ID: 1129898759

View in Genome Browser
Species Human (GRCh38)
Location 15:79129516-79129538
Sequence CCTTATCTTGAAAAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129898759_1129898764 -2 Left 1129898759 15:79129516-79129538 CCCTCCAGCTTTTCAAGATAAGG No data
Right 1129898764 15:79129537-79129559 GGGCCTTTTTAAATGCCTCATGG No data
1129898759_1129898766 8 Left 1129898759 15:79129516-79129538 CCCTCCAGCTTTTCAAGATAAGG No data
Right 1129898766 15:79129547-79129569 AAATGCCTCATGGAACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129898759 Original CRISPR CCTTATCTTGAAAAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr