ID: 1129906449

View in Genome Browser
Species Human (GRCh38)
Location 15:79190999-79191021
Sequence GTGCAGGTCAACTGTGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906449_1129906453 8 Left 1129906449 15:79190999-79191021 CCAGGGTCACAGTTGACCTGCAC No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906449_1129906454 11 Left 1129906449 15:79190999-79191021 CCAGGGTCACAGTTGACCTGCAC No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906449 Original CRISPR GTGCAGGTCAACTGTGACCC TGG (reversed) Intergenic