ID: 1129906446

View in Genome Browser
Species Human (GRCh38)
Location 15:79190991-79191013
Sequence CAACTGTGACCCTGGGGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906446_1129906450 -4 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG No data
1129906446_1129906454 19 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906446_1129906453 16 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906446 Original CRISPR CAACTGTGACCCTGGGGCCG AGG (reversed) Intergenic