ID: 1129898766

View in Genome Browser
Species Human (GRCh38)
Location 15:79129547-79129569
Sequence AAATGCCTCATGGAACCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129898759_1129898766 8 Left 1129898759 15:79129516-79129538 CCCTCCAGCTTTTCAAGATAAGG No data
Right 1129898766 15:79129547-79129569 AAATGCCTCATGGAACCCTCTGG No data
1129898763_1129898766 4 Left 1129898763 15:79129520-79129542 CCAGCTTTTCAAGATAAGGGCCT No data
Right 1129898766 15:79129547-79129569 AAATGCCTCATGGAACCCTCTGG No data
1129898761_1129898766 7 Left 1129898761 15:79129517-79129539 CCTCCAGCTTTTCAAGATAAGGG No data
Right 1129898766 15:79129547-79129569 AAATGCCTCATGGAACCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129898766 Original CRISPR AAATGCCTCATGGAACCCTC TGG Intergenic
No off target data available for this crispr