ID: 1129890446

View in Genome Browser
Species Human (GRCh38)
Location 15:79068233-79068255
Sequence CAGCGTGAACAGAAGGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 193}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129890446_1129890453 24 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890453 15:79068280-79068302 AAGAGTTAATAGGGGGCAAGTGG 0: 1
1: 0
2: 1
3: 14
4: 137
1129890446_1129890451 16 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890451 15:79068272-79068294 TAATGGAGAAGAGTTAATAGGGG 0: 1
1: 0
2: 2
3: 21
4: 230
1129890446_1129890448 -1 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890448 15:79068255-79068277 GTTTGTTCTCTTCACTGTAATGG 0: 1
1: 0
2: 0
3: 14
4: 222
1129890446_1129890450 15 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890450 15:79068271-79068293 GTAATGGAGAAGAGTTAATAGGG 0: 1
1: 0
2: 0
3: 15
4: 198
1129890446_1129890452 17 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890452 15:79068273-79068295 AATGGAGAAGAGTTAATAGGGGG 0: 1
1: 0
2: 4
3: 18
4: 265
1129890446_1129890449 14 Left 1129890446 15:79068233-79068255 CCAGGGTCCTTCTGTTCACGCTG 0: 1
1: 0
2: 1
3: 16
4: 193
Right 1129890449 15:79068270-79068292 TGTAATGGAGAAGAGTTAATAGG 0: 1
1: 0
2: 0
3: 15
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129890446 Original CRISPR CAGCGTGAACAGAAGGACCC TGG (reversed) Intronic
900269678 1:1780748-1780770 CAGCAGGAACAGAAGGGTCCAGG + Intergenic
900750721 1:4395475-4395497 CAGCCTGAACAGAAGAAGACAGG + Intergenic
903690694 1:25171384-25171406 CAGAGTGAGCAAAGGGACCCTGG - Intergenic
903772510 1:25772777-25772799 CAGGGTGATCAGCAGGGCCCAGG - Intronic
905033396 1:34902408-34902430 CAGAGTGGACAGAGGGATCCTGG + Intronic
913149143 1:116022965-116022987 CAGCTTGAAAAGAAAGACCAAGG - Intronic
915044696 1:153002337-153002359 CAGTGTGAACAGAGGCTCCCAGG + Intronic
918771347 1:188564320-188564342 CAGCGTGAGACCAAGGACCCTGG + Intergenic
924200434 1:241652906-241652928 CAGCGTCTACAGAAGAACACTGG - Intronic
924875987 1:248105132-248105154 CAATGTGAACACATGGACCCAGG - Intergenic
1063277835 10:4590598-4590620 CAGGATGAACAGCAGGAGCCAGG + Intergenic
1064711639 10:18133042-18133064 CAGCGAGAACACATGGACACAGG - Intergenic
1065044950 10:21738817-21738839 CAGGCTGAAGAGGAGGACCCAGG - Intronic
1066232183 10:33446917-33446939 GATGGTGAAGAGAAGGACCCGGG - Intergenic
1068201315 10:53787566-53787588 CAGCATGAACAAAAGAAGCCTGG - Intergenic
1070623723 10:78033814-78033836 CAACGCGCACGGAAGGACCCCGG - Exonic
1071370712 10:84948759-84948781 CAGCGAGAACACAGGGACCCAGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1074530876 10:114297837-114297859 CAGGGTTAACAGGAGGAGCCAGG - Intronic
1075023688 10:118968601-118968623 CAGCGGGAACAGGAGGGGCCAGG + Intergenic
1076272122 10:129162933-129162955 CAGCAGGAACAGAAGGCCTCCGG + Intergenic
1077228798 11:1449629-1449651 CAGGGTGTGCAGCAGGACCCAGG + Intronic
1079098014 11:17523322-17523344 CAGAGAGCACAGAAGGCCCCAGG + Intronic
1082122669 11:48396267-48396289 CACCCTGAAAAGAAGGACACAGG - Intergenic
1082251966 11:49992405-49992427 CACCCTGAAAAGAAGGACACAGG + Intergenic
1082298582 11:50475660-50475682 CAGTGTGAACACATGGACACAGG + Intergenic
1082556373 11:54567543-54567565 CACCCTGAAAAGAAGGACACAGG - Intergenic
1082596687 11:55090317-55090339 CAATGTGAACACAAGGACACAGG + Intergenic
1083147701 11:60771350-60771372 GAGTGTGAACAGGGGGACCCAGG + Intronic
1085267607 11:75246531-75246553 CAGCCTGGACAGAAGGAACCCGG - Intergenic
1086985723 11:93247116-93247138 CAACGTGAACACATGGACACAGG + Intergenic
1088993091 11:114971485-114971507 CAGACTGAACAAAAGGAGCCAGG - Intergenic
1089365970 11:117921345-117921367 CAGTTTGTACACAAGGACCCGGG + Intronic
1089679326 11:120110578-120110600 CAGTGAGAACAGAGGGGCCCGGG + Intergenic
1091029781 11:132175343-132175365 CAGCGTGGAGAGCAGGAGCCAGG - Intronic
1092054812 12:5500039-5500061 CAGCCTAAACAGAAGGAGCCGGG + Intronic
1095032908 12:37318069-37318091 CAGCGAGAACAAATGGACACAGG - Intergenic
1097772419 12:63603565-63603587 CAGTGAGAACACATGGACCCAGG - Intronic
1098529126 12:71520664-71520686 CAGTGAGAACAGATGGACACAGG + Intronic
1100725112 12:97400348-97400370 CAGTGCGAATGGAAGGACCCAGG - Intergenic
1105751399 13:23425164-23425186 CAAGGTGAACAGGAGGCCCCAGG - Intronic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1105924843 13:24998506-24998528 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1106130902 13:26938624-26938646 CAGTGAGAACACAAGGACACAGG - Intergenic
1106304033 13:28494802-28494824 CAGCGCGCACAGCAGGACCCCGG + Exonic
1106963985 13:35037911-35037933 CACCCTGAAGAGAAGGACACAGG - Intronic
1108631606 13:52289179-52289201 CATCGTGAAGGGAAGGACACAGG - Intergenic
1108655089 13:52523416-52523438 CATCGTGAAGGGAAGGACACAGG + Intergenic
1108917721 13:55636374-55636396 CAGTGAGAACAGATGGACACAGG + Intergenic
1110337819 13:74352503-74352525 CAGTGAGAACAGATGGACACAGG + Intergenic
1111951695 13:94713203-94713225 CAGCGAGGACAGAGGGGCCCCGG - Intergenic
1113266340 13:108622301-108622323 TAGCTTGTACAGAAGAACCCTGG + Intronic
1113693615 13:112329179-112329201 CAGGGTGGACAGAAGGACCCAGG - Intergenic
1114072584 14:19126570-19126592 CACCCTGAAGAGAAGGACACAGG - Intergenic
1114089672 14:19273402-19273424 CACCCTGAAGAGAAGGACACAGG + Intergenic
1114526833 14:23371818-23371840 AAGCATGAAGAGAAGGACCTGGG + Intergenic
1116267026 14:42705479-42705501 CAGTGTGAATAGGAGGACACAGG + Intergenic
1124377058 15:29135041-29135063 CAGCATGACCAGAAGCATCCAGG - Intronic
1124399636 15:29336899-29336921 CAGCATGGACGGAAGGACCTCGG - Intronic
1124798361 15:32804704-32804726 CAGTGAGAACAGATGGACACAGG - Intronic
1125717695 15:41828363-41828385 CAACGTGAACAGAATCACCCAGG - Intronic
1125748763 15:42014703-42014725 TAGAGTGACCAGAAGGACCTGGG - Intronic
1128950422 15:71874408-71874430 TAGCTTAAACAGAAGGAACCAGG + Intronic
1129890446 15:79068233-79068255 CAGCGTGAACAGAAGGACCCTGG - Intronic
1131534029 15:93219299-93219321 CAGGAGGAACAGAAGGGCCCAGG - Intergenic
1132721367 16:1317818-1317840 CAGCGTGGAGAGGAAGACCCGGG + Intronic
1134466504 16:14483478-14483500 CAGAGTAATAAGAAGGACCCTGG - Intronic
1135021360 16:18965811-18965833 CAGAAAGAACAGAAAGACCCGGG + Intergenic
1139873667 16:70127923-70127945 CAGCGAGAACAGGAGCAGCCTGG + Intronic
1140685067 16:77425695-77425717 TAGCGTGAACCGCAGAACCCTGG + Intronic
1141152755 16:81575549-81575571 CAGAGTAAACACAAGGGCCCTGG + Intronic
1146440093 17:32886401-32886423 CAGCGTGACCAGAAGCTCACAGG - Intergenic
1148793887 17:50188131-50188153 CGGCGGGACCAGCAGGACCCTGG + Exonic
1149979916 17:61302187-61302209 CAGAGAGAACAGGAGAACCCTGG - Intronic
1150215669 17:63467573-63467595 CAGAGTTAACAGAAGCAGCCGGG + Intergenic
1151696728 17:75721709-75721731 CAGCGTGGACAGAGGGACCGGGG - Intronic
1152599195 17:81253009-81253031 CAGCCTGCAAAGGAGGACCCGGG + Intronic
1153565344 18:6413654-6413676 CAGCTCCAACAGAAGGATCCAGG + Intronic
1153672950 18:7429852-7429874 CGCAGTGAACAAAAGGACCCAGG + Intergenic
1155416409 18:25604521-25604543 CAGCCTGAACAGAATGTCCTTGG - Intergenic
1155763192 18:29591687-29591709 CAGTGAGAACACAAGGACACAGG + Intergenic
1160046565 18:75392152-75392174 GAGCAGGAACAGGAGGACCCAGG - Intergenic
1161517613 19:4705049-4705071 CAGTGTAAACACAAGGACACTGG + Intronic
1163328428 19:16620187-16620209 CAGCATAAACAGCTGGACCCAGG + Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1163704493 19:18804357-18804379 CAACTGGAACAAAAGGACCCGGG - Intergenic
1164169205 19:22709458-22709480 CGGGGAGGACAGAAGGACCCAGG + Intergenic
1165034642 19:33023923-33023945 CAGAGTGAACCGAAGGTCTCTGG - Intronic
1167151017 19:47709762-47709784 CAGCGTCATCAGCAGGACCTGGG - Intergenic
1168585471 19:57588197-57588219 GAGTGTGAACTGAAGGACCCAGG + Intronic
925389614 2:3486363-3486385 CAGGGTGACCAGAAGGAGCCAGG - Intergenic
928205160 2:29278733-29278755 GAGGGTGAATAGAAGGACTCAGG + Intronic
928480514 2:31678287-31678309 CAACGAGAACAGATGGACACAGG - Intergenic
930148375 2:48031447-48031469 CAGGGAGAACAGGATGACCCTGG - Intergenic
930551954 2:52847067-52847089 CAGTGAGAACAGATGGACACAGG - Intergenic
932049626 2:68385631-68385653 CAGTGTGAACAGATGCACTCAGG - Intronic
935568713 2:104636388-104636410 CAAAGTGATAAGAAGGACCCAGG - Intergenic
936457637 2:112687442-112687464 CCGAGTGGACAGCAGGACCCTGG - Intergenic
938486823 2:131720043-131720065 CACCCTGAAGAGAAGGACACAGG - Intergenic
944051802 2:195478498-195478520 CAACCTGAGCAGAAGCACCCAGG + Intergenic
944342756 2:198622548-198622570 CAGCCTGAACTGAAGAACCCTGG - Intergenic
947669267 2:231926205-231926227 CAGCGTGAGCAGCAGGGCGCAGG + Exonic
948182872 2:235996609-235996631 GATGGTGAACAGAAGGTCCCCGG - Intronic
948585455 2:239016148-239016170 CAGCCTGCAAAGGAGGACCCTGG + Intergenic
948591430 2:239053261-239053283 GATCCTGAACAGATGGACCCGGG - Intronic
1169688296 20:8301621-8301643 CAGCATGACCAGAAGGACAATGG - Intronic
1171238414 20:23546384-23546406 CAGGGTCAAGAGAAGGACCAAGG + Intergenic
1171243252 20:23588043-23588065 CAGGGTCAAGAGAAGGACCAAGG - Intergenic
1171262697 20:23747842-23747864 CTGGGAGAACAGAAGGTCCCTGG - Exonic
1174160587 20:48547598-48547620 CAGACTGAACAGAATCACCCTGG - Intergenic
1174479152 20:50818756-50818778 CAGAGAGAACAGAAGGATTCAGG - Intronic
1175313500 20:58028279-58028301 CAGTGGGAAGTGAAGGACCCAGG - Intergenic
1179513291 21:41889281-41889303 CGGCATCAACAGAAAGACCCAGG - Exonic
1179974882 21:44859063-44859085 CAGCAGCACCAGAAGGACCCAGG + Intronic
1180351222 22:11805909-11805931 CAACGAGAACACAAGGACACAGG + Intergenic
1180386977 22:12186166-12186188 CAACGAGAACACAAGGACACAGG - Intergenic
1180491032 22:15848945-15848967 CACCCTGAAGAGAAGGACACAGG - Intergenic
1180940483 22:19657289-19657311 CAAGGTGAACAGGAGGCCCCAGG + Intergenic
1181698039 22:24603716-24603738 CAGCATGAACAGACAGGCCCTGG + Intronic
1184538803 22:45106302-45106324 GAGCGAGAACTGAAGGGCCCTGG + Intergenic
1184775188 22:46619637-46619659 CAGAGTGAACAGGAGGACCGGGG - Intronic
1184891847 22:47384530-47384552 CATTGTGAAGAGAAGGAGCCAGG + Intergenic
949506231 3:4730655-4730677 GAGGGTGAACAGCAAGACCCTGG - Intronic
949648995 3:6133046-6133068 GAGAGGGAAAAGAAGGACCCTGG + Intergenic
950178525 3:10894164-10894186 CAGTGGGAGCAGCAGGACCCAGG - Intronic
951417323 3:22440716-22440738 GAGAGTGATCAGAAAGACCCAGG + Intergenic
952887530 3:38020760-38020782 CAGAGTGAACTGAAGGAAGCTGG + Intronic
953455764 3:43040918-43040940 CAACGAGAACACAAGGACACAGG - Intronic
953720743 3:45352718-45352740 CAGCGTGCAAAGGAGGAGCCTGG - Intergenic
956124285 3:65996822-65996844 CACCCTGAACTGAAGGCCCCGGG + Intronic
956652986 3:71522216-71522238 CAGCGTGGACAGATGAGCCCAGG - Intronic
957153548 3:76518214-76518236 CAGTATGACCTGAAGGACCCAGG + Intronic
957785323 3:84875039-84875061 CAGCGTGAACAGAGGGCCTATGG - Intergenic
959645638 3:108697179-108697201 CAGTGAGAACACAAGGACACAGG + Intergenic
959829692 3:110845643-110845665 CAACGAGAACAGATGGACACAGG + Intergenic
960404232 3:117239276-117239298 CAACCTGAAGAGAAGGACACAGG + Intergenic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961799191 3:129431939-129431961 AAGCCTGAACTGAAGGACCATGG - Intronic
963935633 3:151049748-151049770 CAGAGACAACACAAGGACCCAGG - Intergenic
967707898 3:192673582-192673604 CAGCGAGAACACATGGACACAGG - Intronic
969510013 4:7612404-7612426 CATCGTGGCCAGAAGGACCGAGG - Intronic
969689781 4:8698131-8698153 CAGTGTGGACAGATGGACCCGGG - Intergenic
970804895 4:20019193-20019215 CAGCGAGAACACATGGACACAGG + Intergenic
973322340 4:48823337-48823359 CAGCGAGAACACATGGACACAGG + Intronic
980960479 4:139470116-139470138 CACCCTGAAGAGAAGGACACAGG - Intronic
985655668 5:1130335-1130357 CAGCGAGGACAGGAGGACCCAGG + Intergenic
985825543 5:2188072-2188094 CAGCGAGAAGAGAAGGACCTGGG - Intergenic
985966237 5:3340623-3340645 CAGCCTGGACAGGAGGGCCCTGG + Intergenic
986506845 5:8460324-8460346 CAGGGTGTAAAGAAGGCCCCAGG - Intergenic
986657497 5:10030143-10030165 CATCCTGAAAAGAAGGACACAGG - Intergenic
989429227 5:41332891-41332913 CAGTGTGAACACATGGACACAGG + Intronic
990318503 5:54607215-54607237 CAGTGCCAACAGAAGAACCCAGG - Intergenic
996119730 5:119657496-119657518 CAGCGAGAACACATGGACACAGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002163131 5:177328515-177328537 CAGAGGGTGCAGAAGGACCCAGG + Intergenic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1007264241 6:40585367-40585389 CAGCATCAGCAGAAGGGCCCAGG + Intronic
1008261782 6:49375009-49375031 CAGCATGAAAAGAAGGAAACTGG - Intergenic
1013183738 6:107739526-107739548 CAACTTGAACAGAACAACCCTGG + Intronic
1017644441 6:156526246-156526268 CAATGTGAACACATGGACCCAGG - Intergenic
1018622664 6:165746609-165746631 GCGCGTGCACAGAAGCACCCAGG - Intronic
1019346845 7:535288-535310 CAGGGTGAAGAGGAGGAGCCGGG - Intergenic
1019444616 7:1064857-1064879 CAGGGCGCACAGAAGGCCCCAGG + Intronic
1021586854 7:22218127-22218149 CAGTGAGAACACAAGGACACAGG + Intronic
1022365820 7:29715072-29715094 CAGTGAGAACAGATGGACACAGG + Intergenic
1022556288 7:31301144-31301166 CAACGTGAACACATGGACACAGG - Intergenic
1025009319 7:55383154-55383176 CAGCGTGAGACAAAGGACCCTGG - Intronic
1026186654 7:68087050-68087072 CACCGTGAACAGAAGTAGCTTGG + Intergenic
1028401166 7:90427296-90427318 CAGAGTGAACATAAGAGCCCAGG + Intronic
1028590229 7:92485291-92485313 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1029114114 7:98228690-98228712 CAGTAGGAACAGAGGGACCCTGG + Intronic
1029827867 7:103219756-103219778 CAGTGAGAACAGATGGACACAGG - Intergenic
1030312159 7:108079747-108079769 CAACGTGAACAGCAGGACTCTGG + Exonic
1031730917 7:125299543-125299565 CCCCGTGAGCAGAAGGAGCCAGG + Intergenic
1031846954 7:126816882-126816904 AAGCGTGAATAGAAGGACTATGG - Intronic
1034064387 7:148122496-148122518 GAGACTGAACCGAAGGACCCAGG + Intronic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1035319234 7:158017757-158017779 CAGCAGGGACAGAAGGACGCAGG + Intronic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1037079963 8:14772622-14772644 CAGTGAGAACACATGGACCCAGG - Intronic
1037739254 8:21592290-21592312 CAGCATGAGCAGAAGGACAGAGG + Intergenic
1037812424 8:22094988-22095010 CAGCTTGGAGAGAGGGACCCAGG - Intronic
1038362971 8:26901454-26901476 TAGCGTGAACCATAGGACCCTGG - Intergenic
1043066337 8:75575796-75575818 CAACGAGAACACATGGACCCAGG - Intergenic
1048378783 8:133845853-133845875 CAGGAAGAACATAAGGACCCTGG - Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049523249 8:143106017-143106039 CAGTGAGAACACAAGGACACAGG + Intergenic
1050287024 9:4114127-4114149 CAGAGTGAGTAGAGGGACCCAGG - Intronic
1051005792 9:12342063-12342085 CAGTGAGAACACAAGGACACAGG + Intergenic
1051209628 9:14728046-14728068 CAGGGTGAAAAGAAGGACCGTGG - Intergenic
1053834546 9:42120769-42120791 CAGCGAGAACACATGGACACAGG + Intronic
1057299539 9:93869949-93869971 GAGAGTGAACAGAAGGCCCTAGG - Intergenic
1058528378 9:105882601-105882623 CAGCGAGAACACATGGACACAGG - Intergenic
1059379252 9:113910339-113910361 CAGAGTGAAGAGCAGGAACCAGG - Intronic
1060597702 9:124858083-124858105 CAGGGTGAATCCAAGGACCCAGG + Intronic
1061753313 9:132795702-132795724 CAGCGTGAACTTCAGGAGCCCGG - Intronic
1062143144 9:134971334-134971356 CAGCGTCATCAGACGGGCCCTGG + Intergenic
1203688708 Un_GL000214v1:21843-21865 CAACGAGAACACAAGGACACAGG + Intergenic
1203647567 Un_KI270751v1:82210-82232 CAACGAGAACACAAGGACACAGG - Intergenic
1187284842 X:17895178-17895200 CAGCAGGAACAGAAGTATCCTGG - Intergenic
1189594821 X:42553031-42553053 CAGCGTGAACACATGGGCACAGG - Intergenic
1190538829 X:51456719-51456741 CAGCGTGAGACCAAGGACCCTGG + Intergenic
1190622839 X:52305177-52305199 CAACGAGAACACAAGGACACAGG - Intergenic
1190691782 X:52918669-52918691 CAGCGTCGACAGCAGGACCTGGG - Intergenic
1190694201 X:52937123-52937145 CAGCGTCGACAGCAGGACCTGGG + Intronic
1192237445 X:69304975-69304997 CAGCGAGAACACAGGGACACAGG + Intergenic
1193353098 X:80484386-80484408 CAGCGTGAGGCAAAGGACCCTGG + Intergenic
1195336172 X:103857141-103857163 CAGCGTGAGACAAAGGACCCTGG - Intergenic
1195844592 X:109212348-109212370 CAGCGAGAACACATGGACACAGG + Intergenic
1199437737 X:147832064-147832086 CAACGTGAACACATGGACACAGG + Intergenic
1199671944 X:150155010-150155032 CAGGATGCACAGAAGGACCAGGG - Intergenic