ID: 1129906449 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:79190999-79191021 |
Sequence | GTGCAGGTCAACTGTGACCC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1129906449_1129906453 | 8 | Left | 1129906449 | 15:79190999-79191021 | CCAGGGTCACAGTTGACCTGCAC | No data | ||
Right | 1129906453 | 15:79191030-79191052 | TGGATTTGAAGACAAGCGTCAGG | No data | ||||
1129906449_1129906454 | 11 | Left | 1129906449 | 15:79190999-79191021 | CCAGGGTCACAGTTGACCTGCAC | No data | ||
Right | 1129906454 | 15:79191033-79191055 | ATTTGAAGACAAGCGTCAGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1129906449 | Original CRISPR | GTGCAGGTCAACTGTGACCC TGG (reversed) | Intergenic | ||