
974073673 4:57148814-57148836 CTATAATCCCAGGACCTGGGAGG - Intergenic
975660253 4:76681540-76681562 CTGCAACCCCAGGAGCTAGAGGG - Intronic
977194494 4:94042745-94042767 CTCTCACCCCATTGCCTAGATGG + Intergenic
977939578 4:102844333-102844355 CTGTAACCCCAGCACTTAGGGGG - Intronic
977977122 4:103278674-103278696 CTATAATCCCAGTACTTAGAAGG - Intergenic
978417605 4:108493224-108493246 CACTAAGCCCAGGACCTTCATGG - Intergenic
979981439 4:127260962-127260984 CTCTGACCCCATGACCTTGTGGG + Intergenic
985499424 5:232476-232498 CTATAATCCCAGGACCCTGAGGG - Intronic
988254782 5:28808235-28808257 CTCTAACCCCAGCACTTTAAGGG - Intergenic
988661210 5:33270699-33270721 CCCTAATCCTAGGATCTAGAAGG - Intergenic
989714842 5:44450765-44450787 GTGTAAACCCAGGACCCAGATGG - Intergenic
989743375 5:44798272-44798294 CTCTAACCCAAGAACCCACATGG + Intergenic
990418034 5:55605441-55605463 CTGTAACCCCAGCACTTTGAGGG - Intergenic
990511181 5:56490573-56490595 CTCTTACCCCAGGATCTATTAGG - Intergenic
991345932 5:65668350-65668372 CTCTAATCCCAGCACTTTGAGGG + Exonic
994841748 5:104932681-104932703 CTCCAACCCCAGGGCCAGGATGG - Intergenic
997721342 5:136080523-136080545 CTCGAACCCCAGCACAGAGATGG + Intergenic
999517661 5:152317122-152317144 CTGTAACCCCAGCACTTTGAGGG - Intergenic
1000770429 5:165346800-165346822 CTGTAATCCCAGCACCTTGAGGG + Intergenic
1003261509 6:4520980-4521002 CTCCAGCCCCAGCACCTAAAGGG + Intergenic
1005985416 6:30870724-30870746 ATCTCACACCAGGACCCAGATGG + Intergenic
1008660773 6:53665545-53665567 CACACACCCCAGGATCTAGAAGG + Intronic
1009327456 6:62370534-62370556 CTCTAACAAAAGGATCTAGATGG + Intergenic
1011504060 6:88021916-88021938 TTCTAACCCAAGGCCCCAGAAGG + Intergenic
1015008570 6:128314339-128314361 GTCCAACCCCAGCACCCAGAAGG + Intronic
1015299327 6:131634711-131634733 CTATAACCCCAGAATTTAGAAGG - Intronic
1015480619 6:133703917-133703939 CTATAATCCCAGCACCTTGAGGG - Intergenic
1015594887 6:134857012-134857034 CTCTAACCCCTTGAACTTGATGG + Intergenic
1015617070 6:135088557-135088579 CTATATCCACAGCACCTAGAAGG + Intronic
1018191321 6:161311499-161311521 ATCTAACCACAAGACCAAGATGG - Intergenic
1019403116 7:867750-867772 CTCCCACCCCAGGACCAAGGTGG + Intronic
1026213171 7:68324714-68324736 CTATATGCCCAGAACCTAGACGG + Intergenic
1026379513 7:69784893-69784915 CTGTAAACCCAGTACCTAGAAGG - Intronic
1026787978 7:73313627-73313649 CTCTAGCCCCAGGGTCTAGAAGG + Intronic
1027919037 7:84367136-84367158 CTCTAGCCCCAATTCCTAGAGGG - Intronic
1029420730 7:100470561-100470583 CTGTAATCCCAGGACTGAGATGG - Intronic
1031479646 7:122262875-122262897 CTCTAACACTAGGACCTAGGAGG - Intergenic
1034541845 7:151763505-151763527 TTCTGACCCCAGGGCCTTGAAGG + Intronic
1035138374 7:156730679-156730701 CTGTAATCCCAGGACTTGGAAGG + Intronic
1037510083 8:19573821-19573843 CTTTATCCCCAGCACCTTGAGGG - Intronic
1039897345 8:41725611-41725633 CCCTCACCCCAGGACGCAGAGGG - Intronic
1043601653 8:81946517-81946539 CACTGACCTCAGGAGCTAGAAGG - Intergenic
1044658234 8:94570672-94570694 CTGTAATCCCAGCACCTTGAGGG + Intergenic
1044977668 8:97681747-97681769 CTGTAATCCCAGCACCTGGAAGG - Intronic
1046046770 8:108974119-108974141 CTCAAAGCCCAGGATCAAGATGG - Intergenic
1047276442 8:123409081-123409103 CTGTAACCCCAGCACTTTGAGGG - Intronic
1047707142 8:127510906-127510928 CTATATCCCCAGTGCCTAGAAGG - Intergenic
1049124325 8:140773288-140773310 TTCTAACTCCAGCACCTACATGG - Intronic
1051421925 9:16897284-16897306 CTGTAATCCCAGCACCAAGATGG - Intergenic
1053014659 9:34654947-34654969 CCCTAAGCCCAGGACTGAGATGG + Intronic
1053693274 9:40610506-40610528 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1053940258 9:43240901-43240923 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1054271558 9:63029581-63029603 CTGTATCCCCAGGACCTAGAAGG - Intergenic
1054304516 9:63409734-63409756 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1054403263 9:64733753-64733775 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1054436885 9:65219243-65219265 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1054493512 9:65802751-65802773 CTGTATCCCCAGGACCTAGAAGG - Intergenic
1056476747 9:86960024-86960046 CTTTTCCTCCAGGACCTAGAAGG - Intergenic
1056798428 9:89674947-89674969 CTCTGACCCCAGGGACTAGAAGG - Intergenic
1058636484 9:107043342-107043364 CTGTAAACCCAGAACCTAGAAGG + Intergenic
1058774777 9:108272670-108272692 ATCAGACCCCAGGAACTAGAAGG + Intergenic
1060552148 9:124490789-124490811 CTCTAATCCCTGGATCTAGGGGG - Intronic
1060985410 9:127816597-127816619 CTCCCAGCCCAGGACCAAGAAGG - Intronic
1061205443 9:129160468-129160490 CTCTGTCCCCAGCACCTGGAGGG - Intergenic
1203624384 Un_KI270749v1:157173-157195 CTGTATCCCCAGGACCTAGAAGG + Intergenic
1187746508 X:22414936-22414958 CTTTAACCCCAGCACCTAGTAGG - Intergenic
1189983790 X:46535401-46535423 CTGTAACCCCAGCACTTGGAAGG - Intronic
1190026702 X:46930525-46930547 CTATATCCCCAGGGCCTAGAGGG + Intronic
1192821006 X:74645380-74645402 CTCTAACCTCAGGGCCTTCATGG + Intergenic
1196972458 X:121124433-121124455 CTCTAACCAAAGGACCAAAAAGG - Intergenic
1197242191 X:124132098-124132120 CTGTAACCCCAGCACTTTGAGGG - Intronic
1200072976 X:153538082-153538104 CTCCAGCCCGAGGACCTTGAGGG - Intronic