ID: 1129906452

View in Genome Browser
Species Human (GRCh38)
Location 15:79191021-79191043
Sequence TGTCTTCAAATCCAAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906452_1129906456 13 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906456 15:79191057-79191079 TGTAACTAATGCTGACTGGCAGG No data
1129906452_1129906458 19 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906458 15:79191063-79191085 TAATGCTGACTGGCAGGCGGTGG No data
1129906452_1129906455 9 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906455 15:79191053-79191075 TGGCTGTAACTAATGCTGACTGG No data
1129906452_1129906459 27 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906459 15:79191071-79191093 ACTGGCAGGCGGTGGCTGTGTGG No data
1129906452_1129906457 16 Left 1129906452 15:79191021-79191043 CCTCTCTCTTGGATTTGAAGACA No data
Right 1129906457 15:79191060-79191082 AACTAATGCTGACTGGCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906452 Original CRISPR TGTCTTCAAATCCAAGAGAG AGG (reversed) Intergenic