ID: 1129906453

View in Genome Browser
Species Human (GRCh38)
Location 15:79191030-79191052
Sequence TGGATTTGAAGACAAGCGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1129906448_1129906453 9 Left 1129906448 15:79190998-79191020 CCCAGGGTCACAGTTGACCTGCA No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906449_1129906453 8 Left 1129906449 15:79190999-79191021 CCAGGGTCACAGTTGACCTGCAC No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906446_1129906453 16 Left 1129906446 15:79190991-79191013 CCTCGGCCCCAGGGTCACAGTTG No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906451_1129906453 -8 Left 1129906451 15:79191015-79191037 CCTGCACCTCTCTCTTGGATTTG No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data
1129906447_1129906453 10 Left 1129906447 15:79190997-79191019 CCCCAGGGTCACAGTTGACCTGC No data
Right 1129906453 15:79191030-79191052 TGGATTTGAAGACAAGCGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1129906453 Original CRISPR TGGATTTGAAGACAAGCGTC AGG Intergenic