ID: 1129906006

View in Genome Browser
Species Human (GRCh38)
Location 15:79187618-79187640
Sequence ATTCCAGCTGGAGCACCCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906006_1129906013 -6 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906013 15:79187635-79187657 TGGAATCAGAGAGAGGGTGGGGG No data
1129906006_1129906015 22 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906015 15:79187663-79187685 ACTCCGCTCACTTCCTCCCAGGG No data
1129906006_1129906014 21 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906014 15:79187662-79187684 TACTCCGCTCACTTCCTCCCAGG No data
1129906006_1129906012 -7 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906012 15:79187634-79187656 CTGGAATCAGAGAGAGGGTGGGG No data
1129906006_1129906010 -9 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906010 15:79187632-79187654 AGCTGGAATCAGAGAGAGGGTGG No data
1129906006_1129906011 -8 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906011 15:79187633-79187655 GCTGGAATCAGAGAGAGGGTGGG No data
1129906006_1129906017 25 Left 1129906006 15:79187618-79187640 CCAATGGGTGCTCCAGCTGGAAT No data
Right 1129906017 15:79187666-79187688 CCGCTCACTTCCTCCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906006 Original CRISPR ATTCCAGCTGGAGCACCCAT TGG (reversed) Intergenic
No off target data available for this crispr