ID: 1129900663

View in Genome Browser
Species Human (GRCh38)
Location 15:79145945-79145967
Sequence GTGCACACACACTGCTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129900663_1129900666 -4 Left 1129900663 15:79145945-79145967 CCAGGAAAGCAGTGTGTGTGCAC No data
Right 1129900666 15:79145964-79145986 GCACATGTTAGGTATTCAAAGGG No data
1129900663_1129900665 -5 Left 1129900663 15:79145945-79145967 CCAGGAAAGCAGTGTGTGTGCAC No data
Right 1129900665 15:79145963-79145985 TGCACATGTTAGGTATTCAAAGG No data
1129900663_1129900667 -1 Left 1129900663 15:79145945-79145967 CCAGGAAAGCAGTGTGTGTGCAC No data
Right 1129900667 15:79145967-79145989 CATGTTAGGTATTCAAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129900663 Original CRISPR GTGCACACACACTGCTTTCC TGG (reversed) Intergenic
No off target data available for this crispr