ID: 1129906451

View in Genome Browser
Species Human (GRCh38)
Location 15:79191015-79191037
Sequence CAAATCCAAGAGAGAGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906451_1129906456 19 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906456 15:79191057-79191079 TGTAACTAATGCTGACTGGCAGG No data
1129906451_1129906454 -5 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906454 15:79191033-79191055 ATTTGAAGACAAGCGTCAGGTGG No data
1129906451_1129906453 -8 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906451_1129906458 25 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906458 15:79191063-79191085 TAATGCTGACTGGCAGGCGGTGG No data
1129906451_1129906455 15 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906455 15:79191053-79191075 TGGCTGTAACTAATGCTGACTGG No data
1129906451_1129906457 22 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906457 15:79191060-79191082 AACTAATGCTGACTGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906451 Original CRISPR CAAATCCAAGAGAGAGGTGC AGG (reversed) Intergenic