ID: 1129906446 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 15:79190991-79191013 |
| Sequence | CAACTGTGACCCTGGGGCCG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1129906446_1129906450 | -4 | Left | 1129906446 | 15:79190991-79191013 | CCTCGGCCCCAGGGTCACAGTTG | No data | ||
| Right | 1129906450 | 15:79191010-79191032 | GTTGACCTGCACCTCTCTCTTGG | No data | ||||
| 1129906446_1129906454 | 19 | Left | 1129906446 | 15:79190991-79191013 | CCTCGGCCCCAGGGTCACAGTTG | No data | ||
| Right | 1129906454 | 15:79191033-79191055 | ATTTGAAGACAAGCGTCAGGTGG | No data | ||||
| 1129906446_1129906453 | 16 | Left | 1129906446 | 15:79190991-79191013 | CCTCGGCCCCAGGGTCACAGTTG | No data | ||
| Right | 1129906453 | 15:79191030-79191052 | TGGATTTGAAGACAAGCGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1129906446 | Original CRISPR | CAACTGTGACCCTGGGGCCG AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||