ID: 1129892145

View in Genome Browser
Species Human (GRCh38)
Location 15:79078401-79078423
Sequence CGGCATGAGCACGTGCAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129892145_1129892150 -7 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892150 15:79078417-79078439 CATGCCGTGGTGTACAGTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 95
1129892145_1129892148 -9 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892148 15:79078415-79078437 CTCATGCCGTGGTGTACAGTGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1129892145_1129892147 -10 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892147 15:79078414-79078436 GCTCATGCCGTGGTGTACAGTGG 0: 1
1: 0
2: 3
3: 4
4: 89
1129892145_1129892149 -8 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892149 15:79078416-79078438 TCATGCCGTGGTGTACAGTGGGG 0: 1
1: 0
2: 0
3: 1
4: 70
1129892145_1129892152 23 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892152 15:79078447-79078469 AAGCACATTATTCCCAAGTCAGG 0: 1
1: 0
2: 1
3: 6
4: 130
1129892145_1129892153 24 Left 1129892145 15:79078401-79078423 CCTGGCTGCACGTGCTCATGCCG 0: 1
1: 0
2: 1
3: 4
4: 119
Right 1129892153 15:79078448-79078470 AGCACATTATTCCCAAGTCAGGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129892145 Original CRISPR CGGCATGAGCACGTGCAGCC AGG (reversed) Intronic
900324505 1:2101695-2101717 TGACATGAGCCCGTGCATCCTGG + Intronic
900623605 1:3598333-3598355 GTGCATGAGCACGTGCTTCCGGG - Intronic
901828457 1:11878093-11878115 CGGCATGACCATCAGCAGCCTGG + Intergenic
903016848 1:20366969-20366991 CGGGATTGGCACGTGCAGGCGGG + Intergenic
905546458 1:38804121-38804143 CGGCCCGAGCGCGCGCAGCCCGG + Intergenic
906209234 1:44002967-44002989 CAGCTTCAGCACGTACAGCCTGG + Exonic
910373441 1:86543164-86543186 GGCAATGAGCACATGCAGCCTGG - Intergenic
912452287 1:109774434-109774456 CTGGATGAGCAAATGCAGCCTGG - Intronic
918066627 1:181105779-181105801 CGGGGGCAGCACGTGCAGCCGGG - Intergenic
920871252 1:209797092-209797114 AGGCATGAGCCCCTGCACCCAGG - Intronic
924243280 1:242059735-242059757 AGGCATGAAGAAGTGCAGCCAGG - Intergenic
924479682 1:244417306-244417328 CACCATGAGCATGTACAGCCGGG - Intronic
1062837661 10:646478-646500 CGGCAGGAGCAGGTGCTACCTGG - Intronic
1063524524 10:6772579-6772601 AGGCACAAGAACGTGCAGCCCGG - Intergenic
1066460269 10:35607356-35607378 CGGCAGGAGCACTTGAGGCCAGG + Intronic
1067064573 10:43096556-43096578 CGGCCAGTGCAGGTGCAGCCAGG - Intronic
1069601233 10:69709517-69709539 CAGAATCAGCAGGTGCAGCCTGG + Intergenic
1069802547 10:71091009-71091031 TGGCATGGGCATGTGCAGTCTGG - Intergenic
1070461492 10:76674922-76674944 AGTCTTGAGCAAGTGCAGCCTGG + Intergenic
1071426145 10:85555036-85555058 AGGCATGAGTAGGTGGAGCCCGG + Intergenic
1071713336 10:88071131-88071153 CGGCAAGAGCATATGCAGTCAGG + Intergenic
1072995058 10:100236334-100236356 CGGGAGGAGCACTTGAAGCCAGG - Intronic
1074118999 10:110479325-110479347 CGGGATGATCACTTGAAGCCAGG - Intergenic
1077308798 11:1879525-1879547 GGGCCTGAGCACGTCCAGGCAGG - Intronic
1077414599 11:2418891-2418913 CAGCATGAGCGCGTGCAGTGTGG - Intronic
1081652334 11:44832722-44832744 AGGCAGGAGCAGGTGCAGCAAGG - Intronic
1084445803 11:69202833-69202855 CGGCAGGAGCAAGAGCCGCCAGG - Intergenic
1084709082 11:70832841-70832863 CCCCACGAGCAGGTGCAGCCAGG + Intronic
1086152124 11:83623536-83623558 AGGAAAGAGCACGTGAAGCCTGG + Intronic
1089076028 11:115739484-115739506 CGGCAGGAGCAAGAGCAGCCCGG + Intergenic
1097183412 12:57183803-57183825 GGGCCTGAGCACGATCAGCCGGG + Exonic
1097248835 12:57621342-57621364 GGACAAGAGCACGTGCAGCGCGG - Exonic
1098281574 12:68867774-68867796 CAGCATGAGCAGTGGCAGCCTGG - Intronic
1103845342 12:123898301-123898323 CGGGAGGAGCACGTGAACCCAGG - Intronic
1104439663 12:128784599-128784621 CGGAGTGACCACGTGCAGCAGGG + Intergenic
1108115067 13:47118592-47118614 TGGCATGTGCACGGGCAGCAAGG + Intergenic
1110283238 13:73719827-73719849 AGGCAGGATCACGTGAAGCCAGG - Intronic
1111002616 13:82205375-82205397 CTGCTTGAGCATGTGCAGCCTGG - Intergenic
1113357267 13:109592985-109593007 TGGCATGAGCACATTCAGCCTGG - Intergenic
1113961349 13:114128003-114128025 CGGCAGGGGCAGGTTCAGCCTGG - Intronic
1118355737 14:65012015-65012037 CGCAATGAGCACACGCAGCCAGG - Intronic
1119674359 14:76542755-76542777 CAGGAAGAGCACGTGAAGCCAGG + Intergenic
1120167368 14:81215806-81215828 CGGGAGGATCACTTGCAGCCAGG + Intronic
1125353640 15:38793424-38793446 AGGCGTGAGCACTTGCAGGCTGG - Intergenic
1127665019 15:61137500-61137522 GGCCATGGGCACGTGCTGCCAGG - Intronic
1128475250 15:67991740-67991762 CGGCATGAGCCCCTGCAGCCTGG + Intergenic
1129246989 15:74285397-74285419 TGGGATGACCACGTGCTGCCAGG - Intronic
1129892145 15:79078401-79078423 CGGCATGAGCACGTGCAGCCAGG - Intronic
1131977377 15:97960484-97960506 CGGCCTGTGCACGTGCACGCCGG + Intergenic
1136184429 16:28578079-28578101 CGGGAGGATCACTTGCAGCCAGG - Intronic
1137459374 16:48645951-48645973 AGGCATGAGCCACTGCAGCCGGG + Intergenic
1138599175 16:58045111-58045133 TGCCAGGAGCACGTGGAGCCAGG + Exonic
1139591102 16:67933712-67933734 CGGCCTGGGGATGTGCAGCCCGG + Intronic
1145876450 17:28321857-28321879 AGGCATTAGCACGGGCATCCTGG + Intronic
1148027444 17:44598496-44598518 GGGCATGCGCACTTGCAGCTTGG + Intergenic
1151786126 17:76275892-76275914 CGGCCTGTGCACGTGGGGCCTGG + Exonic
1152650879 17:81492103-81492125 CAGCAGGAGCAGGTGTAGCCAGG + Intergenic
1162462846 19:10823650-10823672 CAGCATGACCAGGTGAAGCCTGG + Intronic
1162578745 19:11514748-11514770 CGGGATGATCACTTGAAGCCAGG - Intronic
1162787121 19:13042583-13042605 CGGAAAGATCACTTGCAGCCAGG - Intronic
1163937188 19:20457676-20457698 AGGCATGAGCCAGTGCACCCAGG + Intergenic
1164145741 19:22511477-22511499 AGCCATGAGCACCTGAAGCCTGG + Intronic
1165110378 19:33498783-33498805 CGGCATGGGCACCTGCCTCCAGG - Intronic
1167604928 19:50476570-50476592 CAGCAAGAGCAGGAGCAGCCGGG - Exonic
1167958198 19:53084923-53084945 CGGCATGGTCACAGGCAGCCAGG + Intronic
931280349 2:60785757-60785779 CGGGAGGATCACGTGAAGCCAGG - Intronic
941661200 2:168197083-168197105 GGGCAAGAGCAGGTACAGCCTGG + Intronic
941998025 2:171619904-171619926 AGGCATGAGCCCCTGCACCCAGG + Intergenic
946727024 2:222671404-222671426 CGGCAGGAGCCCGCGCTGCCCGG + Intergenic
946760997 2:222992947-222992969 AGGCAGGAGCACCTGGAGCCTGG + Intergenic
947156223 2:227164746-227164768 CAGCAGGAGCACCTGCGGCCTGG - Exonic
1173947922 20:46966212-46966234 CGGCAGGATCACGTGAACCCAGG - Intronic
1174988883 20:55487407-55487429 AGGCATGAGCCACTGCAGCCAGG - Intergenic
1175160666 20:57005386-57005408 CAGCCTGAGCAGGTGCATCCTGG + Intergenic
1178814606 21:35916983-35917005 AGGCATGAATATGTGCAGCCAGG + Intronic
1179156448 21:38855767-38855789 CGGCGTGAGCAAGTGGAGCCAGG + Intergenic
1181981022 22:26766550-26766572 CGGGAGGAGCACTTACAGCCTGG - Intergenic
1183007769 22:34917481-34917503 AGGATGGAGCACGTGCAGCCAGG + Intergenic
1184029534 22:41883789-41883811 CTGGATGAGCACGGGAAGCCTGG + Intronic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185370809 22:50460079-50460101 CCGCATGACCATGAGCAGCCTGG - Exonic
955162308 3:56476263-56476285 AGGTATGAGCAACTGCAGCCTGG - Intergenic
957576462 3:82014665-82014687 CGGCAGGAGCTAGAGCAGCCTGG - Intergenic
962470480 3:135703541-135703563 AGGCTTGAGAACATGCAGCCTGG + Intergenic
966159964 3:176957491-176957513 GGTCATGAGCAGGTGCATCCTGG - Intergenic
967807776 3:193730656-193730678 CGGCATGGCTAGGTGCAGCCTGG + Intergenic
968685915 4:1958494-1958516 CAGCAGGAGGAAGTGCAGCCAGG + Intronic
982774963 4:159431766-159431788 AGGCATGAGCAACTGCACCCAGG + Intergenic
987088193 5:14488200-14488222 CCGCATGAGCACGTGCTCCTCGG + Exonic
991945563 5:71895380-71895402 CGGCATGAACATCTCCAGCCAGG + Intergenic
998307867 5:141096763-141096785 CACCAGGAGCACGTGCAGCGTGG - Exonic
998310408 5:141123962-141123984 CACCAGGAGCACGTGCAGCGTGG - Exonic
998311566 5:141137398-141137420 CACCAGGAGCACGTGCAGCGTGG - Exonic
998312848 5:141152218-141152240 CACCAGGAGCACGTGCAGCGTGG - Exonic
998313542 5:141157967-141157989 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998315036 5:141174802-141174824 CACCAGGAGCACGTGCAGCGTGG - Exonic
998315613 5:141180004-141180026 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316153 5:141184526-141184548 CACCAGGAGCACGTGCAGCGTGG - Exonic
998316711 5:141189285-141189307 CACCAGGAGCACGTGCAGCGTGG - Exonic
998318975 5:141210874-141210896 CACCAGGAGCACGTGCAGCGTGG - Exonic
998319540 5:141216090-141216112 CACCAGGAGCACGTGCAGCGTGG - Exonic
998320517 5:141225472-141225494 CACCAGGAGCACGTGCAGCGTGG - Exonic
998321530 5:141236521-141236543 CACCAGGAGCACGTGCAGCGTGG - Intergenic
998322090 5:141241877-141241899 CACCAGGAGCACGTGCAGCGTGG - Intergenic
1001655475 5:173345506-173345528 CAGCATGAGGGTGTGCAGCCTGG - Intergenic
1002715523 5:181224329-181224351 TGGCATGAGCAGGTCCAGCTGGG + Exonic
1004336455 6:14768944-14768966 AGGCATGAGCGCGTCCACCCTGG - Intergenic
1005397058 6:25393644-25393666 CGGGATGATCACTTGAAGCCAGG + Intronic
1025928484 7:65977418-65977440 AGGCATGAGCCAGTGCACCCAGG + Intronic
1036617935 8:10403370-10403392 TGGCATGAGCATGTGGAGCTAGG - Intronic
1037578560 8:20230825-20230847 GGGCATGAGCAGCTGCTGCCTGG - Intergenic
1037891670 8:22626996-22627018 TGGCAGGAGCCCATGCAGCCAGG - Intronic
1043938202 8:86167517-86167539 AGGCATGAGCCACTGCAGCCCGG - Intergenic
1046659940 8:116938360-116938382 CGGCAGGAGCACGGACATCCAGG + Exonic
1048988054 8:139745877-139745899 CGCCATGGGCACGTGGAGGCGGG - Intronic
1050120108 9:2299312-2299334 AGGCCTGAGCACCTGCACCCTGG - Intergenic
1059323801 9:113489755-113489777 CAGAAGGAGCACTTGCAGCCAGG - Intronic
1060316625 9:122517303-122517325 TGGAGTGAGCAGGTGCAGCCGGG + Intergenic
1062584497 9:137243000-137243022 GGGCATGAAGAAGTGCAGCCGGG - Exonic
1192202387 X:69074859-69074881 GGGCATCAGCACCTGCAGGCTGG - Intergenic
1200110199 X:153737056-153737078 GGGAATGAGGGCGTGCAGCCAGG + Intronic
1200183947 X:154169685-154169707 CGGCAGGAGCCCGCCCAGCCTGG - Intergenic
1200189601 X:154206813-154206835 CGGCAGGAGCCCGCCCAGCCTGG - Intergenic
1200195354 X:154244622-154244644 CGGCAGGAGCCCGCCCAGCCTGG - Intergenic
1200201006 X:154281743-154281765 CGGCAGGAGCCCGCCCAGCCTGG - Intronic