ID: 1129906450

View in Genome Browser
Species Human (GRCh38)
Location 15:79191010-79191032
Sequence GTTGACCTGCACCTCTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906447_1129906450 -10 Left 1129906447 15:79190997-79191019 CCCCAGGGTCACAGTTGACCTGC No data
Right 1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG No data
1129906440_1129906450 24 Left 1129906440 15:79190963-79190985 CCCAAACAAATGGGTGTGGTTGA No data
Right 1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG No data
1129906446_1129906450 -4 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG No data
1129906441_1129906450 23 Left 1129906441 15:79190964-79190986 CCAAACAAATGGGTGTGGTTGAC No data
Right 1129906450 15:79191010-79191032 GTTGACCTGCACCTCTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906450 Original CRISPR GTTGACCTGCACCTCTCTCT TGG Intergenic