ID: 1129905285

View in Genome Browser
Species Human (GRCh38)
Location 15:79182948-79182970
Sequence TTGTCTCTGAAAAAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129905285_1129905288 -2 Left 1129905285 15:79182948-79182970 CCTTCCTTCTTTTTCAGAGACAA No data
Right 1129905288 15:79182969-79182991 AAGGTCTTGCTCTGTTGTCCAGG 0: 51
1: 1095
2: 8235
3: 32183
4: 85650
1129905285_1129905289 2 Left 1129905285 15:79182948-79182970 CCTTCCTTCTTTTTCAGAGACAA No data
Right 1129905289 15:79182973-79182995 TCTTGCTCTGTTGTCCAGGCTGG 0: 1039
1: 23881
2: 73820
3: 161770
4: 215455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129905285 Original CRISPR TTGTCTCTGAAAAAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr