ID: 1129890041

View in Genome Browser
Species Human (GRCh38)
Location 15:79065782-79065804
Sequence CCCTGCCACCTGGACACCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 160}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129890041_1129890045 -8 Left 1129890041 15:79065782-79065804 CCCTCGGTGTCCAGGTGGCAGGG 0: 1
1: 0
2: 0
3: 20
4: 160
Right 1129890045 15:79065797-79065819 TGGCAGGGAGCAGCAGCACAAGG 0: 1
1: 0
2: 8
3: 64
4: 505

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129890041 Original CRISPR CCCTGCCACCTGGACACCGA GGG (reversed) Intronic
900379480 1:2376721-2376743 CCCTCCCACCCGGACACCAGCGG - Intronic
900533105 1:3164434-3164456 CCCTGCCAGGAGGGCACCGAGGG + Intronic
900590395 1:3456879-3456901 CCCTCCCACCTGGACATAGCTGG - Intronic
901070233 1:6513314-6513336 CCCTGCCACCTTGACACACAGGG - Intronic
902412303 1:16218503-16218525 CCCTGCCTCCAGGAAACGGAAGG - Intergenic
903178996 1:21596141-21596163 CCCTGCCACCTTGACATCCCTGG + Intergenic
903472725 1:23598629-23598651 CCCACCCACCTGGGCACAGAGGG + Intronic
904464929 1:30702026-30702048 TCCTGCCCCCTGGACACCCACGG + Intergenic
904465471 1:30704882-30704904 TCCTGCCCCCTGGACACCATGGG + Intergenic
905491647 1:38348904-38348926 AACTGCCACCTGGAGACCAAGGG + Intergenic
906678353 1:47709033-47709055 CCCTGCCACCTGTAGAAGGAAGG + Intergenic
906805447 1:48775965-48775987 CTCTGCCACCTGGCCAGGGAGGG + Intronic
907222090 1:52914553-52914575 GCCTGCCTCCTGTACACCCAGGG + Intronic
907855085 1:58295400-58295422 CCCTGCCACCTCCACTCCCATGG - Intronic
910573241 1:88729715-88729737 CCCTTCCACATGGACTCTGAGGG - Intronic
911093138 1:94033768-94033790 CCCTGGCACCTGCACTCAGAGGG + Intronic
919768784 1:201144024-201144046 CACTGCCAGCCGGACACAGATGG - Intronic
922181935 1:223242563-223242585 TCCTGCCACGTGGACAGGGATGG - Intronic
922717843 1:227886407-227886429 CCCTCCCACCTGGAGCCCCATGG - Intergenic
922746636 1:228048019-228048041 CTCTGCCACCTGGACATCCAGGG - Intronic
923624561 1:235603483-235603505 CCCTCCCACCCAGACACCCAGGG + Intronic
1063670517 10:8096091-8096113 AACTGCCACCAGGCCACCGACGG - Intergenic
1069073006 10:64009478-64009500 CCCTGCTACCTGTACACTGGAGG + Intergenic
1069829930 10:71276857-71276879 CTCTGCCTCCAGGACACCTAGGG + Intronic
1070542413 10:77425631-77425653 TCCTGCCACCTGGACAAGGCTGG - Intronic
1071011429 10:80944825-80944847 CCCTCACACCTGGATACCCATGG - Intergenic
1072607924 10:96999486-96999508 CCATGCCTCCTGGTCACAGATGG + Exonic
1076312293 10:129517189-129517211 CCATGGCTCCTGGACAGCGAGGG + Intronic
1076844363 10:133061756-133061778 CCCAGCCACCTGCACGCCGAAGG - Intergenic
1084795226 11:71500895-71500917 CCCTGTCATCTGGCCACCCAGGG + Intronic
1085269577 11:75262352-75262374 CCCAGCAACCAGGACACAGAGGG - Intergenic
1085307693 11:75497470-75497492 GCCTGCCTCCTGGACAGTGAGGG + Intronic
1087162169 11:94959405-94959427 CCCTGCCTCCTGGACTCCCCAGG - Intergenic
1089383149 11:118050476-118050498 CCCTGCCATCTGGAGACCCAAGG + Intergenic
1090444162 11:126749020-126749042 CCCTGCCACCTGGAGACTGCAGG - Intronic
1094064782 12:26350930-26350952 CCCAGCCAACAGGGCACCGAGGG + Intronic
1095809503 12:46356843-46356865 CCCTGCCACTTGGAAGCCCAGGG - Intergenic
1096551814 12:52378116-52378138 CCCTGCCCCCTGCCCACCCAGGG - Exonic
1096670569 12:53196066-53196088 CACTGCCACTTGGACAGCAATGG - Exonic
1096878542 12:54648704-54648726 TCCTTCCACCTGGAAACAGAAGG + Intergenic
1097918207 12:65042131-65042153 ACCTGCAGCCTGGACACCTAGGG - Intergenic
1102466855 12:113135211-113135233 CCCTCCCACCGGGACAGCCATGG + Intronic
1103085619 12:118060659-118060681 CCCTGGCACCTGGGTACCCAGGG + Intronic
1103090581 12:118095396-118095418 CCCTGCCACATGGAAGCTGAGGG - Intronic
1103716791 12:122949749-122949771 CCCAGCCCCCAGGACACCTAGGG + Intronic
1103807150 12:123582517-123582539 CCCTGCCACAGGGCCACAGAAGG - Intergenic
1103948099 12:124538194-124538216 CCATGCCACCGGGACACCCTGGG - Intronic
1104208592 12:126664861-126664883 CCCTGCCCCCAGGACACTTAAGG - Intergenic
1104293400 12:127489379-127489401 CCCTGTCACCTGGACCCCTTAGG + Intergenic
1104765855 12:131329783-131329805 CCCTAACACCTGGAAACCGCAGG - Intergenic
1104806239 12:131591321-131591343 CCCTGCCCCCTGCACACCTGGGG + Intergenic
1106082505 13:26512057-26512079 TCCTGCCAGCTGGCCACAGAAGG - Intergenic
1107809919 13:44190429-44190451 CCCTGACACATGGACTCCGTTGG + Intergenic
1112291271 13:98145215-98145237 CACAGCCACCTCCACACCGAGGG - Intronic
1113008048 13:105730151-105730173 CCCTGCCTCCTGGACAGCCAGGG - Intergenic
1121107361 14:91289823-91289845 CACAGCGAGCTGGACACCGAGGG + Intronic
1121456743 14:94043294-94043316 GCCTGCCAGCTGGTCACCCAGGG + Intronic
1122090227 14:99333769-99333791 CCCTGCGACCTGGACACAGGTGG + Intergenic
1122690404 14:103529477-103529499 CCCTGCCACCTAGCCCCCGTGGG + Intronic
1123043179 14:105498927-105498949 TCCCGCCACCTGGACGCTGAGGG + Exonic
1123108848 14:105855871-105855893 CCCAGCCACCGGGACAGAGAGGG - Intergenic
1123552749 15:21398525-21398547 GGCTGCCACCTGGAGACTGATGG - Intergenic
1123588995 15:21835913-21835935 GGCTGCCACCTGGAGACTGATGG - Intergenic
1124372900 15:29113540-29113562 CACTGCCACCTGGCCTCCTACGG - Intronic
1128548740 15:68584341-68584363 CACTGCCACCTTGACACCTATGG + Intronic
1128607384 15:69047131-69047153 CCCTGTCTCCTGGGCACCCACGG + Intronic
1129269626 15:74412514-74412536 CCCTGCCTCCTGGACTCTTAGGG + Intronic
1129761545 15:78131650-78131672 CCGTGCGACCTGGACTCCCACGG - Intronic
1129890041 15:79065782-79065804 CCCTGCCACCTGGACACCGAGGG - Intronic
1130913604 15:88287988-88288010 CCCTTCCCCCTGGAAACTGATGG - Intergenic
1202961099 15_KI270727v1_random:125745-125767 GGCTGCCACCTGGAGACTGATGG - Intergenic
1132601337 16:774479-774501 CCCTGGCTCCTGGACACTGGAGG - Exonic
1132660764 16:1060569-1060591 CTCTGTCACCAGGACACGGATGG - Intergenic
1132850279 16:2021892-2021914 CCCTGCCACATGGCCACAGGAGG - Intergenic
1134066474 16:11231727-11231749 CCCTACCACCTGGCATCCGAGGG - Intergenic
1134620370 16:15684266-15684288 CCCTGCAACCTCGACACCCTGGG - Intronic
1136577122 16:31131517-31131539 CCCTGACTCCTGGACTCCGGAGG - Exonic
1137311405 16:47263207-47263229 CTCTGCTACATGGACACTGAAGG + Intronic
1139297119 16:65910622-65910644 CCCTGCCACCTTCACACCATAGG - Intergenic
1139967920 16:70755878-70755900 CCCAGCCACCTGGGAACCTAGGG + Intronic
1140156979 16:72440311-72440333 CCCTGCAACCTCCACACCCAGGG + Intergenic
1141629886 16:85281660-85281682 CCCTCCTACCTGGTCACCGTGGG + Intergenic
1142000212 16:87660052-87660074 CCCTGCCACCTGGAAACCCTGGG + Intronic
1142032767 16:87846706-87846728 CCCTGCTACCTGGATGCCGGCGG - Intronic
1143020666 17:3915857-3915879 CTCTGCCTCCTGTTCACCGAAGG + Intronic
1143875021 17:9985029-9985051 CCCTGGCCCCTGGACAACCAGGG + Intronic
1148741335 17:49894801-49894823 CCCTGCCAGCTTGTCACCAAGGG - Intergenic
1148860547 17:50602263-50602285 GCCTGCCTCCTGGCCACCCAGGG + Intronic
1151698479 17:75730361-75730383 CGGTGCCACCTGGACACCACGGG + Exonic
1151717886 17:75840650-75840672 CGCAGCCACCTGGACCCCAAAGG + Intronic
1151983481 17:77527949-77527971 CGCGGCCCCCTGGACACAGATGG - Intergenic
1154453662 18:14501922-14501944 GGCTGCCACCTGGAGACTGATGG - Intergenic
1156637538 18:39049448-39049470 ACCAGCCATCTGGACACAGAAGG + Intergenic
1160663299 19:311464-311486 CCCTGACACCTGGAGACCAGGGG - Intronic
1160840648 19:1145724-1145746 CCATGCCAGCCGGACACAGAAGG - Intronic
1161713606 19:5863577-5863599 CCCAGCCACCTGGCCAACGTTGG - Intergenic
1161741954 19:6026762-6026784 CCCTGCCACCAGGAGGCCGTAGG + Intronic
1165435614 19:35793171-35793193 CCCGTCCACCTGGACACCTAAGG + Intergenic
1166817150 19:45553238-45553260 CCCAGCCAGCAGGACACCGTGGG - Intronic
1168318427 19:55494308-55494330 CCCTGCCTCCTGGCCCCCGGCGG + Intronic
1168396148 19:56050425-56050447 CAGTGCCACCTGGACACGGCTGG + Exonic
925105332 2:1286114-1286136 CCCTGCCACCAGGAAACACAAGG - Intronic
934477390 2:94602583-94602605 GCCTGCCACGTGGACTCCCATGG - Exonic
934916661 2:98305737-98305759 GCCTGCAACCTGGAGACCAAGGG - Intronic
937193418 2:120127175-120127197 CCCTCCCACCTGAAAACCTAAGG - Intronic
938249111 2:129799820-129799842 CCCTGCAAACTGCACACCCAGGG - Intergenic
946478849 2:220034303-220034325 CCATGGCACCTGGCCACCCACGG - Intergenic
946691604 2:222312449-222312471 CACTGCCACTGGGACACCGGGGG - Intergenic
948178255 2:235960607-235960629 CCCTGCTACCTGAACAAAGAAGG - Intronic
1172845967 20:37930253-37930275 CCCTGTCCCCAGGATACCGAAGG - Intronic
1174474060 20:50783456-50783478 CCCTGCCACATGGACCCCAAGGG + Intergenic
1175277682 20:57783201-57783223 CCCACCCAGCTGGCCACCGAGGG - Intergenic
1175308483 20:57994414-57994436 CCGTACCACCTGGCCACAGAGGG - Intergenic
1175442641 20:59002223-59002245 CCCAGCCACCTGGGCAGTGAGGG - Intronic
1175876803 20:62234062-62234084 CCCTGCCAGCTGGACAGCGCAGG + Intronic
1176125733 20:63473666-63473688 CTGTGCCTCCTGGACACAGATGG + Intergenic
1176301079 21:5099421-5099443 CCCTGCCACGTGGCCACCACAGG + Intergenic
1176820520 21:13651383-13651405 GGCTGCCACCTGGAGACTGATGG + Intergenic
1179855950 21:44162477-44162499 CCCTGCCACGTGGCCACCACAGG - Intergenic
1180915069 22:19480083-19480105 CCCTGCCTCCCGGTCACCCACGG - Intronic
1181451835 22:23027865-23027887 CCCTTCCACATGGACACCCCAGG + Intergenic
1183767617 22:39893584-39893606 CGCCCCCACCTGGACTCCGACGG + Intronic
1184859626 22:47165754-47165776 CCCTGCCCCCCGGACCCCGGGGG + Intronic
952945071 3:38473549-38473571 TGCTGCCACCTGGAGACCCAGGG - Intronic
955360610 3:58270984-58271006 CCCAGCCACCTGGCCACCCATGG - Exonic
960922275 3:122759254-122759276 CCCTGTCATCTGGACTCCTATGG - Exonic
961318331 3:126055814-126055836 CCCTCCCACCTGCACCCCCAGGG + Intronic
961830404 3:129620172-129620194 CCCTGAGGCCTGGCCACCGAGGG + Intergenic
962152005 3:132903081-132903103 CCCTGACTCCTGGACACCTTCGG + Intergenic
962227020 3:133621641-133621663 CACTGCCACATGGATACCAAGGG + Intronic
963106012 3:141647824-141647846 GCCTGCCAGCTGGAGACCCAGGG + Intergenic
968780106 4:2573938-2573960 CCTTGTTACCTGGACACCTAAGG - Intronic
969619344 4:8271103-8271125 CCCTGCCACCTGCAAGCTGATGG - Intronic
974131430 4:57761155-57761177 CCATGCCACCTGTACACCTGAGG - Intergenic
979565805 4:122152741-122152763 CCCTGGCACCTATAAACCGAGGG + Intronic
981100084 4:140820224-140820246 CCATGGCACCTGGTCACTGATGG + Intergenic
984657496 4:182335036-182335058 AGCTGCCACCTGGGCACCAAGGG - Intronic
986276205 5:6277191-6277213 CCCTGCCGCCTGGAGACAGCTGG - Intergenic
990149804 5:52803580-52803602 AGCTGCAACCTGGACACTGAGGG - Exonic
990174770 5:53095333-53095355 CTCTGCCATCTGTACAGCGATGG - Intergenic
990342595 5:54838271-54838293 CCCTGCCACGTGGTCCCTGAGGG - Intergenic
990411042 5:55541814-55541836 CCCTCCAACCTTGACACGGAAGG - Intergenic
999501370 5:152149821-152149843 CCCTGCCTTCAGGACACAGATGG + Intergenic
1001586492 5:172836398-172836420 CCCTGACACCTGGGCACTCAGGG - Intronic
1006923401 6:37640749-37640771 CCCTGCCCCAAGGACACTGATGG - Intronic
1008888982 6:56463564-56463586 CCCTGCCACCACCACACCCAAGG - Exonic
1011193191 6:84754912-84754934 CACAGCCACCTGGAGACCTAGGG - Intronic
1017845749 6:158256875-158256897 CCCTCCCACCTTTACACAGAAGG - Intronic
1019186707 6:170224710-170224732 CCCTGCCTCCTGGGCCCCGCTGG + Intergenic
1019666385 7:2254100-2254122 CCCAGCCACCTGCTCACAGAGGG - Exonic
1019689865 7:2404326-2404348 CCCGGCCACCGAGACACCGCCGG + Intronic
1021493852 7:21250503-21250525 CCCTGACACCTGGATACAGTGGG - Intergenic
1022608911 7:31848788-31848810 CCCTGCCACTTGGCCACCAAAGG - Intronic
1026849096 7:73713863-73713885 AGCTGCCACCTGCACAGCGAAGG - Intronic
1026999650 7:74643598-74643620 TTCCGCCACCTGGAAACCGAGGG + Intergenic
1027540012 7:79454139-79454161 CCCTCCGACCTGGGCTCCGATGG + Intergenic
1029496169 7:100896385-100896407 CCGTGCCACCTGGACCCCTAAGG - Intronic
1031078769 7:117238718-117238740 GCCTGCCTCCTGGACACCCTGGG + Intergenic
1032885486 7:136133776-136133798 CCCTGGCATCTGGCCACTGAGGG - Intergenic
1035698941 8:1623248-1623270 CCAGGCCACCTGGACTCAGAAGG + Intronic
1036709427 8:11068739-11068761 CCCAGCCAGCTGGACACTGATGG + Intronic
1042875098 8:73434460-73434482 CCCTGTCACCTGAACAAGGAAGG + Intronic
1043082605 8:75784815-75784837 CCCTGCCACCTGGCCCCCTCTGG - Intergenic
1048232837 8:132660539-132660561 TCCTGCCACATGGACACAGAAGG - Intronic
1048286893 8:133148766-133148788 CCCTCCCCCATGGATACCGACGG + Intergenic
1048948358 8:139471832-139471854 TCCTGCCACCTGGCCAATGAGGG - Intergenic
1049298497 8:141856448-141856470 CCCTGCCTCCTGGCCTCCCATGG - Intergenic
1049720133 8:144111839-144111861 CCCTCCCACCTGGTCTCTGATGG + Intronic
1051882179 9:21850902-21850924 CCTTGCCACCTGGACACTTTGGG + Intronic
1052278541 9:26706309-26706331 TCCTGCCTCCTGGACTCTGATGG + Intergenic
1058873396 9:109221517-109221539 CCCTCCCACCTAGACAATGATGG - Intronic
1060532330 9:124355168-124355190 CCTTGGCCCCAGGACACCGATGG + Intronic
1061798231 9:133100803-133100825 CCCTGCTACCTTGACCCTGAGGG + Intronic
1062295829 9:135826006-135826028 CCCTGCAGCCTGGACACCGTGGG + Intronic
1062346095 9:136116012-136116034 CCCAGCCAACGGGACACGGAAGG - Exonic
1203526730 Un_GL000213v1:97538-97560 GGCTGCCACCTGGAGACTGATGG - Intergenic
1186425878 X:9464606-9464628 CCCTGCCCCCTAGAAACTGAGGG + Intronic
1193517005 X:82478364-82478386 GCCTGCCACATGGACTCAGATGG + Intergenic
1195711190 X:107775157-107775179 CCCTGCTACCTGATCAACGAGGG - Exonic
1196339745 X:114583157-114583179 CGCTGCCGCCAGGACACCGCAGG + Intergenic
1200129595 X:153833786-153833808 CCATGCCCCGTGGACACCGAAGG - Intergenic